ID: 1008881553

View in Genome Browser
Species Human (GRCh38)
Location 6:56385354-56385376
Sequence GGCAGAGCTGCATTCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 2, 1: 33, 2: 87, 3: 238, 4: 587}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008881553 Original CRISPR GGCAGAGCTGCATTCCTTTC TGG Intronic
900715677 1:4141954-4141976 CGCAGAGCTGCCTTCCTTTCTGG - Intergenic
900815063 1:4837368-4837390 GGTTGTGCTGCATTCCTTTCTGG - Intergenic
900982008 1:6051228-6051250 GGCAAAGCTGCATTCCAGGCAGG - Intronic
901751972 1:11415828-11415850 GGCACAGCTGCACACCTTTCTGG + Intergenic
902098677 1:13967311-13967333 GGAAGACTTGCATTCCTTGCAGG - Intergenic
902540959 1:17154408-17154430 GGCAGGGCTGCATTCCTTTCAGG + Intergenic
902750560 1:18506631-18506653 GGCAGGACTGCTTTCTTTTCTGG + Intergenic
903168121 1:21535269-21535291 GGCAGTGCTGGTTTCCTCTCTGG + Intronic
903227627 1:21902700-21902722 GGAAAAGCTGCATTCCATCCAGG + Intronic
903655231 1:24944815-24944837 GGCAGGGCTGTGTTCCTTGCTGG - Intronic
903757336 1:25671837-25671859 GGCCATGCTGCATTCCTTTCTGG + Intronic
903780844 1:25819301-25819323 GGAAGAGCCACATTCCTTCCAGG - Intronic
904312344 1:29637003-29637025 GGCAGGGCTGCATTCCCTCCTGG + Intergenic
904965338 1:34368419-34368441 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
905791126 1:40790130-40790152 GACAGATCTGCGTTCCTTCCTGG + Intronic
905839555 1:41163043-41163065 GGAAGAGCTGCAGCCCTTTGGGG + Intronic
905909949 1:41646883-41646905 AACAGGGCTGCATTGCTTTCTGG + Intronic
906389343 1:45400328-45400350 AGCAGGGCTGCATTCCTCTCTGG - Intronic
907031682 1:51178413-51178435 AGCGGAGCTGCAGACCTTTCTGG - Intergenic
907380025 1:54079459-54079481 GATAGGACTGCATTCCTTTCTGG + Intronic
907549398 1:55291637-55291659 GGGAGAGAGGCATTCCTTCCAGG + Intergenic
908269681 1:62410867-62410889 AGCAGGGCTGCATTCCTCTATGG + Intergenic
908738211 1:67298978-67299000 GGCAGGGCTGCATTCTCTTCTGG - Intergenic
908886105 1:68790825-68790847 GGCAAGGCTGCATTCTTGTCTGG + Intergenic
908992098 1:70103560-70103582 GGTACGGCTGCATTCTTTTCTGG - Intronic
909144454 1:71912176-71912198 GGCAGGGCTGCTTTCTTTTGTGG + Intronic
909145369 1:71923634-71923656 GGCAGGGCTGAAGTCCCTTCTGG + Intronic
909381341 1:75002389-75002411 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
909868990 1:80714776-80714798 GACAGGACTGAATTCCTTTCTGG + Intergenic
910053084 1:82999238-82999260 AACAGGGCTGCATTTCTTTCTGG + Intergenic
910113030 1:83702152-83702174 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
910576287 1:88768321-88768343 GGCAGGACTGCATTCCCTTCTGG + Intronic
910766801 1:90790173-90790195 GACAGACCCGTATTCCTTTCTGG - Intergenic
912015618 1:105030919-105030941 ACCATAGCTGCGTTCCTTTCTGG - Intergenic
912058815 1:105638789-105638811 TGCAGTGCTGCGTTTCTTTCGGG - Intergenic
912137938 1:106684208-106684230 ATCAGGGCTGCATTCCTTCCTGG + Intergenic
912465656 1:109871676-109871698 GGCAGGGCTGTGTTCCATTCTGG - Intergenic
913487886 1:119350466-119350488 GGCACAGCTGGATTCATTACAGG - Intergenic
914319771 1:146548016-146548038 AGCAGGGCTGCATTCCCTTCTGG + Intergenic
914324820 1:146602152-146602174 CCCAGGGCTGCATTCCTTCCTGG - Intergenic
914331287 1:146673106-146673128 AGCCGAGCTGCATTCCTTTCGGG + Intergenic
914348491 1:146819997-146820019 AGCAGGGCTGCCTTCCCTTCTGG + Intergenic
914349503 1:146828046-146828068 GGAAGGGCTGTATTCTTTTCTGG + Intergenic
914394032 1:147247735-147247757 AGCAGAGCTGCATTCCTTTCTGG + Intronic
915850968 1:159322678-159322700 AGCAGAGCTGTATTCCTTCATGG - Intergenic
915912034 1:159921487-159921509 GGCAGAGCTGTGTTCCTTCTGGG - Intronic
915913341 1:159927724-159927746 GGCCGAGATGCCTGCCTTTCCGG + Intronic
916422148 1:164647403-164647425 AGCAGGGCTGGATTCCTTCCTGG - Intronic
916604425 1:166326841-166326863 GGCCAGGCTGCATTCCTTTCTGG - Intergenic
916826580 1:168447741-168447763 GGTAGGGCTGCATTTCTTTCTGG + Intergenic
916949319 1:169762838-169762860 TACAGAGCTGTGTTCCTTTCTGG - Intronic
918270865 1:182897851-182897873 GACAGGCCTGCATTCCTTTTTGG - Intergenic
918574066 1:186034260-186034282 AGCAGAGCTGAATTCCCTTCTGG - Intronic
918910302 1:190559239-190559261 GGCAGGGTTGCATTATTTTCTGG + Intergenic
919592722 1:199524667-199524689 GGCTGGGCTGCTTTCCTGTCTGG + Intergenic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920535742 1:206735559-206735581 AGCAGGGCTGCATTCCTCTTTGG + Intergenic
921275318 1:213513261-213513283 AGCAGGGCTGAGTTCCTTTCTGG - Intergenic
921493451 1:215807220-215807242 ACAAGAGCTGCATTCCCTTCTGG - Intronic
921668955 1:217905526-217905548 AGCAAAGATGCATTCCTTTCTGG - Intergenic
922184975 1:223266203-223266225 GGCTGAGCTCCATACCTTTTAGG - Intronic
922370675 1:224907526-224907548 GGTAGGGCTACATTTCTTTCTGG + Intronic
922852912 1:228749035-228749057 GGCAGGGCTGTGTTGCTTTCTGG + Intergenic
922856002 1:228775141-228775163 AGCAGGACTGCATTCCTTTCTGG + Intergenic
922975358 1:229779372-229779394 GGCAGAGCTGCATGCCTGGTGGG + Intergenic
923038150 1:230300085-230300107 TGTAGGGCTGCAGTCCTTTCTGG + Intergenic
923344004 1:233033801-233033823 GGGAGAACTGGATACCTTTCAGG + Intronic
923812744 1:237337958-237337980 GGCAGCACTGCATTGCTTCCAGG + Intronic
923925424 1:238621563-238621585 TACAGAGCTGCATTCTTTTCTGG - Intergenic
924614276 1:245599840-245599862 GGTATATCTGCATTCCATTCTGG - Intronic
924644756 1:245867266-245867288 GGCAAGGCTGCCTTCCTTTCTGG - Intronic
924811302 1:247404989-247405011 GGCAGGGCTGCGTTCCTCTCTGG + Intergenic
1063131357 10:3180475-3180497 GGCCGGGTTGCATTCCCTTCCGG + Intergenic
1063810226 10:9696348-9696370 AGCAGGGCTGCGTTCATTTCTGG - Intergenic
1063811862 10:9720324-9720346 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1064242747 10:13645976-13645998 CTCAAAGCTGCTTTCCTTTCAGG - Exonic
1064706236 10:18075138-18075160 GGCAGGGCTGTGTTCGTTTCTGG - Intergenic
1065251801 10:23823163-23823185 GGCAGGGCTGTGTTCCATTCTGG + Intronic
1065400909 10:25300191-25300213 AGCAGGGCTGCATTCCTTTTTGG + Intronic
1065429016 10:25634525-25634547 GGCAGGGCTGTACTCCTGTCTGG - Intergenic
1065859628 10:29861129-29861151 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067522827 10:47021062-47021084 GGTAGGACTGCATTCTTTTCTGG + Intergenic
1067564522 10:47327001-47327023 GGAAGAGCTGCAGTCCTTATCGG + Intergenic
1067787981 10:49264824-49264846 GGCAGAGCTGTGCTCCTTTTTGG + Intergenic
1068149625 10:53115501-53115523 AGGAGGGCTGCTTTCCTTTCTGG - Intergenic
1068451444 10:57194671-57194693 GGCAGGGCTACATTCTTTTCTGG - Intergenic
1068525042 10:58118522-58118544 AGCAGGGCTGTGTTCCTTTCTGG - Intergenic
1068554208 10:58439966-58439988 GGCACAGCTGCATTCCTTTCTGG + Intergenic
1068611457 10:59064995-59065017 TTCAAAGCTGCATTACTTTCAGG + Intergenic
1070521169 10:77254865-77254887 GGCAGGGATGCTTTGCTTTCTGG - Intronic
1070765245 10:79052657-79052679 GGGAGAGCTGCACTCATTTGGGG - Intergenic
1071216305 10:83406524-83406546 GGCAGTGCTGCATTTCCTTGTGG + Intergenic
1071402905 10:85295023-85295045 GGCAGAGCTGTGCTGCTTTCTGG + Intergenic
1072364656 10:94696581-94696603 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1072568095 10:96634837-96634859 GTCAGGGCTGCATTCCTTTCTGG + Intronic
1072863554 10:99032709-99032731 GGGAAGGCTGCATTCCATTCTGG + Intronic
1072979393 10:100087121-100087143 GGCAGAGCTGTGTTCCTTGCTGG - Intergenic
1073612587 10:104959061-104959083 TGCAGGGCTGTTTTCCTTTCTGG - Intronic
1074184136 10:111086557-111086579 GGCAGAGCTTCTTTTGTTTCGGG + Intergenic
1074845136 10:117391104-117391126 GGCAGAGCTGCCTCACTTTCTGG - Intergenic
1074925555 10:118066233-118066255 GGCTAAGCTGCATTCTTATCTGG - Intergenic
1075024545 10:118974997-118975019 GGCAGGGCTGGGTTCGTTTCTGG + Intergenic
1075154526 10:119963564-119963586 GGCAGGGCTGTGTTCCTTTCTGG - Intergenic
1075210273 10:120485072-120485094 AGCAAAGCTGCATTCCTTTCTGG - Intronic
1075280632 10:121135351-121135373 TGCTGGGATGCATTCCTTTCTGG + Intergenic
1076071316 10:127492242-127492264 GGCAGGGCTGCCTTCCCTTCTGG + Intergenic
1077245045 11:1532706-1532728 GGAAAAGCTGCATACCTTTGTGG + Intergenic
1077715146 11:4573259-4573281 GGCACTGCTGCATTCCTTGAAGG + Intronic
1078120743 11:8506485-8506507 AGCGGGGCTGCATTCCTTTCTGG + Intronic
1078508894 11:11970810-11970832 GGCAGGGCTGCATTCCTCTCTGG - Intronic
1078519596 11:12052509-12052531 GGCAGTGCTGTGTTCCTTTCTGG - Intergenic
1078578651 11:12521928-12521950 AGCACAGCTGCATTTTTTTCTGG - Intronic
1078930577 11:15909417-15909439 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1079387016 11:19989421-19989443 TGCAGGGCTACATTCATTTCTGG - Intronic
1079429372 11:20374424-20374446 GACAGAGCTGCATTCCTTTCTGG + Intronic
1079655223 11:22978336-22978358 GGCAGAGCTGAATTAAATTCAGG - Intergenic
1079986588 11:27206551-27206573 GGCAGGACTGAATTCCTTTCTGG - Intergenic
1080113374 11:28594687-28594709 AGCTGAGCTGCATTCCCATCTGG - Intergenic
1080233912 11:30046953-30046975 GGCAAAGCTGCATTCATTGATGG + Intergenic
1080291061 11:30671795-30671817 GGCAGAATTACATTCCTTTCTGG - Intergenic
1080728295 11:34918766-34918788 GTAGGAGCTGCATTCTTTTCTGG + Intronic
1080769893 11:35330829-35330851 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1080898536 11:36466308-36466330 GTCAAGGCTGCATTCCTTTCTGG + Intergenic
1081188314 11:40072483-40072505 GGCAGAGCTGCTTTGCTTTCTGG - Intergenic
1081283941 11:41245626-41245648 AGAAGAGCTGCAGCCCTTTCAGG - Intronic
1081375405 11:42352328-42352350 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1081759009 11:45564074-45564096 GGCCGGATTGCATTCCTTTCTGG + Intergenic
1082751904 11:57028617-57028639 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1082772674 11:57220517-57220539 GGCTGAGCTGCGGTCCTTCCTGG - Intergenic
1083088955 11:60180126-60180148 GGCAGAGCTGCACACCCTCCAGG - Intronic
1083465616 11:62843763-62843785 GACAGGGCTGCATTGCTTTCTGG - Intergenic
1083486803 11:62988317-62988339 GGCTGAGTTACATACCTTTCTGG - Intergenic
1083580401 11:63821140-63821162 GGCAGGGCTGTGTTCCTTCCTGG + Intronic
1084358708 11:68655973-68655995 GGCCGGGCTGCGTTCCTTCCTGG - Intergenic
1084760855 11:71269873-71269895 GCCCGAGCTGCATTACATTCGGG + Intergenic
1084905997 11:72348012-72348034 GACAGAACTGTCTTCCTTTCTGG - Intronic
1085275387 11:75295328-75295350 CACAGGGCTGCATTCATTTCTGG + Intronic
1085622615 11:78048855-78048877 AGCAGGGCTGCCCTCCTTTCTGG - Intronic
1085882453 11:80484049-80484071 GACAGGGCTACATTCTTTTCTGG + Intergenic
1085884344 11:80505183-80505205 AGCAGGACTGCATTCCTTTCTGG - Intergenic
1085985804 11:81786411-81786433 GACAGGGCTGTATTCCTTACAGG + Intergenic
1086056016 11:82647289-82647311 AGTAGGGCTCCATTCCTTTCTGG - Intergenic
1086435417 11:86775245-86775267 AGCAGGGCTGCATTTCTTACTGG - Intergenic
1086584285 11:88433561-88433583 GGCAGAGCTGCATTTATTAATGG - Intergenic
1086594426 11:88554126-88554148 AGTAGGGCTACATTCCTTTCTGG + Intronic
1088322716 11:108570051-108570073 CTCAGATCTGCTTTCCTTTCTGG - Intronic
1089068830 11:115682803-115682825 GGCAGGGCCGCACTCCTTTCTGG - Intergenic
1089625263 11:119747120-119747142 GGAAGGGCTGTGTTCCTTTCAGG + Intergenic
1090287434 11:125512071-125512093 AGGAGAGCTGATTTCCTTTCTGG - Intergenic
1092695476 12:11166826-11166848 AGCAAGGCTGCATTGCTTTCTGG + Intronic
1092845340 12:12579794-12579816 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1092928921 12:13296951-13296973 GGCTGGGATGCACTCCTTTCTGG + Intergenic
1093364646 12:18278227-18278249 ATCAGGGCTGTATTCCTTTCTGG + Intronic
1093616222 12:21228753-21228775 AGCAGGGCTGTATTCCTTTCTGG - Intronic
1093847080 12:23985824-23985846 GGCAGGGTTGTATTCTTTTCTGG + Intergenic
1094394613 12:29992364-29992386 AGCAGGGCTGTGTTCCTTTCTGG + Intergenic
1094556933 12:31510270-31510292 GACAGGGCTGCATTCCTTTCTGG + Intronic
1094750745 12:33404317-33404339 GACAGGGCTGCATTCTTTTCTGG - Intronic
1095107192 12:38248749-38248771 GGCAGAGCTGTGTTCCTTTCTGG - Intergenic
1095168634 12:39006192-39006214 GGCAGAACTGCCTTTCTTTCTGG - Intergenic
1095301584 12:40590539-40590561 GGTAGGGCTGTATTTCTTTCTGG - Intergenic
1095301773 12:40592717-40592739 GGTAGGGCTGTATTTCTTTCTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095482147 12:42647873-42647895 TCAAGTGCTGCATTCCTTTCTGG + Intergenic
1095545453 12:43362930-43362952 AGCAGGGCTGCATTCCTTTCTGG - Intronic
1095615651 12:44184702-44184724 AGCAGAGCTGAGTTCCTTTCTGG - Intronic
1096034034 12:48448106-48448128 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1096116833 12:49060040-49060062 GGCGGCGCGGCATTCCTTCCGGG - Intergenic
1096546473 12:52343647-52343669 GGCAGGGCTGCATTTCTTTTTGG + Intergenic
1096597223 12:52703496-52703518 GTCAGAGCTCCTTTCCTCTCTGG - Intergenic
1096689931 12:53314327-53314349 GCCAGAGCTGCATTCTTATCTGG - Exonic
1096855342 12:54477673-54477695 GGCAGAGCTGCACTCCAGCCTGG + Intergenic
1096872427 12:54601743-54601765 GGCAGGGCTGCGTTCCTTTCTGG - Intergenic
1097309378 12:58101959-58101981 GGCAGGCCTGCTTTCCTTTCTGG + Intergenic
1098133648 12:67378634-67378656 GGCAGGGCTGCGTTTCTTACTGG + Intergenic
1098549050 12:71742776-71742798 GGAAGGGCTGCATTCCTGTCTGG + Intergenic
1098571868 12:71997059-71997081 GGCAGGGCTGTGTTCCTTTATGG + Intronic
1098708295 12:73719771-73719793 GGCAGGGTTACATTCCCTTCTGG - Intergenic
1098998975 12:77154533-77154555 GGCAGGGCTACATTCTTTACTGG - Intergenic
1099203169 12:79699098-79699120 GGCAAGGCTGCATTCCCTTGTGG + Intergenic
1099764989 12:86971479-86971501 TGAGGAGCTGCATTCCTTTTGGG - Intergenic
1100108339 12:91205922-91205944 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1100239491 12:92697022-92697044 GGCTAGGCTGCATTCCTTTCTGG - Intergenic
1100515617 12:95324721-95324743 GGCAGAGCTGCAGCCATATCAGG - Intergenic
1100648404 12:96557083-96557105 AACCGAGCTGTATTCCTTTCTGG + Intronic
1100924196 12:99525022-99525044 GAAAGGGCTGCTTTCCTTTCTGG - Intronic
1100966653 12:100020730-100020752 AGCAGGGCTGCACTCCTTTCTGG - Intergenic
1101063866 12:100999215-100999237 GTCAAGGCTGCACTCCTTTCTGG + Intronic
1101339207 12:103826572-103826594 TGCAGGACTGCATTTCTTTCTGG - Intronic
1101527292 12:105543071-105543093 GGCTGGGCTGCATTCTTATCTGG + Intergenic
1101741696 12:107505057-107505079 GGCACAGCTACATTTATTTCAGG + Intronic
1102366216 12:112338092-112338114 GGCAGGGCTGCACTCCCTCCAGG + Intronic
1102447801 12:113016980-113017002 AGCTGGGCTGCCTTCCTTTCTGG - Intergenic
1102797738 12:115703564-115703586 GGCCAGGCTGCATTCCTTTCTGG + Intergenic
1102814196 12:115849798-115849820 AGCAGAGCTGTGTTCTTTTCTGG + Intergenic
1103157891 12:118702479-118702501 CGCAGAGCTGCATTCCATTCTGG - Intergenic
1103267914 12:119646498-119646520 GGCAGGGTTGGATTCCTTTCTGG + Intergenic
1104065386 12:125301280-125301302 GGCAGAGCTTGATTGCATTCAGG + Intronic
1104206676 12:126645226-126645248 GACAAGGCTGCATTCTTTTCTGG - Intergenic
1104282092 12:127387667-127387689 GGCAGCACTGCACTCCATTCTGG - Intergenic
1105513634 13:21072143-21072165 TGGAGAGCTGCATCCCTTCCTGG - Intergenic
1106036541 13:26050210-26050232 TGAGGAGCTGCCTTCCTTTCGGG + Intronic
1106131245 13:26941261-26941283 GGGAGGGCTGAATTCTTTTCTGG - Intergenic
1106431959 13:29689166-29689188 AGCAGGGCTGAATTCCTTTGGGG - Intergenic
1106454747 13:29917230-29917252 AGCAGAGCTGTGTTCCTTTTTGG - Intergenic
1106468682 13:30035845-30035867 GGCCCACCTGAATTCCTTTCAGG + Intergenic
1106683427 13:32031507-32031529 GGCCGCGCTGCTTTCATTTCGGG - Exonic
1106833123 13:33606791-33606813 GGCAGAGCTGCGCTCCTTTCTGG + Intergenic
1106976507 13:35223875-35223897 GGCAGGGCTGCATTTCTTATTGG + Intronic
1107490457 13:40876305-40876327 GGCAAAGCTACTTTCCTATCTGG + Intergenic
1107702983 13:43067118-43067140 GGCAGAGCTGCATTCCATTTTGG + Intronic
1107794267 13:44033944-44033966 AGCAGGGCTGAGTTCCTTTCTGG - Intergenic
1107815503 13:44240895-44240917 GACAGTGCTGTGTTCCTTTCTGG - Intergenic
1108030965 13:46229430-46229452 GGCAGAGCTTCCCTTCTTTCAGG - Intronic
1108085664 13:46789368-46789390 GGCAGAGCAGCAGTGCTTTCAGG - Intronic
1108204676 13:48075483-48075505 AGCAGGGCTGCATTCCTTCCTGG - Intronic
1108793152 13:53997123-53997145 AGCAGGACTGCATTTCTTTCTGG - Intergenic
1109365311 13:61348187-61348209 GGCAGTGCTGTATTTCTTTCTGG + Intergenic
1109494589 13:63151321-63151343 GGCAGAGTGGTATTCCTTTCTGG - Intergenic
1109622701 13:64929939-64929961 GGAAGAGATTCATGCCTTTCTGG + Intergenic
1109692315 13:65909706-65909728 GGCAGCTCTGCATTCCTCTGGGG - Intergenic
1109843765 13:67956644-67956666 GACAGAGCTGCAATACCTTCTGG + Intergenic
1110350206 13:74498315-74498337 GGCAGGGCTGCCTTCCTTTCTGG + Intergenic
1110729134 13:78859947-78859969 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1110899464 13:80802442-80802464 GGCATGGCTGTGTTCCTTTCTGG - Intergenic
1111107277 13:83663430-83663452 GGCAGGGCTGCATTTATTTCTGG + Intergenic
1111754223 13:92372100-92372122 GGCAGGGCTGTGTTCCTCTCTGG - Intronic
1111882718 13:93978225-93978247 GGCAGAGCTGCATTCCTCTCTGG - Intronic
1112800488 13:103104451-103104473 GGCAGGGCTGTTTTCCTTCCTGG + Intergenic
1112809417 13:103200382-103200404 GGCAGGGCTGCATTCCCTCTGGG + Intergenic
1113057481 13:106285030-106285052 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1113320408 13:109227389-109227411 GGCAGGATTGCATTCCTTTTGGG + Intergenic
1113472434 13:110556425-110556447 TGCAGGATTGCATTCCTTTCTGG - Intronic
1113772449 13:112918722-112918744 TGCAGAGCAGCAGTGCTTTCTGG + Intronic
1114556199 14:23563777-23563799 GCAAGAGCTGCAGGCCTTTCTGG - Exonic
1114573583 14:23693237-23693259 GGGAGAGCTGATTTCCTCTCCGG - Intergenic
1114895919 14:26991293-26991315 GTTGGGGCTGCATTCCTTTCTGG + Intergenic
1114976874 14:28112792-28112814 GACAGAGCTACATTTCTTTTGGG + Intergenic
1115707571 14:36014463-36014485 GGCAGAGCTGCATTTATTGACGG - Intergenic
1116043106 14:39709952-39709974 GGCAGGGCTGTGTTCCTTTCTGG + Intergenic
1116341023 14:43723210-43723232 GGCAGGGCTGCATTTCCTTATGG - Intergenic
1116704211 14:48276062-48276084 GAGAGAGCTACATTCCTTCCTGG + Intergenic
1116997874 14:51342724-51342746 GACACAGCTACATTCTTTTCTGG - Intergenic
1117152288 14:52901767-52901789 AGCAGGGCTGCGTTCCTTCCTGG - Intronic
1117489280 14:56229692-56229714 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1118576341 14:67245078-67245100 GGCAGGGCTGCTTTCTTTTCTGG - Intronic
1118935867 14:70287594-70287616 GGCAGGGCCGCATCCCTTTCTGG - Intergenic
1119112333 14:71986785-71986807 GGCAGAGCTGCATGCCCTCAGGG + Intronic
1119179541 14:72596159-72596181 AGGAGGGCTGCATTCCTTTCAGG + Intergenic
1119867766 14:77988372-77988394 ACCAGGGCTGCATTCCTTTCTGG - Intergenic
1119995457 14:79248582-79248604 GCCATAACTGCATACCTTTCTGG + Intronic
1120090334 14:80324499-80324521 GGCAGGGTTGCAGTTCTTTCCGG - Intronic
1120186034 14:81394803-81394825 GGCAGGGCTGTGTTCCTTTCTGG - Intronic
1120357199 14:83449814-83449836 GTCAGGGTTGCATTCCTTTCTGG - Intergenic
1120688788 14:87569202-87569224 ATCAGAGCTGCTTTCCCTTCTGG - Intergenic
1121026004 14:90616580-90616602 GGCAGAGCTCTCTTCCTTCCAGG + Intronic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1121679329 14:95779485-95779507 ATCAGGGCTGCATTCCTTACTGG - Intergenic
1122034129 14:98935237-98935259 TTCAGAGCTGTATCCCTTTCTGG - Intergenic
1122261959 14:100528814-100528836 GGCGGAGCCGCACTTCTTTCTGG - Intronic
1122538342 14:102481894-102481916 GCCAGAGCTGCAGTGCTTCCTGG + Intronic
1124184079 15:27506575-27506597 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1124205062 15:27710943-27710965 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1124205263 15:27713108-27713130 GACAGAGCTGCCTTCCTTTCGGG - Intergenic
1124229256 15:27928530-27928552 GGCAGGGCTGCGTTCCTGTCTGG + Intronic
1125337037 15:38636843-38636865 GGCAGAGCTGCAGTCATCTGAGG - Intergenic
1125425256 15:39542395-39542417 GGTAGAGCTGCATTCCTTTCTGG + Intergenic
1126316557 15:47376203-47376225 GGCAGATCTGCACCCCTTTGTGG + Intronic
1126401262 15:48273169-48273191 GGCCAGGCTGCATTCCCTTCCGG + Intronic
1126466994 15:48969935-48969957 GGCAGGGCTACATTTCTTTCTGG - Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1127264917 15:57353417-57353439 AGCAGGGGTGCATTCCTTTCTGG - Intergenic
1128319298 15:66681669-66681691 GGCAGGGCTTCATGCCTTTCAGG - Intronic
1128929478 15:71691204-71691226 GGCAGGGCTGTGTTCCTTTACGG - Intronic
1129246513 15:74282253-74282275 GGCAGGGTCACATTCCTTTCTGG + Intronic
1130446967 15:84012269-84012291 GGCATGGCTGCATTCCTTTTTGG + Intronic
1130620862 15:85460860-85460882 ATCTGAGCTACATTCCTTTCAGG - Intronic
1131424440 15:92334153-92334175 GGCAGAGCTGCATTCGTAACTGG - Intergenic
1132198199 15:99929546-99929568 GGCAGGGCTGCGTTTCTTTCCGG - Intergenic
1132244462 15:100283666-100283688 GAAAGAGCTGCATTCCTAGCAGG + Intronic
1133014583 16:2933581-2933603 GGGTGAGCTGCCTTCCTTTGGGG + Exonic
1133034830 16:3028794-3028816 GGCAGAGCTGCAGTCCCTGCGGG - Exonic
1133481250 16:6172888-6172910 GGCAGAGCTGCACTCCTTTCTGG + Intronic
1133832105 16:9332887-9332909 GGCAGGGCTGTGTTTCTTTCTGG + Intergenic
1134210754 16:12274578-12274600 GGCATAGCTGCACTCCGTCCTGG - Intronic
1134593327 16:15475113-15475135 GACAGTGCTGCATTGCTTCCTGG + Intronic
1135121529 16:19770451-19770473 GGCAGAGCCTAATTCTTTTCTGG + Intronic
1135467269 16:22697886-22697908 GGTAGGGCTGCATTCCTTCTGGG + Intergenic
1135925071 16:26686779-26686801 ATCAGAGCTTCGTTCCTTTCTGG + Intergenic
1137583298 16:49647705-49647727 GGCAGGGCCGCATTCCTTTCTGG - Intronic
1137882253 16:52062265-52062287 AGCAGGGATGCATTTCTTTCTGG + Intronic
1137952397 16:52796119-52796141 GCAAAAGATGCATTCCTTTCTGG - Intergenic
1138073421 16:54016643-54016665 TGCAGAGCTGCCTTACTTTCGGG - Intronic
1138326411 16:56174655-56174677 TGCAAGGCTGCATTCCTTTCTGG + Intergenic
1138876786 16:60961194-60961216 CACAGGGCTGCATTCCTTTCCGG + Intergenic
1138888757 16:61114969-61114991 GCCTGGGCTGCATTCCCTTCTGG - Intergenic
1139134804 16:64189364-64189386 GTCAAATCTGAATTCCTTTCTGG - Intergenic
1139353432 16:66352382-66352404 GGCAGGGCTGCATGCCTTTCAGG + Intergenic
1139984534 16:70887508-70887530 GGAAGGGCTGTATTCTTTTCTGG - Intronic
1139985544 16:70895551-70895573 AGCAGGGCTGCCTTCCCTTCTGG - Intronic
1140002269 16:71037795-71037817 AGCCGAGCTGCATTCCTTTCGGG - Intronic
1140008743 16:71108794-71108816 CCCAGGGCTGCATTCCTTCCTGG + Intronic
1140013757 16:71162061-71162083 AGCAGGGCTGCATTCCCTTCTGG - Intronic
1140293428 16:73685495-73685517 GGCAGGGCTGTGATCCTTTCTGG - Intergenic
1140558469 16:75948433-75948455 GGAAGAGCTGTGTTCTTTTCCGG - Intergenic
1140565059 16:76032053-76032075 TGCAGAGCTGCATTTGTTTCTGG - Intergenic
1140642340 16:76990880-76990902 GGCAGGGCTGGATTCCTTTCTGG + Intergenic
1140704453 16:77613660-77613682 GGCAGGGCTGCAATTCTTTTTGG + Intergenic
1141304347 16:82847331-82847353 GGCAGCGATGCATTCTTTTCTGG + Intronic
1142181326 16:88672261-88672283 GGCAGAGCTGCTCTCCTGTTTGG - Intergenic
1142240979 16:88944938-88944960 GGCAGAGCTGGAGTCCTGCCAGG + Intronic
1142833489 17:2566854-2566876 GGTAGGCCTGCATTCTTTTCTGG - Intergenic
1143313465 17:6013187-6013209 GGCAGAGATACATTTTTTTCTGG - Intronic
1143365264 17:6404161-6404183 GGCAGGGCTGCATTCCTTTCTGG + Intronic
1144153674 17:12476122-12476144 AGCAGGGATGCGTTCCTTTCTGG - Intergenic
1144242964 17:13332005-13332027 GGCAGGGCTGCCTTCCTCCCTGG - Intergenic
1145233638 17:21193105-21193127 GGTAAACCTGCATTCCTTTGAGG - Intronic
1145284404 17:21494702-21494724 TGCAGGGCTGCGCTCCTTTCTGG + Intergenic
1146103470 17:30008917-30008939 GGCAGGGCTGCACTTCTCTCAGG + Intronic
1146456191 17:33011649-33011671 AGCAGGGCTGCATTTCTTTCTGG - Intergenic
1146537815 17:33668344-33668366 AGAAGGGCTGCGTTCCTTTCTGG + Intronic
1146579050 17:34020761-34020783 GGCGGGGCTGCATTCCTTCCTGG - Intronic
1147594479 17:41707912-41707934 GGCAGGGCTGCATTTCTTTCTGG + Intergenic
1148625340 17:49065086-49065108 GGTAGGACTGCATTCCTTTCTGG + Intergenic
1149656880 17:58314594-58314616 GGCAGAACTGCATCCCCTTGGGG - Intronic
1150226765 17:63528654-63528676 GGCAGAGCTGCACTCCCTGAGGG - Intronic
1150968901 17:70004269-70004291 GGCAGTGCTGCATTCTTTTCTGG + Intergenic
1150990671 17:70254619-70254641 AGCAGAGCTACATTCCTTTCTGG - Intergenic
1151139521 17:71978075-71978097 GGCAGGGCTGTGTTTCTTTCTGG - Intergenic
1151670218 17:75568184-75568206 GGCACAGCTGCATGCCTCTGGGG + Intronic
1152043122 17:77917867-77917889 GGCAGAGCTGGAGTACTTTCAGG - Intergenic
1152225108 17:79089249-79089271 GGCAGGGCTGCATCCCGTCCTGG + Intergenic
1152694936 17:81739296-81739318 GGTGGAGCTGCATTCGTTTCCGG + Intergenic
1153038170 18:784578-784600 AGCAGGGCTGCATTTCCTTCTGG + Intronic
1153750644 18:8226806-8226828 AGCAGGGCTGTGTTCCTTTCTGG + Intronic
1153852285 18:9106766-9106788 GCCCGAGCTTCATTCCTTTTTGG + Intronic
1153902020 18:9625703-9625725 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1153902217 18:9627771-9627793 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1153952855 18:10071542-10071564 GGCAGGGCTGTGTCCCTTTCTGG - Intergenic
1154314161 18:13290929-13290951 GGCAGAGCTGCCTTTCTCTCAGG - Intronic
1155054179 18:22170478-22170500 GGCCGAGTTGCATTTCTCTCTGG + Intronic
1156069482 18:33188728-33188750 GGCAGAGTTGCATTTCCTACTGG - Intronic
1156255556 18:35392462-35392484 AGCAGTGTTGCATTCCTTTCTGG - Intergenic
1157015424 18:43706705-43706727 GGCAGAGCTGTGTTCTTTTCTGG - Intergenic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1157644782 18:49256478-49256500 AACAGAGCTGCATTTCTGTCTGG - Intronic
1158318435 18:56237475-56237497 GGCAGGGCTCTGTTCCTTTCTGG - Intergenic
1158521565 18:58175511-58175533 TGCAGAGCTACATTTCTCTCTGG + Intronic
1158906892 18:62021846-62021868 GGCTGAGCTACATTCTTATCTGG + Intergenic
1158973190 18:62687296-62687318 GGCAGGGCTGCATTCATTTCTGG + Intergenic
1159687680 18:71443766-71443788 AGCAAATCTGCATTCCTTTCTGG + Intergenic
1159754623 18:72348995-72349017 GGCAGGACTGCTGTCCTTTCTGG - Intergenic
1161140673 19:2645924-2645946 AGCGGTGCTGCATGCCTTTCCGG - Intronic
1161836570 19:6651339-6651361 AGCAGAGCTGTATTTTTTTCTGG - Intergenic
1161952473 19:7475584-7475606 GGGAGAGCGGCCTCCCTTTCTGG + Intergenic
1164797784 19:31048331-31048353 AGCAGGGCTGCATTCCTCTCTGG - Intergenic
1165055182 19:33171644-33171666 AACAGGACTGCATTCCTTTCAGG + Intronic
1165162086 19:33822552-33822574 AACAGAGCTGCTCTCCTTTCTGG + Intergenic
1165577673 19:36835694-36835716 GGTAGGGCTGTGTTCCTTTCTGG + Intronic
1167227668 19:48259177-48259199 GGCACCGCTGCATTCCAGTCTGG - Intronic
925435390 2:3832990-3833012 GGCTTGGCTGCATTCCTTTCTGG + Intronic
925481958 2:4285350-4285372 AGCAGGGCTGCATATCTTTCTGG - Intergenic
926889172 2:17624722-17624744 GGCAGAGCTACATTCCCTTCTGG - Intronic
927125633 2:20010701-20010723 GGCAGGGCTGTGTTCCTTTTGGG - Intronic
927362158 2:22248653-22248675 GTCAGGACTGCATTCCTTTTGGG - Intergenic
927420636 2:22926881-22926903 GGTAGGGCTGCCTTCCTTTATGG + Intergenic
927710278 2:25321218-25321240 GGCAGGGCTGCATTCTTTTCTGG + Intronic
927840254 2:26437122-26437144 GGCAGAGCTGGTTTCATTTGAGG + Intronic
927928554 2:27029368-27029390 AGCAGGGCTGGGTTCCTTTCTGG - Intergenic
928372290 2:30748960-30748982 GGCTTAGGTGCATGCCTTTCTGG - Intronic
928686970 2:33759790-33759812 GGCAGGGCTACATTCCTTCAGGG - Intergenic
929308631 2:40396104-40396126 GACAGAGATACATTCCTTTAAGG - Intronic
929492537 2:42408829-42408851 AGAAGAGCTGCAGTCCTTTGCGG + Intronic
930266189 2:49202211-49202233 GGCAGAGCAGTATTCCTTATTGG + Intergenic
930453051 2:51568218-51568240 GGCAAAGCTGTATTTTTTTCTGG + Intergenic
930832417 2:55759278-55759300 GGTAGGGCTGCATTCCTTTTTGG + Intergenic
931943205 2:67276126-67276148 GCAAGAGCTGCATTTCTTTCAGG + Intergenic
932054471 2:68430743-68430765 GGGAGGGCTGCATTCCTTGATGG + Intergenic
932512703 2:72311242-72311264 GGCAAGGTTACATTCCTTTCTGG + Intronic
932696644 2:73962400-73962422 GAAATAGCTGCATTTCTTTCTGG + Intergenic
933244362 2:79958596-79958618 AGGAGACCGGCATTCCTTTCTGG - Intronic
933648003 2:84827901-84827923 GGCAGGGCTGCATTCCCTTCTGG - Intronic
934063384 2:88317835-88317857 GGCAGAGCTGCTTTCCTTTCTGG - Intergenic
935386868 2:102509163-102509185 TGCAGGGCTGCGCTCCTTTCTGG + Intronic
935621797 2:105136509-105136531 GGCAGGGCTGTGTTCCTTCCAGG + Intergenic
935852948 2:107242954-107242976 GGCCAAGCTGTGTTCCTTTCTGG - Intergenic
935946490 2:108291037-108291059 GGCAGGGCTGCGTTCCCTTCTGG + Intronic
935999991 2:108817729-108817751 TACAGAGCTGTGTTCCTTTCTGG - Intronic
936997228 2:118428210-118428232 AGCAGGGTTGCATTCCTTTCTGG + Intergenic
937374196 2:121324065-121324087 GGCTGAGCTGAGTTCCTTTCTGG - Intergenic
937470629 2:122171124-122171146 AGCAGGGCTGCTTTCCTTTATGG - Intergenic
938173405 2:129102936-129102958 AGCAGGGCTCCATTCCTTCCTGG + Intergenic
938998482 2:136706048-136706070 AGCAGAGCTGCATGCCATTCTGG - Intergenic
939059851 2:137408678-137408700 GGTAAGGCTGCATTTCTTTCTGG + Intronic
939105677 2:137945767-137945789 GGCAGGGCTGCATATCTTTCTGG + Intergenic
939379245 2:141413477-141413499 GGCCGGGCTGCATTCCTTTCTGG - Intronic
939877433 2:147593936-147593958 AGCAGGGCTGCATTTCTTCCTGG + Intergenic
940077317 2:149757058-149757080 AGCAGGGTTGCATTTCTTTCAGG - Intergenic
940189162 2:151020475-151020497 GGCAGGGGTGCATTCTTTTCTGG + Intronic
940214246 2:151288467-151288489 GGCAGGGTTGCCTTCCTTTCTGG - Intronic
940868843 2:158843071-158843093 GGCAGGTCTGTGTTCCTTTCTGG + Intronic
941320818 2:164052039-164052061 GTCAGGGCTGCCTTCCTTTCTGG + Intergenic
941646945 2:168050685-168050707 TATAGGGCTGCATTCCTTTCTGG - Intronic
942359454 2:175156720-175156742 GGCAGAGCTGCATTCCTTTTTGG - Intronic
943026000 2:182629191-182629213 GGCAGGACTGAATTCCCTTCTGG - Intergenic
943070966 2:183140195-183140217 AGCAGGACTGCATTCCTTTCTGG + Intronic
943108840 2:183581367-183581389 TGCAGGGATGCATTTCTTTCTGG + Intergenic
943116836 2:183683260-183683282 GAGAGAGCTACTTTCCTTTCCGG - Intergenic
943322745 2:186465681-186465703 AGCAGAGCTGTCTTCCTTTAGGG - Intergenic
943538693 2:189184474-189184496 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
945061781 2:205915722-205915744 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
945153752 2:206815740-206815762 GGCAGGGCTGTCTTCCTTTCTGG + Intergenic
945217095 2:207445312-207445334 GGCAGAGCCACATTCTTTTTTGG + Intergenic
945230942 2:207589217-207589239 AGCAGGACTGCATTCCTTCCTGG + Intronic
945322041 2:208435724-208435746 GGCAGGGCTGCATTCCTCTCTGG - Intronic
945394938 2:209306177-209306199 AGAAGAGCTGCAGTTCTTTCAGG - Intergenic
945898153 2:215508066-215508088 GCCAGAGCTGCATTTCTTTTGGG + Intergenic
946150962 2:217770227-217770249 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
946319030 2:218938151-218938173 GGGAGGGCTGCATTACTTCCTGG + Intergenic
946679080 2:222194541-222194563 GGGAGAGCTGCTGTCCTCTCTGG - Intergenic
946698822 2:222389080-222389102 GGCAGAGCTGAGTTCCTTCTGGG - Intergenic
946805254 2:223464827-223464849 GGCAGAGCTGCATTGCATTCTGG + Intergenic
947256696 2:228173660-228173682 GCCAGGGCTGCATTCCTTTCTGG - Intronic
947999962 2:234559739-234559761 GGAAGAGATGCATTACCTTCCGG + Intergenic
948114320 2:235482906-235482928 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
949041111 2:241850351-241850373 GGCAGAGCTGGAGGCCTTTCAGG - Exonic
1169404152 20:5309342-5309364 GGCAAGGCAGCATTTCTTTCTGG + Intronic
1169524998 20:6414802-6414824 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1169775543 20:9248927-9248949 GGCAGAGCTGCTTTCCTTTCTGG + Intronic
1169992959 20:11523982-11524004 GCCAAGGCTGCATTCCTTTCTGG + Intergenic
1170017959 20:11803451-11803473 GTCAGAGCTGTCTTCCTTTATGG + Intergenic
1170120843 20:12910122-12910144 GGCCAGGCTGCATTCTTTTCTGG + Intergenic
1170138232 20:13099334-13099356 GGCAGGGCTGTATTTCTGTCTGG - Intronic
1170192268 20:13656056-13656078 GGCAGGGCTGTGTTCCTTTCTGG - Intergenic
1170566969 20:17613015-17613037 GGCAGACCCGCCTTCCATTCCGG + Intergenic
1171726165 20:28623012-28623034 GTCAGGGCTGTATTGCTTTCTGG + Intergenic
1171751965 20:29060361-29060383 GTCAGGGCTGTATTGCTTTCTGG - Intergenic
1171790366 20:29517509-29517531 GTCAGGGCTGTATTGCTTTCTGG + Intergenic
1171857347 20:30359328-30359350 GTCAGGGCTGTATTGCTTTCTGG - Intergenic
1172181356 20:33005653-33005675 GGCAGGGCTGTGTTCCTTGCTGG - Intergenic
1172886645 20:38235648-38235670 TGCAGAGCTGCATTCTTTCCTGG - Intronic
1173409578 20:42797922-42797944 ATCAGGGCTGCATTCTTTTCTGG - Intronic
1173492719 20:43496245-43496267 AGCAGAGCTGCATTCCTTTCTGG - Intergenic
1173626172 20:44474623-44474645 GGCAAGGCTGCATTCTTTTGGGG - Intergenic
1173679994 20:44871894-44871916 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1173795964 20:45860185-45860207 TGCAGGGCTGTATTTCTTTCTGG + Intronic
1173914617 20:46697743-46697765 AGCAGGGCTGTGTTCCTTTCTGG + Intergenic
1175176433 20:57115139-57115161 GGGAGAGCTGCATTCCTTTATGG + Intergenic
1175274653 20:57759951-57759973 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1175320174 20:58079959-58079981 AGCAGGGCTGCACTCCTCTCTGG + Intergenic
1175419750 20:58823693-58823715 GGCAGAGCTGCAGTCCGCTGGGG + Intergenic
1175475405 20:59269791-59269813 GGCAGATCTGAAATCCATTCAGG - Intergenic
1175508540 20:59505113-59505135 GGCCGAGCTGTAGTCCTTTCTGG + Intergenic
1175711179 20:61222247-61222269 CGAAGGGCTGCATTCCTTTCTGG - Intergenic
1176018115 20:62947972-62947994 CGGGGAGCTGCATTCCCTTCTGG + Exonic
1176313120 21:5165169-5165191 GGCAAATCTGCATTCTTTGCTGG - Intergenic
1176896535 21:14384907-14384929 AGCAAAGCTGCATTCCTTTCTGG + Intergenic
1177217910 21:18153220-18153242 AGCAGAGCTGATTTCCTGTCTGG + Intronic
1177344578 21:19853504-19853526 AGAAGAGCTGCATTCCTTCGGGG - Intergenic
1177710868 21:24772674-24772696 CGCAGGGCTGCATTCCTTCTGGG - Intergenic
1178602056 21:34003049-34003071 GGGAGAGCTGCCATCCTTTCAGG + Intergenic
1178683720 21:34695126-34695148 AGCAGGGCTGCATTTCTTTCTGG + Intronic
1178792499 21:35713226-35713248 ATCAGGGCTGCATTCCTTTCTGG + Intronic
1178896741 21:36564960-36564982 GGCAGGGCTATGTTCCTTTCTGG - Intronic
1179008553 21:37535132-37535154 GGCAGGACGGCATTTCTTTCTGG - Intergenic
1179015828 21:37593917-37593939 GCCAGCGCTGCCTTCCTTTCAGG + Intergenic
1179050607 21:37885736-37885758 AGCAGGGCTGCATTCATTCCTGG - Intronic
1179147266 21:38779022-38779044 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1179175082 21:39002328-39002350 GGCGGCGCTGCTCTCCTTTCTGG - Intergenic
1179240106 21:39582294-39582316 AGCAGGGCTACTTTCCTTTCTGG - Intronic
1179252580 21:39684887-39684909 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1179268116 21:39823719-39823741 GGCAAGGTTGCATTCCTTTTGGG - Intergenic
1179336538 21:40461897-40461919 GGCAGAGCTAGGTCCCTTTCTGG - Intronic
1179657267 21:42853129-42853151 GGCTGAGCTGCTTTCCTCTGGGG - Intronic
1179843928 21:44096861-44096883 GGCAAATCTGCATTCTTTGCTGG + Intronic
1180391070 22:12282632-12282654 GTCAGGGCTGTATTGCTTTCTGG + Intergenic
1180408671 22:12582121-12582143 GTCAGGGCTGTATTGCTTTCTGG - Intergenic
1180632519 22:17239521-17239543 GGCAGGGCTGCATTCCTGACCGG - Intergenic
1180702049 22:17786590-17786612 GGCCCAGCAGCCTTCCTTTCTGG + Intergenic
1181667386 22:24407505-24407527 GCCAGAGCTGCCTGCGTTTCAGG + Intronic
1181914089 22:26265300-26265322 GGCAGATCTGAATTCCTATCAGG - Intronic
1181968565 22:26673190-26673212 GCCAGAGATGCATTCCTGGCCGG - Intergenic
1182447007 22:30395738-30395760 GACAGGGCTGCCTTCCTTACTGG - Intronic
1182719001 22:32382848-32382870 GGCACCGCTGCATTCCAGTCTGG - Intergenic
1182960325 22:34466217-34466239 GGCAGGGCTGAATTTCTTTCTGG + Intergenic
1183878557 22:40805731-40805753 AGCAGAGCTGTATTCCTTTTTGG - Intronic
1184335024 22:43847960-43847982 GGCAGGGCTGCGCCCCTTTCTGG + Intronic
1184506431 22:44906575-44906597 GACAGAGCTGCAGCCCTCTCTGG - Intronic
1184560838 22:45262111-45262133 GGAAGAGCTGCAGCCCTTTGGGG - Intergenic
949234044 3:1787067-1787089 GGCTGAGCTGCATTTTTTTCTGG + Intergenic
949357493 3:3197536-3197558 AGCAGGTCTGCATTCCATTCTGG + Intergenic
949401364 3:3668392-3668414 AGCAGAGCTGTGTTTCTTTCTGG + Intergenic
950067495 3:10124672-10124694 AGCAGGACTGCCTTCCTTTCTGG + Intronic
950128824 3:10527911-10527933 AGCAGGGCTGCCTCCCTTTCTGG + Intronic
950339978 3:12234556-12234578 GGCAGAGCTACATGGCTTTTGGG - Intergenic
951051236 3:18096480-18096502 GGCAGGGCTGCTTTTCTTTCTGG + Intronic
951165963 3:19485566-19485588 GGCACAGCTACCTTCCTATCTGG + Intronic
951704555 3:25530459-25530481 GGCAGCGCTGCATTCCTTTTTGG + Intronic
951994072 3:28707472-28707494 AGCAAGGCTGCATTCTTTTCTGG + Intergenic
952086369 3:29826625-29826647 ACCAGGGCTGCATTCTTTTCTGG + Intronic
952258085 3:31712627-31712649 GGCAGGGCTGCATTGCTTTCTGG - Intronic
952273280 3:31853075-31853097 GGCAGATCTGCATACCTCTTTGG - Intronic
952634975 3:35518260-35518282 GACAGGGCTGCATTCCTTCTGGG + Intergenic
952780633 3:37093715-37093737 GGTAAAACTGAATTCCTTTCAGG + Intronic
953240938 3:41148927-41148949 GGGAGAGCTGCCTTCCTCCCTGG - Intergenic
953706777 3:45237230-45237252 GAAAGAGCAGCCTTCCTTTCTGG - Intergenic
953729004 3:45429272-45429294 GGTAGAGCTGTGTTCCTTACTGG + Intronic
954688232 3:52382187-52382209 GGCAGACCTGCAGACCCTTCAGG - Intronic
954704233 3:52470552-52470574 AGCAGAGCTGCATTACTCTAAGG - Intronic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
955135163 3:56209876-56209898 GGCAGAGGAGCATTGCTTTGTGG + Intronic
955413162 3:58668901-58668923 GGCAGGCTTGCATTCCTTTCTGG + Intergenic
955413739 3:58673176-58673198 CACAGGGCTACATTCCTTTCTGG + Intergenic
955463221 3:59208462-59208484 AGCAGGACTGCATTCCTTTCTGG - Intergenic
955485001 3:59426343-59426365 GGCAGGGCTACCTTCCTTTCTGG + Intergenic
956515807 3:70046741-70046763 GGCAGGGCTAAATTCCTTTCTGG + Intergenic
956764315 3:72471532-72471554 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
956928400 3:74014721-74014743 CGCAGGGCTTCATTCCTTTCTGG - Intergenic
957118774 3:76061810-76061832 AGCAGGACTGAATTCCTTTCTGG + Intronic
957124267 3:76137660-76137682 GGCAGAGTTGCTCTTCTTTCTGG + Intronic
957510788 3:81185133-81185155 GGCAGGGCCGCATGGCTTTCTGG - Intergenic
957872899 3:86110889-86110911 GGCATAGCAGCATTCATCTCAGG - Intergenic
957946493 3:87069736-87069758 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
958997580 3:100922712-100922734 GGCAGGGCTGCATTCCTTTCTGG - Intronic
959016843 3:101144308-101144330 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
959162382 3:102737788-102737810 GGCAAAGCTGCATTCATTGATGG + Intergenic
959487187 3:106940486-106940508 GACAGGGCTGCATTCCTTTTGGG + Intergenic
959592668 3:108097163-108097185 CGCTGAGCTGCTTTCCCTTCCGG + Intergenic
959848662 3:111063032-111063054 GGCAGGGTTGTATTCCTTTCTGG + Intergenic
960400656 3:117193596-117193618 GGCAAAGCTGCATTTCCTTCTGG - Intergenic
960413584 3:117358191-117358213 AAGAGAGCTGCATTCATTTCTGG + Intergenic
960748504 3:120917991-120918013 CACAGAACTGCATTCCTTTCTGG + Intronic
960757116 3:121027462-121027484 GGAAGAGCTGCACTTCTTTCTGG + Intronic
960875146 3:122288308-122288330 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
961580425 3:127876164-127876186 GGCAGGACTGCATTCCTCTCTGG - Intergenic
961744982 3:129058945-129058967 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
962231696 3:133671212-133671234 AGCAGGGCTGAGTTCCTTTCTGG + Intergenic
962305460 3:134282182-134282204 GGGAAGGCTGCATTCCTTTCTGG - Intergenic
962494017 3:135921635-135921657 AGCAGGGCTGTGTTCCTTTCTGG + Intergenic
962889985 3:139663095-139663117 AGCAGGGCTGTGTTCCTTTCTGG + Intronic
963033915 3:141008177-141008199 AGCCAACCTGCATTCCTTTCTGG - Intergenic
963204481 3:142618494-142618516 AGCAGGACTGCGTTCCTTTCTGG + Intronic
963388840 3:144632009-144632031 AACTGAGCTGCATTCCTTTTTGG - Intergenic
963394014 3:144708433-144708455 GTCAAAGCTGCATTCCATTCTGG - Intergenic
963639760 3:147844045-147844067 GGCAGGGCTGTATTCCTTCTGGG - Intergenic
964143744 3:153433816-153433838 GGCGGAGCTGCGTTCCTTCTAGG + Intergenic
964561013 3:157996697-157996719 TGCAGAGCTGCATTCCTTTCTGG + Intergenic
964743673 3:159991708-159991730 AGCAGAGCTGTAGCCCTTTCTGG + Intronic
964781211 3:160340454-160340476 AACAAGGCTGCATTCCTTTCTGG + Intronic
964813532 3:160692047-160692069 AGCAGAGCTGCATTTCTTTTTGG - Intergenic
965081952 3:164045128-164045150 AGCAGGACTGCATTCCTTTCTGG + Intergenic
965294544 3:166926879-166926901 TGAAGAACTGTATTCCTTTCAGG + Intergenic
965636601 3:170788341-170788363 GGCAGGGCTGTGCTCCTTTCTGG - Intronic
965701959 3:171467250-171467272 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
965837807 3:172870404-172870426 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
966264422 3:178022061-178022083 GGCAGGGCTGTGTTCTTTTCTGG + Intergenic
966363121 3:179150681-179150703 GGCAGAGCTTCCTTCCTGTCAGG + Intronic
967078835 3:186030104-186030126 GGCGGTGCTGTGTTCCTTTCTGG + Intergenic
967103146 3:186233376-186233398 ATCAGGGCTACATTCCTTTCTGG - Intronic
967346940 3:188467825-188467847 GGCAGGGCAGCATTCCTTTCTGG - Intronic
967354467 3:188552571-188552593 AGCAGAGCTTCGTTCCTTTCTGG + Intronic
967584436 3:191194759-191194781 GGCAGAGCTGCACTCCAGCCTGG + Intergenic
968024416 3:195427242-195427264 GGCAGGGCTGCATTCTTTTCTGG - Intronic
968917153 4:3501586-3501608 AGCAGAGCTGCCTTCCTTGGTGG + Intergenic
969204505 4:5633264-5633286 GGCTGAGCTGCATTCTCCTCTGG - Intronic
969272369 4:6111452-6111474 GGCACAGCTGCAGTCCTATTTGG - Intronic
969558997 4:7933820-7933842 GGCTGGGCTGCATTCCTCACTGG - Intronic
970268871 4:14321352-14321374 AGCAGGGCTGAATTCCTTTCTGG + Intergenic
970272955 4:14367071-14367093 GGCAGGGCTGTGTTCATTTCTGG + Intergenic
970360705 4:15306012-15306034 GGCAGAGCTGCATTTCATTCTGG - Intergenic
970493362 4:16599227-16599249 AGCAGGGCTGAATTCCTTTCTGG + Intronic
970554540 4:17217957-17217979 GGCTAGGCTGCATTCCTTTCTGG + Intergenic
970639157 4:18044479-18044501 AGCTGAGCTGCCTTTCTTTCTGG - Intergenic
970858760 4:20677936-20677958 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
971285197 4:25282224-25282246 AGTAGGGCTGCATTCCTTTCTGG + Intergenic
971518467 4:27518348-27518370 TGCAGTGTTGCAGTCCTTTCTGG + Intergenic
971620746 4:28851412-28851434 GGCAAAGCCACATTCCTTTTTGG - Intergenic
971725129 4:30302271-30302293 GGCAGAGCTCAGTTCCTTGCTGG + Intergenic
971795326 4:31219586-31219608 GGCAGGGCTGCATTCTTTTCTGG + Intergenic
971824422 4:31602976-31602998 GGCAGGGCTGTGTTCCTTTCTGG + Intergenic
972039887 4:34579763-34579785 GGCAGGAGTGCATTCCTTTCTGG - Intergenic
972098102 4:35374742-35374764 GTCATAGCTGAATTCATTTCTGG + Intergenic
972791412 4:42374850-42374872 AGCAGGGCTGCATTCCTTCTGGG + Intergenic
973000499 4:44942734-44942756 GGCAGTGCTGCATTCCTCTCTGG - Intergenic
973036256 4:45411080-45411102 GGCAGGGCTGCGTTCCTTAATGG - Intergenic
974119582 4:57622854-57622876 TGCAGAGCTGAATTCAATTCTGG + Intergenic
974184960 4:58433156-58433178 GGCAGAGCTTTGATCCTTTCTGG - Intergenic
974214202 4:58824010-58824032 GGCAGATCTTCATTCCCTTCTGG + Intergenic
974365836 4:60947573-60947595 GGCAAAGCTGCATTCTCATCTGG + Intergenic
975098746 4:70488012-70488034 GGCAGGGCTGAGGTCCTTTCTGG + Intergenic
975254688 4:72218714-72218736 AGCAGGGCTGCATTCCCTTTTGG - Intergenic
975258997 4:72274079-72274101 AGCAGGGCTGCATTCTCTTCTGG - Intergenic
975548369 4:75584447-75584469 TGCAGGGCTGCATTATTTTCTGG - Intronic
975694499 4:76998406-76998428 CGCAGGGCTGCATTCCTTCCTGG + Intronic
976044325 4:80927580-80927602 GGCAGAGCTGCATTTCTTTCCGG + Intronic
976650653 4:87430262-87430284 AGCAGGGCTGCATTCCTCTCTGG - Intronic
976838899 4:89408037-89408059 GGCAGGGCTGCATTGCTTTCTGG - Intergenic
977382861 4:96298834-96298856 AGCAAAGCTGCATTCTTTTCTGG - Intergenic
977494736 4:97760848-97760870 TGCAAGGCTGCATTTCTTTCAGG + Intronic
977535539 4:98252647-98252669 GGCAGGGCTGTATTTCTTTCTGG - Intergenic
977576942 4:98684966-98684988 AGCAGGGCTGCACTCCTTTCTGG + Intergenic
978103793 4:104876359-104876381 GGCAGGGCTGTGTTCCTTTCTGG - Intergenic
978107181 4:104917100-104917122 GGCAGCGCCGTATTCCTTTCTGG - Intergenic
978362479 4:107946194-107946216 GACAGGGCTGCATTCCTTTCTGG + Intronic
978719412 4:111889798-111889820 AGCTGGGCTGCATTCCTTACTGG - Intergenic
979236045 4:118401411-118401433 AACAGGGCAGCATTCCTTTCTGG - Intergenic
979375090 4:119937247-119937269 GTCAGGGCTGCACTCCTTACTGG + Intergenic
979719504 4:123882433-123882455 AGCTGAGCTGCATTTTTTTCTGG - Intergenic
980459232 4:133084515-133084537 GGCAAGGCAGCATTCCTTTATGG + Intergenic
980624522 4:135357227-135357249 GGCAAGGCTGGGTTCCTTTCTGG + Intergenic
980849708 4:138366020-138366042 GACAGGGCTGCATTCTTTTTGGG - Intergenic
981265424 4:142777490-142777512 GGCTGGGCTGCATTTTTTTCTGG - Intronic
982276918 4:153645328-153645350 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
982673596 4:158350339-158350361 TGCCAGGCTGCATTCCTTTCTGG + Intronic
982745142 4:159099104-159099126 GGCAGAGAGGCATTCCTGTCTGG + Intergenic
983302571 4:165946212-165946234 AGCAGAGCTGCATTCCATTCTGG - Intronic
983885338 4:172975000-172975022 GGAAGAGCTGCAGTCCTTTGGGG - Intronic
984078373 4:175212665-175212687 AGCAGGGCTGCATTTGTTTCTGG - Intergenic
984155398 4:176190518-176190540 GGCAGGGCTGCATTCCTTTCTGG + Intronic
984474300 4:180216640-180216662 GGCAGAGCTGCAGAGCTCTCGGG - Intergenic
984862380 4:184252458-184252480 GGCAGGGCTGGGTTTCTTTCTGG - Intergenic
985434366 4:189914747-189914769 GTCAGGGCTGTATTGCTTTCTGG - Intergenic
986205124 5:5616836-5616858 GTCAGGGCTGCCTTCCTTTCTGG - Intergenic
986650983 5:9963171-9963193 TGAAGAGCTGAATTCCCTTCAGG - Intergenic
986658860 5:10041332-10041354 CGCTGGGCTGCATTCCTTCCTGG + Intergenic
986788477 5:11137987-11138009 AGCAGGGCTGCATTACTTTTTGG + Intronic
987228483 5:15868299-15868321 AGGAGAGCTGCATTCTTTTCTGG - Intronic
987466458 5:18277742-18277764 AGAAAGGCTGCATTCCTTTCTGG + Intergenic
987640659 5:20607477-20607499 GGCTGTGCTTCATACCTTTCTGG - Intergenic
987907911 5:24102859-24102881 GGCATTTCTGCATTTCTTTCAGG - Intronic
987914101 5:24189351-24189373 GGTAGAGCTGCATCCCTTTCTGG + Intergenic
988183440 5:27828551-27828573 GGCAAAGCTGCATTCCTTGCTGG - Intergenic
988779399 5:34505895-34505917 GGCAGGGATGCACTCCTTTCTGG - Intergenic
988995050 5:36706659-36706681 GGCAGAGCTGAGTTCCTTTCTGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
989254664 5:39353204-39353226 GGCAGGGCCAGATTCCTTTCTGG - Intronic
989975682 5:50583947-50583969 GGCAGGGCTGCATTTCCTTCTGG - Intergenic
990312877 5:54556316-54556338 GGCCGGGCTGCATTCCTCTGTGG + Intergenic
990449974 5:55924866-55924888 GGCAGGGCTGTGTTCCTCTCTGG + Intergenic
990605591 5:57406769-57406791 GGCCAGGCTGCGTTCCTTTCTGG + Intergenic
990659872 5:58001454-58001476 CAGAGGGCTGCATTCCTTTCTGG + Intergenic
991138566 5:63212153-63212175 GGCAGGGCTGAATTCTTTTCAGG + Intergenic
991598758 5:68331620-68331642 GGCAGGGCTACATTTCTTTCTGG - Intergenic
991603229 5:68374114-68374136 AGAAGGGCTGCATTCCTTTCTGG - Intergenic
991608197 5:68424175-68424197 GGCAGGCCCCCATTCCTTTCTGG + Intergenic
992031204 5:72723105-72723127 GTCAGGGTTGCTTTCCTTTCTGG - Intergenic
992503730 5:77365748-77365770 GGCAAAGCTGCTCTCCTCTCTGG + Intronic
992654847 5:78898697-78898719 GAGAGGGCTGCATTCCCTTCTGG + Intronic
992751794 5:79869257-79869279 AGCAGGGATGCAGTCCTTTCTGG + Intergenic
992754636 5:79892740-79892762 GGCAGGGCTGCCTTCATTTCTGG - Intergenic
992885369 5:81153510-81153532 AGCAAGGTTGCATTCCTTTCAGG - Intronic
993084024 5:83340665-83340687 GGCAGAGCTGTATACTTCTCTGG - Intronic
993161729 5:84300122-84300144 AGCAGGGCTGCATTCCCTTCTGG + Intronic
993166057 5:84356386-84356408 TCCAGAACTGCACTCCTTTCTGG + Intronic
993483197 5:88450076-88450098 GGCAGGGCTGTGTTTCTTTCTGG - Intergenic
993917661 5:93762152-93762174 TGAGGAGCTGCATTCCTTTGAGG - Intronic
993986868 5:94607780-94607802 AGCGGAGCTTCATTCCTTTTTGG + Intronic
994599600 5:101886415-101886437 GGCACAGCTGGTTTCCTTTGAGG + Intergenic
995272310 5:110235659-110235681 GGCAGGGCTGTGTTCCTTTCTGG + Intergenic
995387121 5:111600364-111600386 AACAGGGCTGCATTCTTTTCTGG + Intergenic
995404140 5:111774764-111774786 AGCAGGGCTGCATTCCTTTCTGG - Intronic
995774401 5:115710285-115710307 TGCAGGTCTGCATTTCTTTCTGG + Intergenic
995788694 5:115860039-115860061 GGTATAGCTGCATCCCTTTCTGG + Intronic
996379189 5:122845995-122846017 GGATGGGCTGCGTTCCTTTCTGG + Intronic
996600447 5:125256526-125256548 GGCAGGGCTGCTTTCCTCACTGG - Intergenic
997007120 5:129831090-129831112 ATCAGAACTTCATTCCTTTCTGG - Intergenic
997060752 5:130499629-130499651 GTTAGGGCTGCATTCCTTTCTGG + Intergenic
997261566 5:132469332-132469354 AGCAGGGCTGCATTCCTTCCTGG - Intronic
997262278 5:132474442-132474464 AACAGAGCTGCATTTCTTCCTGG + Intronic
997280984 5:132645365-132645387 GGCAGAGCTGGATTCCAGTAGGG - Exonic
997604119 5:135161779-135161801 AGTAGGGCTGCATTTCTTTCTGG + Intronic
998039315 5:138942270-138942292 CGCAGGGCTGTACTCCTTTCTGG - Intergenic
998620010 5:143783236-143783258 AGCGGGGCTGCAATCCTTTCTGG - Intergenic
998634734 5:143940795-143940817 GGCAGGCCTGTATTCCTTTCTGG - Intergenic
998649916 5:144106930-144106952 AGCAGGGCTGCATCCCCTTCTGG - Intergenic
998773686 5:145574284-145574306 AGCAGAGTTGCATTAATTTCTGG - Intronic
999063159 5:148656486-148656508 TGTGGAGCTGCCTTCCTTTCTGG - Intronic
999403513 5:151285899-151285921 GGCAGAGCAGCATTCCTTTCTGG - Intronic
999711459 5:154322172-154322194 GGCAGGGTTACCTTCCTTTCTGG + Intronic
1000792777 5:165627531-165627553 GGCAGAGCGGCATTTCTTTCTGG + Intergenic
1000816053 5:165923069-165923091 AGTAAGGCTGCATTCCTTTCTGG - Intergenic
1001289155 5:170444216-170444238 GGCAGAGCTGCGTTCCTTCTGGG + Intronic
1002756388 6:164527-164549 TGCAGAGCAGCATTCCCATCAGG - Intergenic
1003900196 6:10647813-10647835 GGCAGGGCTGCAGTCCTAACTGG + Intergenic
1003950955 6:11115344-11115366 GGCCTGGCTGCGTTCCTTTCTGG + Intronic
1004140906 6:13016029-13016051 GGCAGTGCTGCTTTGGTTTCTGG - Intronic
1004430529 6:15538446-15538468 CGCAGAGCTGCGTTGTTTTCTGG - Intronic
1004740930 6:18460162-18460184 AGCCGGGCTGCATTTCTTTCTGG + Intronic
1004789707 6:19011386-19011408 GGCAGGGCTATATGCCTTTCTGG + Intergenic
1004841237 6:19587348-19587370 AGCAGAGCTGCATTATGTTCTGG - Intergenic
1005022807 6:21433807-21433829 GACTGGGCTGCATTCCTTTCTGG - Intergenic
1005153084 6:22775205-22775227 GGCTGACCTGGATTCCTTCCAGG + Intergenic
1005391203 6:25335279-25335301 AACAGAGCTGCATGCTTTTCGGG - Intronic
1005661299 6:28001748-28001770 GGCAGAGCTGCATTTATTAATGG + Intergenic
1005678630 6:28182627-28182649 AGCAGAGATGCATTCGTTTAGGG + Intergenic
1005696359 6:28356058-28356080 GGCAGAGCTGCATTTATTGACGG - Exonic
1005783285 6:29216277-29216299 GAAAGAGCTGCATTCTGTTCAGG + Intergenic
1005873861 6:29996761-29996783 GGAAGGCCTGCATTCCTTCCTGG - Intergenic
1006943898 6:37771426-37771448 GGCAGAGCTGCCCTCCCTCCAGG + Intergenic
1007246245 6:40465230-40465252 GGCAGAGCTACATTCCTTTCAGG - Intronic
1008132746 6:47737523-47737545 AGCAGGGCTGTGTTCCTTTCTGG + Intergenic
1008416709 6:51249207-51249229 AGCAAAGCTGCATTCCTTTCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1010365666 6:75048844-75048866 TGCAGGGCTTCATTACTTTCTGG + Intergenic
1010646071 6:78389105-78389127 AGCAGGACTACATTCCTTTCTGG + Intergenic
1010726919 6:79345451-79345473 GGTGGGGCTGCATTCCTTTCTGG - Intergenic
1010812622 6:80317347-80317369 AACAGAGCCGCATTCCTTTCTGG + Intronic
1011182692 6:84638816-84638838 GGTGAGGCTGCATTCCTTTCTGG - Intergenic
1011434353 6:87321596-87321618 GACAGAGGTCCATTCCTTTCAGG + Intronic
1011823953 6:91284532-91284554 TGCAGGGCTGCATTTCTTTCTGG - Intergenic
1011927776 6:92669257-92669279 AGCAGAGGTGTTTTCCTTTCTGG - Intergenic
1012037118 6:94156419-94156441 AACAGAGCTGCATTCCCTTCAGG + Intergenic
1012076864 6:94698935-94698957 GGCAGAACTGAATGCCTTCCAGG - Intergenic
1012435560 6:99211653-99211675 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1012738759 6:102985685-102985707 AGAAGAACTGCATTTCTTTCTGG - Intergenic
1012833810 6:104239998-104240020 AGCAAGGCTGCATTTCTTTCTGG + Intergenic
1012847025 6:104403414-104403436 CCTAGTGCTGCATTCCTTTCTGG + Intergenic
1013525327 6:110968791-110968813 GGCAGGAATGCATTCCTTTATGG + Intergenic
1013670871 6:112401058-112401080 GGCAGGGCTGTGTTTCTTTCTGG + Intergenic
1013732939 6:113190411-113190433 GGCAGGGAGGCATTCCTTTCTGG + Intergenic
1013945580 6:115718366-115718388 AGCAGGGCTGTATTCCTTTCTGG - Intergenic
1014391776 6:120873119-120873141 AGAAGAGCTGCATTCCTTTGGGG + Intergenic
1014617231 6:123618258-123618280 TTCAGGGCTACATTCCTTTCTGG + Intronic
1014649146 6:124013927-124013949 GGTACCGTTGCATTCCTTTCTGG - Intronic
1015081644 6:129233083-129233105 GGCATGGATACATTCCTTTCTGG - Intronic
1015820696 6:137257462-137257484 GGCAGGGCTGTGTTCCCTTCTGG + Intergenic
1015873684 6:137801749-137801771 AGCCAGGCTGCATTCCTTTCTGG + Intergenic
1016266264 6:142235558-142235580 GACAAGGCTGCATTCCTTTTTGG - Intergenic
1016363578 6:143292541-143292563 AGCAGGGCTGAGTTCCTTTCTGG - Intronic
1016488483 6:144569962-144569984 AGCAGGGCTGCATTTATTTCTGG - Intronic
1016871982 6:148826728-148826750 AGGAGGGCTGCTTTCCTTTCTGG + Intronic
1017326942 6:153151001-153151023 GGCAGAGCTGCATTTATTAATGG + Intergenic
1017533575 6:155322315-155322337 AGCAGGGCTGCCTTCCTTTCTGG - Intergenic
1017716604 6:157217709-157217731 GGCAGAGCTGCACTCCCCCCAGG - Intergenic
1019156747 6:170044423-170044445 GGCAGCACTGCCTTCATTTCAGG + Intergenic
1019629649 7:2041557-2041579 GACAGAGCTGAGCTCCTTTCAGG - Intronic
1020018971 7:4850755-4850777 GGCTGGGCTGCGTTCCTTTCTGG - Intronic
1020613667 7:10432096-10432118 TACAGGGCTGCATTCCTTCCAGG + Intergenic
1020744481 7:12064669-12064691 AGCAGGGTTGCATTCCTTTCTGG - Intergenic
1020999473 7:15310807-15310829 GGCAGGGCTGTGTTCCTTTCTGG + Intronic
1021160316 7:17264518-17264540 AGCAGAGCTGCATTCCTTTTTGG - Intergenic
1021421108 7:20445584-20445606 GACAGAGGTGCATTCCTTTCCGG + Intergenic
1021620276 7:22544435-22544457 AGCAGGACTGCATTCCTTTCTGG + Intronic
1021969837 7:25954607-25954629 AGCAGGGGTGCATTCCTTTCTGG + Intergenic
1022287569 7:28968753-28968775 GGCAGGATTGCATTTCTTTCCGG - Intergenic
1022349321 7:29552554-29552576 GGCAGGACTGCATTCCTTTATGG + Intergenic
1022407550 7:30105438-30105460 TGCACTACTGCATTCCTTTCTGG + Intronic
1023032281 7:36100776-36100798 GGCAGGGTTGCATTCCTGTATGG + Intergenic
1023109223 7:36793200-36793222 GACAGGGCTGCATCCCTTTCTGG - Intergenic
1023115599 7:36858838-36858860 AGCAGGGCTGTGTTCCTTTCTGG - Intronic
1024445165 7:49469248-49469270 TGCAGAGCTGCCTGCCATTCTGG - Intergenic
1024559619 7:50632121-50632143 GGCAGAATTACATTCCTTTTTGG - Intronic
1024761751 7:52606054-52606076 GGCAGGGCTGCTTTACTTTCTGG - Intergenic
1025633492 7:63300882-63300904 GGCAGTGCAGCCTTCCTTTGAGG + Intergenic
1025649204 7:63447275-63447297 GGCAGTGCAGCCTTCCTTTGAGG - Intergenic
1025937429 7:66048455-66048477 GGTAGGGCTGCAGTCCTTTCTGG - Intergenic
1025946703 7:66110231-66110253 AGCTGGGCTGCAGTCCTTTCTGG + Intronic
1026173907 7:67978711-67978733 GGCAGAGCTGCATCCCTTTCTGG - Intergenic
1027233183 7:76283414-76283436 TGCAGAGCTGAATTCCATGCCGG - Intronic
1027464817 7:78502417-78502439 GGCAGAGCTGTGTTCCTTTCCGG - Intronic
1028123652 7:87086168-87086190 GGCAGGGCTACGCTCCTTTCTGG - Intergenic
1028303378 7:89229402-89229424 GGAAGAGCAGCATTAATTTCAGG + Intronic
1028495715 7:91457463-91457485 GGCAGCACTGTGTTCCTTTCTGG - Intergenic
1028527643 7:91803030-91803052 GGCACAGCTGCATTCCTTTCTGG + Intronic
1028534164 7:91873233-91873255 AGCAAGGCTGCATTCCTTTCTGG + Exonic
1028605434 7:92650619-92650641 GGCAGAGCTGTGTTCCATTCTGG + Intronic
1028720754 7:94028047-94028069 AGCAGGACTGCATTCCTTCCTGG - Intergenic
1028879465 7:95863797-95863819 AAAAGAGCTCCATTCCTTTCAGG - Intronic
1030284435 7:107811331-107811353 GACAGGGCTGTGTTCCTTTCTGG + Intergenic
1030548402 7:110927684-110927706 AGCAAAGCTGCATTCTTTTCTGG - Intronic
1030979272 7:116167054-116167076 GGCAGGGCTGTATTCCTTTCTGG - Intergenic
1031605376 7:123762434-123762456 AGCAAAGCTGCATACCTTCCCGG + Intergenic
1031733470 7:125327173-125327195 AGCAGAGGAGCATTCCTTTATGG - Intergenic
1031915454 7:127558836-127558858 GACAGGGCTGTATTCCATTCTGG - Intergenic
1032123566 7:129174468-129174490 AGCAGGGTTGCATTCCTTGCTGG + Intergenic
1032125696 7:129190716-129190738 GGAAGAGCTGCATCCTTTTTGGG + Intronic
1032297162 7:130649997-130650019 GGTAGGGCTACAGTCCTTTCCGG + Intronic
1032389946 7:131549461-131549483 GGCAGAGCTCCATGAATTTCAGG + Intronic
1032603045 7:133320295-133320317 GGCAGGGCTGTGTTCCTTTTTGG + Intronic
1032755744 7:134889216-134889238 AGCAGGGCTGTATTCCTTCCTGG + Intronic
1032822624 7:135538553-135538575 GGCAGAGATGCATGTCTGTCTGG + Intergenic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1033214017 7:139481205-139481227 AGTGGGGCTGCATTCCTTTCTGG - Intronic
1033619306 7:143048209-143048231 ATCAGGGCTGCCTTCCTTTCTGG - Intergenic
1033982135 7:147178410-147178432 GGCAGGACTACATTCCTTTCTGG - Intronic
1034045067 7:147919186-147919208 GTCAGGGCTGTGTTCCTTTCTGG - Intronic
1034923366 7:155101713-155101735 TGCAGGGCTGCATGCCTTTCTGG + Intergenic
1035723015 8:1806492-1806514 GGCAGGGCTGCATTCCCATCTGG - Intergenic
1035947236 8:3978781-3978803 GGGAAAGCAGCTTTCCTTTCCGG + Intronic
1036198397 8:6744489-6744511 GGCAGGGCTGCAGTCCTTTGTGG + Intronic
1036531013 8:9587365-9587387 GGCAAGGCTGAATTCCTTACTGG - Intronic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1037218828 8:16490998-16491020 GGCAGGGCTGCATTCCCATCAGG - Intronic
1037273966 8:17157278-17157300 GGCGGAGCTGGATCCCTTGCTGG + Intronic
1037379268 8:18266910-18266932 GGCAGAACTGAATTCCTCACAGG - Intergenic
1037595415 8:20350388-20350410 GGCAGAGCTGCTTACCTTCACGG - Intergenic
1038675483 8:29619040-29619062 GACAGAGTTGAATTCCTTGCGGG + Intergenic
1039101469 8:33946527-33946549 AGCAGGACTGCATTCCCTTCTGG + Intergenic
1039146244 8:34450789-34450811 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1039432129 8:37533182-37533204 GGCAGGGCTGTGTTTCTTTCTGG + Intergenic
1039855694 8:41411142-41411164 GGCATAACTGCATACCTATCTGG - Intergenic
1039885406 8:41651380-41651402 GGCTGAGTGGCATTGCTTTCTGG + Intergenic
1040566470 8:48572105-48572127 AGCAAAGCTGCATTCAGTTCAGG + Intergenic
1040793099 8:51256759-51256781 AGCCGAGCTGCATTCCCATCTGG + Intergenic
1041636075 8:60146521-60146543 AGCTGGGCTGCATTCCTTTCTGG + Intergenic
1041684162 8:60627326-60627348 GGCAGGGCTGTATTACTTTCTGG + Intergenic
1041799293 8:61781314-61781336 GGCAGAGCTGCATTTCATAGTGG - Intergenic
1041860343 8:62505890-62505912 GGCAGGGCTGGATTCTTTTATGG + Intronic
1041922495 8:63198086-63198108 GGCAGGGCTCCATCTCTTTCTGG - Intronic
1042044953 8:64640109-64640131 GGCAGATCAGCATTCCCTTGGGG + Intronic
1042057491 8:64781446-64781468 GGTATGGCTGAATTCCTTTCTGG + Intronic
1042109162 8:65361026-65361048 GGTGAAGCTGCATTCCTTTCTGG + Intergenic
1042556830 8:70040743-70040765 TGAAAAGCTGCATTCTTTTCAGG - Intergenic
1042708695 8:71690952-71690974 GGCAGGGCTGTGTGCCTTTCTGG + Intergenic
1043345323 8:79291443-79291465 AGCAGGGCTGCGTTCCCTTCTGG - Intergenic
1044082369 8:87901272-87901294 GGCATGGCTGCATTTCTTTCTGG + Intergenic
1044243181 8:89911059-89911081 GGCAGGGCTGTGTTGCTTTCTGG + Intronic
1044270705 8:90239810-90239832 GGCAGGGCTGCATTCCTTACTGG - Intergenic
1044432427 8:92124253-92124275 GGTAGAGCTGCATTCATTCCAGG - Intergenic
1044501241 8:92960760-92960782 GACAGGGCTGCATTCCTTTCTGG - Intronic
1044796188 8:95900539-95900561 GACAGAGCTGCATTCTTTTCTGG + Intergenic
1044875240 8:96658868-96658890 GGCAGGACTGCATCCCTTTCTGG - Intronic
1044942989 8:97362097-97362119 AGCAGAGCTGCAGTCCTGGCTGG - Intergenic
1045222648 8:100213536-100213558 GGCATCGCTGCATTCCTCCCAGG + Intronic
1045280749 8:100747545-100747567 GGCACCACTGCATTCCATTCCGG + Intergenic
1045635200 8:104178184-104178206 GGCAGGACTACATTCCTTTCTGG + Intronic
1045939033 8:107716967-107716989 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1046275268 8:111950774-111950796 GGAGAGGCTGCATTCCTTTCTGG - Intergenic
1046358751 8:113122712-113122734 ATCAGAGCTGCATTCCTTTCTGG - Intronic
1047436154 8:124836858-124836880 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
1047546150 8:125819179-125819201 GACAGGGCTGCATTTCTTTCTGG - Intergenic
1047572056 8:126109966-126109988 CACAGGGCTGCATTTCTTTCTGG + Intergenic
1047751990 8:127888778-127888800 GGGAGGGCTGCATTTCTTTCTGG - Intergenic
1047919316 8:129617529-129617551 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1048519077 8:135137265-135137287 GGCAGGGCTGCACTCCTTTCTGG - Intergenic
1048742178 8:137573229-137573251 GGCAGGGCTGCACTCCTTTTTGG - Intergenic
1050306131 9:4307837-4307859 GGCAGGGCTGTGTGCCTTTCTGG - Intronic
1050433736 9:5587750-5587772 GGCAGAGCTGGATTCAACTCAGG - Intergenic
1050982233 9:12035227-12035249 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1051640365 9:19219417-19219439 AGCAGGGCTGTGTTCCTTTCTGG + Intergenic
1051880441 9:21834505-21834527 AGCACGGCTGCATTCCTTTCTGG + Intronic
1052278229 9:26702874-26702896 GGAAAAGCTGCTTTCTTTTCTGG + Intergenic
1053470340 9:38341781-38341803 GGCAGGGCAGCATTCCCTTCTGG + Intergenic
1053531747 9:38888973-38888995 GGAGGAGCTGCATTTCTTTCTGG - Intergenic
1053723449 9:40972851-40972873 GTCAGGGCTGTATTGCTTTCTGG - Intergenic
1054203970 9:62113401-62113423 GGAGGAGCTGCATTTCTTTCTGG - Intergenic
1054342514 9:63879145-63879167 GTCAGGGCTGTATTGCTTTCTGG + Intergenic
1054634392 9:67474964-67474986 GGAGGAGCTGCATTTCTTTCTGG + Intergenic
1054742553 9:68822916-68822938 TGCAGAGCTGTATTCCTTCCTGG + Intronic
1055228516 9:74031134-74031156 AGCAGGGCTACATTCCCTTCTGG + Intergenic
1055678470 9:78690462-78690484 GGTAGGTCTGCATTTCTTTCTGG + Intergenic
1055955342 9:81768212-81768234 GGCACAGCTACATTCCTTTCTGG + Intergenic
1056332266 9:85530825-85530847 GGCAGCGCTGCACCCCTTTCCGG + Intergenic
1056479075 9:86982593-86982615 GGCAGAGTTGCATTCCTTTCTGG - Intergenic
1056914747 9:90736205-90736227 GGCAGAGATGCATTCCTCTCTGG - Intergenic
1056997491 9:91477152-91477174 GGCTGGGCTGAATTCCTGTCTGG + Intergenic
1057716599 9:97501348-97501370 GGCAGATTTGCATTCCTGTGGGG - Intronic
1057738467 9:97690015-97690037 GGCAGGGCTGTGTTCCTTTCTGG + Intronic
1057919154 9:99082432-99082454 GCCACAGCTGCAGTTCTTTCTGG + Intergenic
1057958184 9:99428954-99428976 GTCAGGGCTACATTTCTTTCTGG - Intergenic
1057992093 9:99781307-99781329 GGTAGGGCTGCATTCCCTTCTGG + Intergenic
1058257506 9:102787385-102787407 GGGAGAGCTGCATTCCAGTATGG - Intergenic
1058962447 9:110005066-110005088 TGGTGAGCTGCATTCCTTTGGGG + Intronic
1059405273 9:114095274-114095296 AGCAGAGCCACATCCCTTTCCGG - Exonic
1059419934 9:114184518-114184540 GGCTGGGCTGGGTTCCTTTCCGG + Intronic
1059710003 9:116858982-116859004 GGCAGGGTTGCATTCCTTTCTGG + Intronic
1059765004 9:117375819-117375841 AGCAGGGCTGCATTCCCTTCTGG + Intronic
1059860813 9:118459308-118459330 GGCACAGCTACATTCATGTCTGG - Intergenic
1059894176 9:118841910-118841932 GGTAGAACTTGATTCCTTTCTGG + Intergenic
1061166906 9:128928237-128928259 TGCACAGCTGCCTTCCATTCGGG + Intronic
1061751804 9:132783322-132783344 GCCAGGGCTGCATTCCTTCCTGG - Intronic
1203451706 Un_GL000219v1:123130-123152 GTCAGGGCTGTATTGCTTTCTGG + Intergenic
1185789986 X:2921923-2921945 AGCCGAGCTGCATTCCTCACAGG - Exonic
1186081192 X:5934569-5934591 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1186128868 X:6444993-6445015 GGCAGGGCTGTCTTCCTCTCTGG + Intergenic
1186134598 X:6505813-6505835 AGCAGTGCTGCCTTTCTTTCAGG + Intergenic
1186197113 X:7120431-7120453 GGCAGGGCTGTGTTCCTTTCTGG - Intronic
1186206753 X:7208823-7208845 GGCAGGGCTGCTTTCTTTTCTGG + Intergenic
1186273862 X:7919327-7919349 GGCAGGGCTGCATCTCTTTCTGG + Intronic
1186280793 X:7990569-7990591 GGTGGGGCTGCATTCCTTTCTGG - Intergenic
1186331826 X:8542604-8542626 GGCAGGCCTGTACTCCTTTCTGG + Intronic
1186421064 X:9426858-9426880 AGCAGGGCTGTACTCCTTTCTGG - Intergenic
1186489329 X:9959343-9959365 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1186621895 X:11250523-11250545 AGCAGAGCTTTGTTCCTTTCTGG + Intronic
1186644348 X:11490441-11490463 AGCTGAGCTGCATTTCTCTCTGG - Intronic
1186676059 X:11818577-11818599 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1186965710 X:14784313-14784335 AGCAGAGCTGCATTCCTTTCTGG + Intergenic
1187077331 X:15948116-15948138 TGCAGGGCTGCATTCCTTCTGGG + Intergenic
1187111272 X:16303060-16303082 CACAGGGCTACATTCCTTTCTGG - Intergenic
1187504094 X:19864637-19864659 GACTGGGCTGCATTCCTTTTTGG - Intronic
1187641353 X:21293741-21293763 AGCACAGCTGTTTTCCTTTCAGG - Intergenic
1187727032 X:22214128-22214150 AGCAGGGCTACTTTCCTTTCTGG + Intronic
1187800668 X:23059277-23059299 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
1187909695 X:24100031-24100053 GACAAGGCTGCATTCTTTTCTGG + Intergenic
1188138481 X:26519168-26519190 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1188171721 X:26936012-26936034 GACAGGGATGCATTACTTTCTGG + Intergenic
1188400209 X:29735121-29735143 GGCAGGGCTGCATCCCTTTCTGG + Intronic
1188480414 X:30631202-30631224 GGCAAGGCTGCATTCCTTTCTGG - Intergenic
1188510219 X:30927864-30927886 AGCAGGGCTGCATTCCCTCCTGG + Intronic
1188897225 X:35684356-35684378 GGCAGGGCCACATTTCTTTCTGG - Intergenic
1188915928 X:35910936-35910958 CGCAGAGCTACACTCCTTTCTGG + Intergenic
1189114673 X:38330275-38330297 AGTAGAGTTGCATTCCCTTCTGG - Intronic
1189216576 X:39330243-39330265 GTCAGACCTGCATTGCTCTCTGG + Intergenic
1190029676 X:46959849-46959871 GACAGAGCTGCATGCTTTGCAGG + Intronic
1191918951 X:66233291-66233313 GGCAGTGATGGATGCCTTTCAGG - Intronic
1191951761 X:66600543-66600565 GGCAGGGCTGTGTTTCTTTCTGG - Intronic
1192144667 X:68673691-68673713 GGCAGAGCTGGTTTCCTTCCAGG - Intronic
1192848176 X:74926233-74926255 GGCAGATCTGTTTTCCTTCCTGG - Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1193079979 X:77397290-77397312 AGCAGGGCTGCATTCATTTCTGG + Intergenic
1193360940 X:80577410-80577432 GGCAGCTCTGCATTTCTCTCAGG - Intergenic
1193799049 X:85913586-85913608 GGCAGGGCTGCATTTCTTCTCGG - Intronic
1194129242 X:90059707-90059729 GGCAGAGTTGCATTCTTTTCTGG - Intergenic
1194359304 X:92929242-92929264 GGCATGGCTGTATTCCTTTATGG + Intergenic
1194412549 X:93574839-93574861 GGCAGAGCTGCTTTTCTTTATGG - Intergenic
1194436300 X:93872298-93872320 AGCAGAGCTGCTGTCCTTTAAGG - Intergenic
1194564700 X:95470282-95470304 GGCAGGGCTGTATTCACTTCTGG - Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1194754931 X:97727710-97727732 GTCATAGCTGCATTCCTTTCTGG - Intergenic
1195026527 X:100883060-100883082 GACAGGGCTGCATTCCTTTCTGG - Intergenic
1195433459 X:104815314-104815336 GGCAGGGCTGCATTCTTTTCTGG + Intronic
1195491399 X:105474300-105474322 AGCAGGGCTGCATACCTTTCTGG - Intronic
1195622764 X:106973854-106973876 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1195637328 X:107132972-107132994 GGCAGGAATGCATTCCTTTATGG + Intronic
1196049378 X:111289007-111289029 GCCAGGGCTGCTTCCCTTTCAGG + Intergenic
1196579740 X:117364756-117364778 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1196595430 X:117540615-117540637 AGCAGAGCTGTATTCCTTTTTGG + Intergenic
1196596429 X:117551100-117551122 GACAGGACTGCATTCCCTTCTGG - Intergenic
1196790383 X:119459067-119459089 GGCAGGCCTGCATGCCTCTCTGG - Intergenic
1196963747 X:121032572-121032594 GGCAGGGCTGCATGCCTTTTTGG + Intergenic
1197737489 X:129862473-129862495 GGCAGGGCTGGTTTCCTTTGAGG - Intergenic
1198651767 X:138870945-138870967 GGCAGGGCTGCATTCCTTTTTGG - Intronic
1198834129 X:140783605-140783627 GGAAGACCTGGATTTCTTTCTGG - Exonic
1198834133 X:140783644-140783666 GGAAGACCTGGATTTCTTTCTGG - Exonic
1199226646 X:145383750-145383772 CCCAAAGCTGCTTTCCTTTCTGG + Intergenic
1199691547 X:150312638-150312660 GGCAGTGCTCCAGCCCTTTCAGG - Intergenic
1199923218 X:152431886-152431908 GGCAGGGCTGTGTTCCTTTTTGG - Intronic
1199933762 X:152551413-152551435 GGCAGGGCTGTGTTCTTTTCTGG - Intergenic
1200291365 X:154877667-154877689 ATCAGGGCTGCATTTCTTTCTGG - Intronic
1200356346 X:155556237-155556259 GGCCAGGCTACATTCCTTTCTGG - Intronic
1200667500 Y:6045077-6045099 GGCATGGCTGTATTCCTTTATGG + Intergenic
1201430788 Y:13900014-13900036 GGCAGGCCTGTACTCCTTTCTGG - Intergenic
1201448435 Y:14083458-14083480 GGCAGGGCTGCGTCTCTTTCTGG - Intergenic
1201513901 Y:14795964-14795986 GGCAGGGCTGTATTCCTCTCTGG + Intronic
1201593089 Y:15637009-15637031 AGAAGAGCTGCATTCTTTTTTGG - Intergenic
1201902256 Y:19055637-19055659 GGCAGAGCTGAATAGCTGTCAGG + Intergenic