ID: 1008878129

View in Genome Browser
Species Human (GRCh38)
Location 6:56351588-56351610
Sequence CATTATACACATGTGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008878129_1008878130 0 Left 1008878129 6:56351588-56351610 CCAAGCTGCACATGTGTATAATG 0: 1
1: 0
2: 1
3: 14
4: 108
Right 1008878130 6:56351611-56351633 CACCCAAAGAAGCAGAGCAAAGG 0: 1
1: 1
2: 4
3: 40
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008878129 Original CRISPR CATTATACACATGTGCAGCT TGG (reversed) Intronic
903425622 1:23252113-23252135 CATTTTACACATGAGCAAATTGG - Intergenic
904962497 1:34345391-34345413 CATTTTACAGATGTGCAAATTGG + Intergenic
907326589 1:53642249-53642271 AATTATAAACATCAGCAGCTTGG + Intronic
911327532 1:96486336-96486358 CTTTCTACACATGTGTAGTTAGG - Intergenic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
913082141 1:115398617-115398639 CATTATACACATCCACACCTGGG + Intergenic
914402812 1:147339347-147339369 CATTCCAGACTTGTGCAGCTGGG + Intergenic
916434393 1:164763730-164763752 AATTGTACACATTTGCAGCAAGG + Intronic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
1064103936 10:12485458-12485480 CAGCAGACACATTTGCAGCTGGG - Intronic
1066019985 10:31288785-31288807 GAATATACAGATGTGAAGCTCGG + Intergenic
1066427097 10:35317453-35317475 GATTAAACACATGTGCTGCTTGG - Intronic
1071087611 10:81881051-81881073 CATTAGACACATGTTTAGTTTGG + Intronic
1072094529 10:92164175-92164197 CATTATACACATTTCCAGATGGG + Intronic
1074418182 10:113285526-113285548 CCTGCTCCACATGTGCAGCTTGG + Intergenic
1078573339 11:12477903-12477925 CATCATACAAATCTTCAGCTAGG - Exonic
1080893633 11:36430753-36430775 CATTTTACATATGAGGAGCTTGG + Intronic
1080897399 11:36458031-36458053 CATTATAGAAATGTGTAACTTGG + Intronic
1087366313 11:97224140-97224162 AACTATACACATGTGCAGTTAGG - Intergenic
1087478122 11:98663717-98663739 AATTTTACACATCTGCAGATAGG + Intergenic
1088502790 11:110499297-110499319 CATTATAAACACGTGCATCAGGG + Intergenic
1090197147 11:124826460-124826482 CATTATATAAGTGTGCAGTTTGG - Intergenic
1095864653 12:46958121-46958143 CATTATCCATCTGTGAAGCTGGG - Intergenic
1100516835 12:95336217-95336239 TTTTATACACATGTGCATCCAGG - Intergenic
1103127979 12:118441027-118441049 CATTATACACATGGGTAACCAGG + Intergenic
1107157575 13:37187232-37187254 TATTAGACACATGTGAAGCTTGG - Intergenic
1110099971 13:71586475-71586497 TATTATACACATCAGCAGATAGG + Intronic
1111675496 13:91382802-91382824 GAATCTACACATGTGCAGGTTGG - Intergenic
1112152638 13:96780804-96780826 CCATAGACACATGTGCAGCTAGG - Intronic
1116369223 14:44108765-44108787 CCTTTAACACATGTGCAGCAAGG + Intergenic
1117846517 14:59917318-59917340 CTTAATACACATGTGTTGCTAGG + Intergenic
1118221264 14:63856454-63856476 CAGTATACACATGTGCTCCTGGG + Intronic
1120951625 14:90046931-90046953 CACTACACACAAGTTCAGCTTGG + Intergenic
1121743097 14:96267617-96267639 AATTAAACACATGTGCAGGCTGG - Intronic
1121879077 14:97483667-97483689 CCTCAGACACATGTGAAGCTCGG + Intergenic
1122075072 14:99230652-99230674 CATTCTACAGATGGGCAGATGGG - Intronic
1125860269 15:42992623-42992645 TATTCTGCACATGTGCAGCTTGG + Intronic
1131945756 15:97618660-97618682 CATTATACTAATGTAAAGCTAGG + Intergenic
1133359429 16:5162277-5162299 CATTATACAGCTGGGCCGCTGGG - Intergenic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1138043859 16:53700840-53700862 TATTGTCCACATGTGCTGCTTGG + Intronic
1138313096 16:56044867-56044889 AGTCATACAAATGTGCAGCTAGG + Intergenic
1138946450 16:61856745-61856767 CATTTTACAGATGTGCAAATTGG + Intronic
1138959367 16:62010507-62010529 CATTATACACATTACCAGATCGG - Intronic
1140675506 16:77325132-77325154 CATTCTACACATGGGCAGTTGGG + Intronic
1146046266 17:29510704-29510726 AATTATAAACATGTGCTACTTGG - Intronic
1146575411 17:33986764-33986786 CATTATACAAATGAGAATCTGGG + Intronic
1150954770 17:69845224-69845246 CATTATACTCATGGGAAGATAGG + Intergenic
1154097712 18:11433310-11433332 AATTAGACACATGAGCAACTGGG + Intergenic
1155868432 18:30995553-30995575 GATGATTCAAATGTGCAGCTAGG - Intronic
1160373286 18:78391560-78391582 CATGATACACATGTTCGTCTTGG + Intergenic
1163494243 19:17635911-17635933 AATTACACAAATGTGCACCTGGG - Intronic
1164990546 19:32679460-32679482 CATTTTTCACATGGGCCGCTTGG + Intergenic
1165021572 19:32928660-32928682 CATCCTACACATGTGCAGGGTGG + Intronic
1167281498 19:48571906-48571928 CATTAAACACAAGTGCAGCCGGG - Intronic
1168358610 19:55718975-55718997 AAAGATACAGATGTGCAGCTGGG - Intronic
926320289 2:11744617-11744639 CATTATTCAAATGTGGAGATGGG - Intronic
927283599 2:21333958-21333980 CATTGTAGACTTGAGCAGCTGGG + Intergenic
928450388 2:31373125-31373147 GATTATCCACATTTGCAGGTGGG + Intronic
928931611 2:36630850-36630872 CCTAATACACAGGTACAGCTGGG + Intronic
930341190 2:50117027-50117049 CATTAAACACATGTGCACAGAGG - Intronic
934752582 2:96803018-96803040 CATTTTACATTTGTACAGCTGGG + Intronic
934869825 2:97853297-97853319 CATTAAGAACATTTGCAGCTGGG + Intronic
941379954 2:164780179-164780201 CATTTTACAGATGTGGATCTAGG - Intronic
943462078 2:188181513-188181535 CTTTATCCACACGTGCAGCTAGG - Intergenic
946142287 2:217701857-217701879 CACTAGACAAATGTGCATCTCGG + Intronic
948654810 2:239469993-239470015 CACTGTACACATGTGAAGTTTGG + Intergenic
1170182657 20:13549734-13549756 TATTATACACAAGATCAGCTGGG + Intronic
1170586932 20:17741710-17741732 CATTCTACAGTTGGGCAGCTGGG - Intergenic
1171462766 20:25308290-25308312 CATGATACACCTGAGGAGCTGGG - Intronic
1173503239 20:43568281-43568303 CATTATACAGATGGGGAGCCTGG - Intronic
1177126488 21:17200241-17200263 CATTCTACACGTGTGCTGGTAGG - Intergenic
1179540410 21:42079839-42079861 CCTTATACTAAAGTGCAGCTTGG - Intronic
1183691775 22:39393985-39394007 CATTTTACAGATGAGGAGCTGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
955597111 3:60603441-60603463 CTTAATACACATGTACAGATAGG - Intronic
956632441 3:71329641-71329663 CAATAAACACATTTGCAGGTGGG + Intronic
957589657 3:82179599-82179621 TATTATAAAGATATGCAGCTGGG - Intergenic
960414515 3:117368209-117368231 CATTTTACACATGAGGAGCCTGG - Intergenic
962742446 3:138371771-138371793 TGTTAAACACAGGTGCAGCTAGG - Intronic
963816173 3:149833413-149833435 CATTATACACATGACCAAGTTGG + Intronic
966676453 3:182595417-182595439 CCAAATACACGTGTGCAGCTGGG - Intergenic
967296149 3:187967122-187967144 CATTTTACAAATGAGCAACTAGG - Intergenic
969485373 4:7469623-7469645 CAGGAGACTCATGTGCAGCTAGG - Intronic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
974495555 4:62622348-62622370 CATTTTATACATGTGCAACTGGG - Intergenic
975186179 4:71406127-71406149 TATTCAACACATTTGCAGCTTGG + Intronic
975653026 4:76613561-76613583 CATACTACAGATGTGCAGTTCGG + Intronic
978967057 4:114752998-114753020 TATGATTCACATGCGCAGCTAGG + Intergenic
981672494 4:147302786-147302808 CATTATACACATTTTCAATTGGG - Intergenic
982190664 4:152852122-152852144 TATTATACACTTGTTAAGCTTGG + Intronic
984637468 4:182126646-182126668 CATTTTATACATGTGCATATAGG - Intergenic
984793911 4:183640254-183640276 CAAGTTACACCTGTGCAGCTTGG - Exonic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
995594612 5:113734461-113734483 CACTCTTCACTTGTGCAGCTTGG - Intergenic
997730039 5:136163883-136163905 TATTATAAACATTTGCAGCTGGG + Intronic
1000051295 5:157565106-157565128 CATTTTACACATAAGCAGTTTGG + Intronic
1001350694 5:170960860-170960882 CATTATACAGCTGAGTAGCTGGG + Intronic
1001550968 5:172602190-172602212 CATTTTACACATGAGAAACTGGG - Intergenic
1006315893 6:33291441-33291463 TTTTATACACATTTGCAGCAAGG + Intronic
1007982048 6:46169994-46170016 CATTAAACACAGTTGCAGCAAGG + Intronic
1008878129 6:56351588-56351610 CATTATACACATGTGCAGCTTGG - Intronic
1010103248 6:72135781-72135803 CATCTTACACATGTGCAGAATGG - Intronic
1010960174 6:82136854-82136876 CATCCTATACATGGGCAGCTTGG + Intergenic
1014887870 6:126803688-126803710 CATTATAGACATTTTTAGCTTGG + Intergenic
1014966463 6:127759550-127759572 GGTTATTAACATGTGCAGCTGGG - Intronic
1015719509 6:136226811-136226833 CATTCTACAGATGAGGAGCTAGG - Intergenic
1019103075 6:169647787-169647809 CAGCATACACGTGTGCAGGTGGG + Exonic
1022429484 7:30302237-30302259 CATTTAAGCCATGTGCAGCTTGG - Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1022987179 7:35667240-35667262 CATGATTCTCATGTGCAGCCAGG + Intronic
1023407733 7:39853312-39853334 CAAGTTACACCTGTGCAGCTTGG - Intergenic
1031005997 7:116472734-116472756 AATTCTACACATGGGCAGCTTGG + Intronic
1031436918 7:121743460-121743482 AATGATACACATTTGGAGCTGGG - Intergenic
1031963648 7:128011584-128011606 CATGATTCCAATGTGCAGCTGGG - Intronic
1033539897 7:142346910-142346932 CATCAGACACACATGCAGCTGGG + Intergenic
1035634022 8:1129942-1129964 CACTTTACAAATGTGCACCTGGG - Intergenic
1041959918 8:63601393-63601415 CATTATATAAATTTTCAGCTAGG + Intergenic
1042510461 8:69605873-69605895 CATTTTACAAATGGGCAGCTGGG + Intronic
1047797010 8:128267869-128267891 CATTATGCAAATGAGCAGCAGGG - Intergenic
1048260377 8:132940033-132940055 CATTGTACAGATGGGAAGCTTGG + Intronic
1060259955 9:122065703-122065725 CATTAGCCCCATGTGCAGTTTGG - Intronic
1189020293 X:37329967-37329989 CATTTTACACATTTGAAGATTGG + Intergenic
1198830757 X:140747606-140747628 CATTGTAAACATGTGAAGCCAGG + Intergenic