ID: 1008877088

View in Genome Browser
Species Human (GRCh38)
Location 6:56340956-56340978
Sequence CCCCTAGTACTGTAGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008877088_1008877092 -5 Left 1008877088 6:56340956-56340978 CCTTATGCCTACAGTACTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1008877092 6:56340974-56340996 AGGGGCTCTAGGCACTTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008877088_1008877094 17 Left 1008877088 6:56340956-56340978 CCTTATGCCTACAGTACTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1008877094 6:56340996-56341018 GGTGTGTGAAACATACTTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1008877088_1008877093 -4 Left 1008877088 6:56340956-56340978 CCTTATGCCTACAGTACTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1008877093 6:56340975-56340997 GGGGCTCTAGGCACTTTCATGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008877088 Original CRISPR CCCCTAGTACTGTAGGCATA AGG (reversed) Intronic
906862489 1:49376506-49376528 CCCCAAATACTGAAGGGATAAGG - Intronic
909039298 1:70630329-70630351 ACCCTAGTACTGACAGCATATGG + Intergenic
909257455 1:73441910-73441932 CACCTAGGACTCTAGGGATAAGG - Intergenic
910655726 1:89616112-89616134 CCCCTAGTGGTGGAGGCACAAGG - Intergenic
917138471 1:171810750-171810772 CCCTCAGTACTATAGGCCTATGG - Intronic
922825731 1:228516874-228516896 CCCCTGGGACTGTGTGCATAGGG + Intergenic
924310967 1:242742809-242742831 CACCTAGGACTGTAGCAATATGG + Intergenic
1062821629 10:538418-538440 GCCCTAGAACTATAGGCATGAGG + Intronic
1071935617 10:90526891-90526913 GCCCCACTACTGTAGGCTTAAGG - Intergenic
1085956388 11:81401403-81401425 CACCAATTACTGTAGGCATTAGG - Intergenic
1089443681 11:118534948-118534970 CACCTTGTACAGTAGGCATGGGG + Exonic
1097322957 12:58245992-58246014 CACCTAGTCCTGAAGACATAAGG + Intergenic
1097877945 12:64661071-64661093 GCCCTAGTGCTGGAGGCATTGGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1106736217 13:32590324-32590346 TCCCTGGTACTGTATGTATATGG - Intronic
1110672558 13:78198615-78198637 CCCATAGTACTGCATGGATATGG - Intergenic
1117443230 14:55779412-55779434 GCCCTAGGACTGTAGGTACATGG - Intergenic
1117651083 14:57906052-57906074 CGTCTAGCACTGTAGGCATGAGG + Intronic
1118287720 14:64491708-64491730 GCCCTGGTACTTTAGGCAGAAGG + Intronic
1123438455 15:20272730-20272752 CCCCTAGGAATGTAGGCTCAGGG - Intergenic
1129772335 15:78210291-78210313 CCCCAAATTCTGTAAGCATAGGG - Intronic
1137727177 16:50664990-50665012 CCCCCAGTTCAGTAGGCAGATGG + Intergenic
1145852785 17:28118978-28119000 GCCCTAGAATTGTAGGTATAAGG + Intronic
1148059793 17:44828533-44828555 CCCAGAGTGCTGTAGGCAAAGGG - Intronic
1159089010 18:63825226-63825248 CCTGTAGTACTGTAGTCACAAGG - Intergenic
1163222058 19:15928920-15928942 CCCCTAGTACCATAGGCTTAGGG + Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
1165034428 19:33022630-33022652 CCCCTAGGAATGTAGGCTCAGGG - Intronic
1166586088 19:43950627-43950649 CCATTAGTACAGTAGGCAAAAGG + Intergenic
1168601766 19:57724306-57724328 CCCCTAGTGCTGGAGGCCCAGGG + Intronic
926977391 2:18528957-18528979 CCCCTAGAACTGCATGCAGAAGG - Intergenic
932992564 2:76805975-76805997 CCCCTGGAACTGTAAGCCTAGGG - Intronic
946760797 2:222991187-222991209 TCCCTGGTACTGTAGCCAGAAGG + Intergenic
1174199150 20:48794735-48794757 CCCCGAGGACTGTAGGCAGCCGG - Intronic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
951195904 3:19823214-19823236 CACCTAGTCCAGTGGGCATATGG + Intergenic
955640181 3:61074157-61074179 CACTTAGTACTGAAGGCTTAAGG - Intronic
963949242 3:151180480-151180502 CCCATAATACGGTAGGCATGGGG - Intronic
970149255 4:13071487-13071509 CCTCTATTACTCTAGGCTTATGG + Intergenic
971505657 4:27363878-27363900 CCACTAGTACTGTATGAAAATGG - Intergenic
976756111 4:88499249-88499271 CCCCTACTATAGCAGGCATAGGG - Intronic
977077023 4:92467516-92467538 CTCCAAGTACTGTATGCATCTGG + Intronic
977387430 4:96360517-96360539 CCACTAGTCCTAGAGGCATATGG + Intergenic
982357811 4:154489676-154489698 CCCCTGGCACTGTAGTCATGTGG - Intronic
996579697 5:125017778-125017800 GCCCTATTACTCTTGGCATATGG - Intergenic
998253176 5:140566248-140566270 CCCCAACTACTGTAGCCAAATGG - Intronic
1008877088 6:56340956-56340978 CCCCTAGTACTGTAGGCATAAGG - Intronic
1010571465 6:77478248-77478270 CCCCTATCTCTGTAGGCATTTGG - Intergenic
1059530489 9:115031013-115031035 CCACTAGAACTTTGGGCATAGGG + Intronic
1192273371 X:69605580-69605602 CACCTAGTACTGCAGACCTAAGG + Intergenic
1193114619 X:77764688-77764710 CTCCTAGTACAGTAAGCAGAAGG + Intronic
1198557616 X:137812079-137812101 CCCCTAGTCCTGAAGGGACAAGG + Intergenic