ID: 1008876481

View in Genome Browser
Species Human (GRCh38)
Location 6:56335238-56335260
Sequence CTAAATATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 3, 1: 17, 2: 55, 3: 124, 4: 653}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008876479_1008876481 12 Left 1008876479 6:56335203-56335225 CCTCTCTCTATAGATGGTCTCTG 0: 1
1: 1
2: 1
3: 13
4: 162
Right 1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG 0: 3
1: 17
2: 55
3: 124
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008876481 Original CRISPR CTAAATATACAAATGGACAA TGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
903863947 1:26384151-26384173 CCAAATTTAAAAATGGGCAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905248810 1:36634027-36634049 GAAGATATACAAATGGTCAATGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905510064 1:38512144-38512166 GTAAACAAACAAATGGATAACGG + Intergenic
905540892 1:38759679-38759701 CTAAAGATACAAATGGTAATGGG + Intergenic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
907015401 1:51007228-51007250 CTAAATATAGAAAGGAAAAATGG + Intergenic
907040953 1:51258904-51258926 CTAAATATACAAAGGCCCAGTGG - Intronic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908577782 1:65479160-65479182 GTAATTTTACAAATGGAAAAAGG + Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
909690344 1:78399518-78399540 CTAAATATCCAAGGGGACTAGGG - Intronic
910127214 1:83856108-83856130 TTAAATATAAAATTGGACCAAGG + Intergenic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911153903 1:94621133-94621155 TTAAATATATAAATGAATAAAGG - Intergenic
911156220 1:94639859-94639881 CCAAATTTTTAAATGGACAAAGG + Intergenic
911586820 1:99700885-99700907 CAAAATTTAAAAATGGGCAAAGG - Intergenic
911846236 1:102754767-102754789 CCAAATAGAAAAATGCACAATGG + Intergenic
912269011 1:108190558-108190580 CTAAATATACGAAGAGATAATGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912708138 1:111929969-111929991 CTAAATTTAGCAAAGGACAATGG - Intronic
912902250 1:113664129-113664151 GTAAAAAGACAAATGGAGAATGG - Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913024114 1:114818456-114818478 CTAAATTTAAAAATGGGTAAAGG - Intergenic
913390482 1:118305492-118305514 TAAAATTTACAAATGTACAAAGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917099322 1:171429822-171429844 CTAAATTTACAAAATCACAAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
918749492 1:188255084-188255106 GAAGATATACAAATGGCCAATGG - Intergenic
918843271 1:189573069-189573091 CTACGTTTACCAATGGACAATGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919541778 1:198855926-198855948 CTAAAGAGACAAATGAACAGTGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
920770081 1:208875779-208875801 CTAAATCTACAAATATCCAAAGG - Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921809126 1:219491793-219491815 CTAAAAGTGCAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
921975864 1:221202430-221202452 CTAAAAATACAAAGGTATAAAGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
923415433 1:233753372-233753394 CTAAAAAAATAAATGGACACAGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923474161 1:234317202-234317224 CTAAATAAATAAAAGTACAACGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924495034 1:244579664-244579686 AAAAATATACAAATGACCAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1063247880 10:4242081-4242103 ATAAATAAATAAATGCACAAAGG - Intergenic
1064727318 10:18294010-18294032 ATAAATATCCAAATGGAAACTGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067813357 10:49449296-49449318 ATAACTTTAAAAATGGACAAAGG - Intergenic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068563338 10:58542674-58542696 CAAAATTTAAAAATGGGCAAAGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069234747 10:66056815-66056837 TTAAATGTATAAATGAACAATGG + Intronic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071684446 10:87739945-87739967 CTACATATACCAATGTACAATGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074608187 10:114995017-114995039 ATAAATAAATAAATGTACAAAGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076409843 10:130239758-130239780 CTACATATGCAAAGGGTCAAAGG - Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1076766393 10:132636643-132636665 ATAAATAACCAAATGGACATGGG - Intronic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079415086 11:20226831-20226853 CCAAATTTACAAATAGACTAGGG - Intergenic
1079549637 11:21678258-21678280 AAAAACATACAAATGGCCAAAGG - Intergenic
1079623564 11:22585931-22585953 ATAAATATTCAAATGGTAAATGG - Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1086224989 11:84497074-84497096 CTAATTAAACAAATAGATAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087711925 11:101563884-101563906 CTAAATGTACAAGTAGAAAATGG - Intronic
1088089926 11:106025589-106025611 ATACATATACATATGCACAATGG - Intergenic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1093062094 12:14617817-14617839 ATAAAGATACAAATTGAAAATGG - Intronic
1093428252 12:19053853-19053875 CTAATTATAAAAAAGAACAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093608210 12:21120379-21120401 CTAAGTCTATAAATGGGCAATGG - Intronic
1094776700 12:33737856-33737878 ACAAACATACAAATGTACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1096935646 12:55271028-55271050 CTAAAGATCCAAATCAACAAAGG - Intergenic
1097594008 12:61605166-61605188 CTATTTAAAGAAATGGACAAAGG - Intergenic
1097715626 12:62962890-62962912 ATAAAAAGACAAAAGGACAAAGG + Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1097947480 12:65388173-65388195 CTAAATATACAAATAATCTAGGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098129445 12:67333674-67333696 CAACAGATACAAATGGCCAATGG - Intergenic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1099741151 12:86635975-86635997 CTAAATATAGAAAAGGAACAGGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100267803 12:92994736-92994758 ATATATATACAAAGGGATAAAGG - Intergenic
1100342700 12:93695906-93695928 ATAAATAAATAAATGGGCAAAGG + Intronic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100704394 12:97184535-97184557 AGAAATTTACAAATGAACAAAGG - Intergenic
1100755013 12:97741654-97741676 TTAAATATATAAATTAACAAAGG - Intergenic
1101221648 12:102647434-102647456 CTAGATATTCAATTGGCCAAGGG + Intergenic
1101335961 12:103797166-103797188 CTAATAATAAAAAAGGACAATGG + Intronic
1101383273 12:104232979-104233001 CTAAATAGGTAAATGCACAATGG + Intronic
1101475411 12:105042129-105042151 CTAAATAAAGAAATGGATATAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102655176 12:114476705-114476727 CTATATATATAAATGTGCAAAGG + Intergenic
1102999192 12:117372299-117372321 ATAAATAAAGAAATGGACATTGG - Intronic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105906321 13:24813455-24813477 CCAATTACAAAAATGGACAAAGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107456311 13:40558647-40558669 CTAAATATCCAATTGGTCCAAGG - Exonic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107542006 13:41397362-41397384 CAAAAAAACCAAATGGACAAAGG + Intergenic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109408206 13:61928286-61928308 CTAAGCATACAAATGAAAAATGG - Intergenic
1109505908 13:63303161-63303183 CTAAATTTATAACTAGACAAAGG + Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109590440 13:64473611-64473633 CTAAGTATACAAAATGACATTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110483290 13:76008523-76008545 CTAAAGATACAAAAGGAGTAAGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111534701 13:89587778-89587800 CAAAATAAACTAAAGGACAAAGG - Intergenic
1111695745 13:91621638-91621660 CTAAATATTGAAATGGTCACAGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112657506 13:101467286-101467308 CTAAATTTCCCAAAGGACAAAGG - Intronic
1113529019 13:111006331-111006353 CGAAATGTACACATGGACAGTGG - Intergenic
1113571979 13:111364522-111364544 CCAAATTTAAAAATTGACAAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116625610 14:47259084-47259106 CTAAACAAACAAATGGAAATTGG - Intronic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1117793955 14:59372131-59372153 CCAAATATACAAATAGGCAGTGG - Intergenic
1118120335 14:62832939-62832961 CCAAATTTAAAAATGGGCAAAGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118601952 14:67476962-67476984 CTAAAAATACAAAAAAACAATGG + Intronic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1120324097 14:83003685-83003707 GTAAATCCAAAAATGGACAATGG - Intergenic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1121975516 14:98400213-98400235 CTAATTTTAAAAATGGGCAAAGG + Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126430029 15:48573454-48573476 ATAAAAATAAAAAAGGACAATGG + Intronic
1127187891 15:56498942-56498964 TTAAATATGCAAATGTATAAAGG - Intergenic
1127332135 15:57949762-57949784 CTACATAGATAAATGGCCAAAGG + Intergenic
1127620589 15:60729999-60730021 ATAAATGTAAAAAGGGACAAGGG - Intronic
1128436633 15:67657205-67657227 CTAATTAACTAAATGGACAATGG - Intronic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130199240 15:81809864-81809886 ATAAAAATAGAAATGAACAAGGG - Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1138221253 16:55252629-55252651 CTAATTTTTCAAATGGGCAAAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1139019393 16:62728630-62728652 CTAAAATAAGAAATGGACAAGGG - Intergenic
1140403455 16:74691064-74691086 TTAAATATATATGTGGACAAAGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140716519 16:77730910-77730932 AAAAATTTAAAAATGGACAAAGG - Intronic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1142686772 17:1581645-1581667 CTAAATTTACAAATGGTGGAGGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145084805 17:19928247-19928269 ATAAAAATAAAAATGGCCAAAGG + Intronic
1145183893 17:20777547-20777569 GAAGATATGCAAATGGACAATGG - Intergenic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1147490514 17:40861759-40861781 CTAAAGATAAAAATGGAATAAGG + Intronic
1147492752 17:40885803-40885825 CTACATCTCCAAATGTACAATGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150180738 17:63118339-63118361 CTAAAAATACAAGTAAACAAAGG - Intronic
1150415134 17:64981441-64981463 CTAAATATACAAATGACCCTTGG + Intergenic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150563904 17:66321081-66321103 CAAAATATACAAAATAACAATGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1153206581 18:2709738-2709760 CAAAATTTAAAAATGGCCAAAGG - Intronic
1153286392 18:3458825-3458847 CTAAATGTACCACTGAACAAAGG - Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153654824 18:7273236-7273258 CTAAAAAAACAAAAGGATAATGG + Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160571575 18:79820948-79820970 CCAAATCTAAAAATGGGCAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1167700458 19:51041147-51041169 CCAAATATACAACTGGTGAATGG + Intergenic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
924972147 2:138187-138209 CGAATTAAAAAAATGGACAAGGG - Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925648089 2:6058075-6058097 CAAGACATACAAATGGCCAATGG - Intergenic
926491894 2:13534039-13534061 CTAAAAATGTAAATGGAAAATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930296666 2:49562871-49562893 CTAGAAATAAAAAGGGACAATGG + Intergenic
930552906 2:52858249-52858271 ATAAGTATAAATATGGACAAAGG + Intergenic
930617941 2:53613575-53613597 TAAAACATACAAATGGCCAATGG - Intronic
930621534 2:53649227-53649249 CTAAGTATAGGAATGAACAAGGG - Intronic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
931107389 2:59071405-59071427 CTAGAAATACAACTGTACAAGGG + Intergenic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933011817 2:77074754-77074776 CTAAATCAAGAAGTGGACAAAGG + Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933334191 2:80935796-80935818 AAAAATATACAAATGGCCAGTGG + Intergenic
933448211 2:82409805-82409827 CTAAGTATACAAATATAAAAGGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934891276 2:98071932-98071954 TTAAATGTGCAAATGGACACAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937544341 2:122998535-122998557 CAAATTAGATAAATGGACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938807828 2:134823026-134823048 CTAAATATAGAAAGGGCCAGAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941779508 2:169428733-169428755 CCAAATTTAAAAATGGGCAAAGG + Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942402505 2:175618059-175618081 CCAATTTTAAAAATGGACAAAGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943231476 2:185258345-185258367 TTAAATATAAGAAGGGACAATGG - Intergenic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943803464 2:192091419-192091441 CTAAATTTGCAATTGCACAAAGG + Intronic
943847065 2:192664011-192664033 CTAAATATACTAGAGGAAAACGG - Intergenic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
944208117 2:197178570-197178592 CCAAATAAAGAAATGGGCAAAGG + Intronic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
944869379 2:203894520-203894542 CTAATTTTACAAATGGATACAGG + Intergenic
944939458 2:204607932-204607954 CTAAATGTCCAAATTGTCAAAGG - Intronic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946636918 2:221739558-221739580 ATAATTTTAAAAATGGACAAAGG + Intergenic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
948016005 2:234691127-234691149 CAAACTGTAAAAATGGACAAAGG + Intergenic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1169628444 20:7598457-7598479 CTAAATATTCAAAAGGACTTGGG - Intergenic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170660217 20:18331578-18331600 CTAATTACACACATGTACAATGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172058740 20:32174359-32174381 TTAACTATACAAATGGAAATAGG - Intergenic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174245637 20:49177718-49177740 CTAAATATAAGAACGGAAAAAGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176522134 21:7832264-7832286 CTACATCTCCAAATGGATAATGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176932989 21:14835657-14835679 ATACATATACAAATTGACACAGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1176994807 21:15543190-15543212 CTAAATATATATTTGAACAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178656154 21:34462276-34462298 CTACATCTCCAAATGGATAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178880382 21:36445385-36445407 CTAAAAATACAATAGAACAAAGG + Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179066927 21:38033738-38033760 CTAATTTTAAAAATGGGCAAAGG - Intronic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179131146 21:38638519-38638541 GTAGAAATTCAAATGGACAAAGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181428589 22:22861603-22861625 AGAAACATACAAATGGCCAAAGG + Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182156854 22:28082219-28082241 ATAAATATCCAAATTGAAAAGGG - Intronic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1184966962 22:47983859-47983881 CACAATTTACCAATGGACAAAGG - Intergenic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949921343 3:9005109-9005131 CCAAATTTAAAAATGGGCAAAGG + Intronic
949933634 3:9099864-9099886 CCAAATACTCAAATGCACAAAGG + Intronic
950519578 3:13489080-13489102 CCAATTTTAAAAATGGACAAAGG - Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950753734 3:15154652-15154674 ACAAAAATACAAATGAACAAGGG + Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951303892 3:21034138-21034160 CAAGACATACAAATGGCCAATGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953725055 3:45390287-45390309 ATAAAAATAAAAATGGGCAAAGG - Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955589904 3:60524000-60524022 CTAAAGATAAAAGAGGACAACGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
956677238 3:71747449-71747471 CCAATTTTAAAAATGGACAAAGG - Intronic
956689390 3:71861973-71861995 CTAAGAATACAAATGGATATTGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958599859 3:96282400-96282422 CTAAATCTACAAAGAGACTATGG - Intergenic
958606245 3:96362026-96362048 CTAAAAATTCAAAAGGACTATGG + Intergenic
958666691 3:97148748-97148770 TTAAATATAAAAATTGAAAATGG - Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959206886 3:103319721-103319743 ATAACAATAAAAATGGACAAGGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961315217 3:126030349-126030371 CTAACTAGAAAAATGCACAAGGG + Intronic
962440401 3:135408632-135408654 ATAAATTTACAAAAGCACAATGG + Intergenic
962894634 3:139703031-139703053 AAAGATATACAAATGGCCAAAGG + Intergenic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963629093 3:147711298-147711320 CTAAATATAGAAAGGAAAAATGG - Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
963727502 3:148938466-148938488 ATAAATATACAAATATACACTGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965268757 3:166585035-166585057 CTAAAGTTACAAGTGAACAAAGG - Intergenic
965396629 3:168166911-168166933 CTAAATGTAGAAATGGAGAGTGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967065474 3:185911491-185911513 CTAAACAAACAATTGGAAAAGGG - Intergenic
967081714 3:186055698-186055720 CTAAAGATTCAAATGGGAAAAGG - Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970173868 4:13317123-13317145 GAAGATATACAAATGGCCAATGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971596159 4:28531628-28531650 ATAAATATACTAATGGCAAAAGG + Intergenic
971989817 4:33878027-33878049 CAACATATACAAATCAACAAAGG - Intergenic
971991937 4:33909624-33909646 AAAAACATAGAAATGGACAAAGG + Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972698879 4:41474492-41474514 ATAAAAATAAAAATGGGCAAAGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974583818 4:63843415-63843437 TTAAATACAGAAATGGAGAAAGG + Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974623801 4:64396476-64396498 CCACATTTAAAAATGGACAAAGG - Intronic
974629869 4:64474033-64474055 CTAAATAAGCAAATGTACATTGG + Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977137125 4:93319359-93319381 CTAAATTAAGAAATTGACAAGGG - Intronic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
977953265 4:102998850-102998872 ATAAGAATAAAAATGGACAAAGG - Intronic
979064889 4:116118125-116118147 ATAAAAATAAAAATGGGCAAAGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
979735801 4:124082032-124082054 CTAAATATCACAATAGACAAAGG + Intergenic
980162386 4:129181584-129181606 ATAAAAATAAAAATGGGCAAGGG - Intergenic
980320052 4:131259906-131259928 ATAAATATATAAATGTGCAATGG + Intergenic
980332574 4:131428429-131428451 ATAAATGTATAAATGGCCAAGGG - Intergenic
980681704 4:136170951-136170973 TTAAAGATACTAATGCACAATGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981342909 4:143642981-143643003 GAAGATATACAAATGGCCAACGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982279686 4:153670123-153670145 GAAAATATATAAATGGCCAAGGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983276619 4:165625367-165625389 CTAAATATAAAAATGAAATAGGG + Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
983779906 4:171655662-171655684 ATATATTTACAAATGCACAATGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985976443 5:3421999-3422021 CTAAAAATAAGAATGGATAAAGG + Intergenic
986587088 5:9329729-9329751 ATAAATAAATAAATGTACAAAGG - Intronic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987561552 5:19530123-19530145 ATAAATACACAAATGCTCAAGGG + Intronic
987617155 5:20290989-20291011 AAAAATATTGAAATGGACAAGGG + Intronic
987798091 5:22655528-22655550 CAACATATACAAATGCAAAATGG - Intronic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
988978590 5:36540933-36540955 GAAGATATACAAATGGGCAACGG - Intergenic
989227314 5:39044430-39044452 TAAAATATAAGAATGGACAAGGG + Intronic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991025507 5:62025398-62025420 CTAAATATGGAAATGGAAACTGG - Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992810988 5:80388325-80388347 CAAAATATTTAAATGGTCAAAGG - Intergenic
992843288 5:80717800-80717822 CCAAATTTAAAAATGGGCAAAGG - Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
993458169 5:88149018-88149040 CTAAATAGTCAAATAGACATTGG - Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993541057 5:89152292-89152314 CAAGACATACAAATGGCCAATGG - Intergenic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
996296504 5:121923282-121923304 CAACATGTACAAATGTACAAAGG - Intergenic
996445181 5:123539938-123539960 CTATAAATACTAAAGGACAAAGG - Intronic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998661604 5:144245082-144245104 ATAAATAAATAAATGTACAATGG - Intronic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999204362 5:149837378-149837400 CAAAAAGTACAAATGGATAAGGG - Intronic
999264870 5:150260095-150260117 TTAAATAAACCAATGGACAGAGG - Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000479795 5:161758020-161758042 TTAAATACACCAAAGGACAATGG - Intergenic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000759995 5:165210993-165211015 TTAAATATACGAATTGAAAATGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002613780 5:180437711-180437733 CTAACAATACAAATGGAAAGTGG - Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1005053257 6:21705319-21705341 ACAAATATAAAAATGTACAAAGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006765598 6:36502408-36502430 TAAAAAATACTAATGGACAAAGG - Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1006861866 6:37177154-37177176 CTTAATATATGAATTGACAATGG - Intergenic
1006952819 6:37839083-37839105 GTAGATACACAAATGGTCAATGG - Intronic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008107270 6:47452487-47452509 CTAAAGATAAAACTGGAAAAGGG - Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008840365 6:55895521-55895543 CTAAATATACAAAGGAAATAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009522588 6:64702704-64702726 CTAAATAAACAAATGAGTAATGG - Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010089256 6:71960759-71960781 CTAAATATTCAAGTAGACATGGG + Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1010794374 6:80102514-80102536 CTATTTAAAGAAATGGACAAAGG - Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011741660 6:90367316-90367338 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012207187 6:96476242-96476264 CTAAATATGGAAAGGAACAATGG - Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012742460 6:103035743-103035765 GTATATATACAAATGACCAAAGG - Intergenic
1012763973 6:103340574-103340596 ATAAATATACTAATGGAAACGGG + Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012884489 6:104830392-104830414 CAAAAAATGCAAATGAACAATGG + Intronic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015319374 6:131855246-131855268 ATACATATAAAAATGGCCAAAGG - Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016144998 6:140659735-140659757 ATAAATATACAAATACACTAAGG + Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017679729 6:156851362-156851384 CTAAATATACAATTAAACATTGG - Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021322025 7:19224069-19224091 CAAAATGTAGATATGGACAACGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022405039 7:30081083-30081105 CTACCTATACAAATGCAAAATGG - Exonic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1023190440 7:37574886-37574908 CTAAAAAGACAAATGACCAATGG + Intergenic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023665333 7:42517164-42517186 CTAACTATATAAATGAACAGTGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024189550 7:46992228-46992250 ATACATGTACAAATGGATAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028111570 7:86948524-86948546 CTAAATATAAAAAGGGAAACAGG + Intronic
1028260273 7:88655834-88655856 CTATATTTACAAATGAAAAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028486888 7:91369066-91369088 CAACATTTACAAATGGGCAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029055321 7:97734051-97734073 CTAAAGATCCAAACTGACAAAGG + Intronic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1030650235 7:112109689-112109711 CTATATATAGAAATGGACTCTGG - Intronic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1030821344 7:114095696-114095718 CTAAATATATAAATGAGCACAGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1031756761 7:125653935-125653957 GAAGATATACAAATGGCCAACGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034182535 7:149149392-149149414 CTAAAAATACAAAAGGACCCGGG - Intronic
1034294404 7:149959196-149959218 CTAATTATCCAAATTGAAAAGGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036422935 8:8614664-8614686 CTAAAGACACAATTGAACAATGG - Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038388985 8:27177197-27177219 CCAAATTTAGAAATGGACACAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038852461 8:31293196-31293218 ATAAATTTAAAAATGGGCAAAGG - Intergenic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039174561 8:34788460-34788482 CTATATATATATATGTACAATGG - Intergenic
1039174566 8:34788678-34788700 ATATATATACATATGTACAATGG - Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041259722 8:56010425-56010447 CTATGTTTACAAATGGACATAGG + Exonic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041321670 8:56620188-56620210 CTAAATATAAGAATGGAACATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041763248 8:61389851-61389873 CAAGATATACAAATGACCAAAGG - Intronic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042095186 8:65207638-65207660 TAAGATATACAAATGGCCAACGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042251972 8:66765334-66765356 GAAAATATACAAATGGCCACAGG - Intronic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1042727730 8:71895397-71895419 CCATTTAAACAAATGGACAATGG + Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043346705 8:79306122-79306144 CCAATTTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044141847 8:88665057-88665079 GTACATATATAAATGCACAATGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044459088 8:92424158-92424180 CTAAATATACCAAGAGAGAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044634128 8:94305551-94305573 ACAAAGATACAAATGGAGAAGGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1046151086 8:110227076-110227098 CCCAATTTACAAATGGTCAAAGG - Intergenic
1046680776 8:117167748-117167770 CTAAAAATATATATGTACAAGGG - Intronic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047602649 8:126441820-126441842 CTAATTTTTAAAATGGACAAAGG + Intergenic
1047789503 8:128188279-128188301 CTCAATTTACTAATGGTCAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050224419 9:3435364-3435386 CTAAATATACAAAAAGATTACGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050712331 9:8479550-8479572 CTAAAAATAAAAACTGACAAAGG + Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1051797236 9:20886157-20886179 CTAAATATATGAAAGGAAAATGG - Intronic
1052662219 9:31448597-31448619 CCAAGTATAAAAATTGACAATGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1055041758 9:71881975-71881997 AAAGATATACAAATGGCCAATGG + Intronic
1055320281 9:75076909-75076931 TTAAATATAAAACTGGAAAAAGG + Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056344426 9:85676414-85676436 GAAAATATATAAATGGGCAATGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057506640 9:95639426-95639448 GAACATATACAAATGGCCAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060253890 9:122008441-122008463 GAAAACATACAAATGGCCAATGG + Intronic
1060679981 9:125553628-125553650 CTACATAGACAAATGGGCATGGG - Intronic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1185671132 X:1811020-1811042 CTAAGGATAAAAATGGAAAATGG + Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1186939032 X:14484277-14484299 CTAATGATGCAAATGGAAAATGG + Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1187910553 X:24107177-24107199 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188170744 X:26921673-26921695 ATAAATATATAAATGGAACATGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189538854 X:41965268-41965290 TTAAATTTAAAAATGGGCAAAGG + Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192289243 X:69774760-69774782 TTAAATATACAAATGTAATAGGG + Intronic
1192480983 X:71485671-71485693 CCAAATCTAAAAATGAACAAAGG - Intronic
1192749365 X:73972536-73972558 GAAAACATACAAATGGTCAATGG - Intergenic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1193767781 X:85551933-85551955 CTAATTTCAAAAATGGACAAAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195271816 X:103239313-103239335 CTAAAGAGTAAAATGGACAAGGG - Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1197204109 X:123774854-123774876 CTAAAAATACAAATAGCCAGGGG + Intergenic
1197267818 X:124394616-124394638 AGAAATATAGAAATGTACAAAGG + Intronic
1197579115 X:128259661-128259683 ATAAAAATAAAAATGGGCAAAGG + Intergenic
1198192261 X:134319886-134319908 CCAAATTTAAAAATGGGCAAAGG + Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1199338247 X:146644291-146644313 CTATATATAGATATGGACTAGGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199644157 X:149889408-149889430 CTAAATCTACACATGGGCTAAGG - Intergenic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200299574 X:154959044-154959066 CAAAAAATAGAAATGTACAAGGG + Intronic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic