ID: 1008882094

View in Genome Browser
Species Human (GRCh38)
Location 6:56390884-56390906
Sequence TGTCCAATGCTAAAAGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008882094 Original CRISPR TGTCCAATGCTAAAAGTAGG TGG (reversed) Intronic
903702135 1:25257228-25257250 TGATAAATGCTAAAAATAGGAGG - Intronic
904963162 1:34350565-34350587 TGTCCAGTGGTAAGTGTAGGGGG + Intergenic
906436412 1:45800624-45800646 GGTCCAATCCTACAAGCAGGAGG - Intronic
908641847 1:66232585-66232607 TTTCCAATTCTAAATGTTGGAGG - Intronic
908769971 1:67587071-67587093 TGGACAATGGTAAGAGTAGGAGG - Intergenic
910013102 1:82489770-82489792 TGTCCAATACTAATAGTAGTGGG + Intergenic
910603579 1:89057908-89057930 TTTTCAATGCTGAAACTAGGTGG + Intronic
912056539 1:105605960-105605982 TGTCACATGTAAAAAGTAGGTGG + Intergenic
912109678 1:106325802-106325824 TGTCAAATGGTAACAGCAGGAGG - Intergenic
913264464 1:117030984-117031006 TGCCCAATGCTCAAAGTACAAGG - Intronic
916184311 1:162115967-162115989 TGTCAAATACTCAAAGTAGAAGG + Intronic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
920783395 1:209016690-209016712 AATCCAATGATAAAAGTAGAGGG - Intergenic
921297098 1:213714664-213714686 TGACCAATGCCAAAACAAGGAGG + Intergenic
921848818 1:219912402-219912424 TGGCCAATGCTAAAATAATGTGG + Intronic
1063514841 10:6685581-6685603 TGTCCAAGGCTAGAACTAAGAGG + Intergenic
1066088423 10:31993991-31994013 TATCCAAGTCCAAAAGTAGGAGG + Intergenic
1066529148 10:36317117-36317139 CTTCCAATGCTAAAACTATGAGG - Intergenic
1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG + Intergenic
1068445721 10:57119971-57119993 TGTTCAATGCTTAATGCAGGAGG + Intergenic
1069600357 10:69701598-69701620 TGACTAATGCTAAAATTAGTGGG - Intergenic
1077362404 11:2146513-2146535 TGCCCAAAGCCAAAAGTACGTGG + Intronic
1079707215 11:23635965-23635987 CATCAAATGCTAAAAGTGGGGGG - Intergenic
1080508262 11:32940236-32940258 TGTGCAAGGCTAACAGTAAGGGG - Intronic
1080604967 11:33857704-33857726 TGTAAAATGCTACAAGTAGTTGG - Intergenic
1082145232 11:48658592-48658614 TGTCCAAGGATAAAACTAGAAGG + Intergenic
1085839918 11:79999939-79999961 TGTGCAAGTCTAAAAGTTGGGGG + Intergenic
1087553432 11:99682393-99682415 AGTACAATGCTAAAAATATGAGG + Intronic
1087974659 11:104530172-104530194 TGTCCAATAGTAAAAGTAAATGG + Intergenic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1091129017 11:133128376-133128398 TTTCGAATGTAAAAAGTAGGAGG + Intronic
1092633678 12:10415741-10415763 TGTGCAATGCTACATGTACGTGG - Exonic
1095818922 12:46455546-46455568 TGTCCAATACTAAAATTATCTGG - Intergenic
1095876116 12:47080645-47080667 TGTCCAATTCAAGAAGGAGGAGG + Intronic
1096906421 12:54941000-54941022 TGTTAAATTTTAAAAGTAGGAGG - Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1102803766 12:115761235-115761257 TGCCCCATGCTAAAAATAAGTGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105224454 13:18417021-18417043 TGACCAAGGCTAAAAGGAAGGGG - Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107369956 13:39734675-39734697 TGTCCAGTGCTCAAAGTAGAGGG + Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108812614 13:54247337-54247359 AGTGCATTTCTAAAAGTAGGTGG + Intergenic
1112100028 13:96178427-96178449 TTTCAAATGCCAAAAGAAGGAGG + Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117326466 14:54673506-54673528 TTTCCAGTGCTAAAAGCAGCAGG - Intronic
1118629703 14:67691416-67691438 TGCCCCATAGTAAAAGTAGGTGG - Intronic
1122335070 14:100969140-100969162 TGTCCAATTATAAAAATAGATGG + Intergenic
1124594189 15:31080205-31080227 TGATGAATGCTAAAAGTAGTGGG + Intronic
1125222790 15:37358677-37358699 TGGTCAATGCAAAAAGCAGGAGG - Intergenic
1127252183 15:57250996-57251018 TGTACAATGCTATAGGAAGGGGG + Intronic
1127469171 15:59275287-59275309 TCTCTAATGCTAAGAGGAGGTGG - Intronic
1144015734 17:11193562-11193584 TGTTCAATGCAAAAAGAAGATGG + Intergenic
1147978287 17:44260215-44260237 TGTCCTATGCTCAGAGTTGGGGG - Intronic
1151222686 17:72624801-72624823 TGTCCAATGCTGGAAGAAGAGGG - Intergenic
1154528903 18:15322427-15322449 TGACCAAGGCTAAAAGGAAGGGG + Intergenic
1155706499 18:28822120-28822142 TGTCCAATGCTAAGCATGGGGGG + Intergenic
1156584463 18:38416334-38416356 TGCCCAATGCTTACAGTAGAAGG + Intergenic
1156705899 18:39882095-39882117 TATCAAATGCTTAAATTAGGAGG + Intergenic
1158660946 18:59386965-59386987 TTTCCAATGATTAAAGTAGTGGG + Intergenic
1160409231 18:78663876-78663898 TGTCAAAGGCTAAATGTAGAGGG + Intergenic
1163240105 19:16057061-16057083 TGTGGAATGTGAAAAGTAGGTGG - Intergenic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
925594184 2:5539119-5539141 TGCCCCATGCTAAAAGTATCAGG - Intergenic
927199609 2:20570191-20570213 TGTCCCAGCCTAAAAGAAGGGGG - Intronic
937033704 2:118763254-118763276 TGTCCAACGCTAAACATAAGTGG + Intergenic
937820019 2:126299583-126299605 TGTGCAATGCTAAATATAGATGG - Intergenic
937850765 2:126633237-126633259 TGTCCAATCCTAAAAATAAATGG + Intergenic
941326105 2:164116504-164116526 TATTCAAAGCTAAAAGTAGAAGG - Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
941661378 2:168199048-168199070 TGGGCAATGCTAAAAGTAGCAGG + Intronic
943416141 2:187607130-187607152 TGTCTAGTTTTAAAAGTAGGAGG - Intergenic
944537694 2:200727471-200727493 TGTCCCATCCTAAAAGTAACTGG - Intergenic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
1169088132 20:2840011-2840033 TGCTCAATGCTAAAGGGAGGAGG + Intronic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1172876670 20:38168489-38168511 TGTGCAATGCTTAGAGCAGGAGG + Intergenic
1173161545 20:40656340-40656362 TTTCTAATGCTAAAAGTTGAGGG + Intergenic
1178300340 21:31447924-31447946 AGTCCAAGGCTGAAAGCAGGAGG + Intronic
1178787181 21:35664447-35664469 TGACTAATGGTAAGAGTAGGTGG + Intronic
1178827109 21:36026161-36026183 GGTTCAATGTTAAGAGTAGGTGG - Intergenic
1183014445 22:34974290-34974312 AGGCCCATCCTAAAAGTAGGAGG + Intergenic
1183423556 22:37725734-37725756 TGTCCAATGCACACAGCAGGTGG - Exonic
950952836 3:17018600-17018622 TGTCCAATGCAATAAATAAGGGG - Intronic
951664299 3:25104882-25104904 TCTCCAGTGCTAGAAGTTGGGGG + Intergenic
952093423 3:29919805-29919827 TGTACAATGCTGAAAGCAGCAGG - Intronic
958449558 3:94257110-94257132 TCTGCAATGCTAAAACAAGGGGG - Intergenic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
959212620 3:103407181-103407203 TGACCAATTCTAAAATTAGATGG - Intergenic
959568205 3:107854236-107854258 ATTCCAAAGCTAAAAGTAGAAGG - Intergenic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
965979803 3:174674142-174674164 TGTCATATGGTAAAAGCAGGAGG + Intronic
966185988 3:177227749-177227771 TATACATTGCTAGAAGTAGGAGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
970727808 4:19067535-19067557 TGTCCAATTATAGAAGTATGGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973832695 4:54778057-54778079 TGTGCTCTGCTAAAAGTAAGTGG - Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
980758240 4:137193005-137193027 TGTCCAGTGGTAAAAGTTAGTGG + Intergenic
983046439 4:162992234-162992256 TTTCCAATGCAATAAGTAGAAGG - Intergenic
983880012 4:172922593-172922615 TGTGCTATGGTAAAAGTAAGGGG + Intronic
984676373 4:182552683-182552705 TGGCCAATGCTAGAACTAGATGG - Intronic
991060231 5:62366947-62366969 TGTCAAATTCTAAAAATAAGTGG + Intronic
992231502 5:74668670-74668692 TGTCCACTGCTTATAGCAGGAGG - Intronic
995682179 5:114732071-114732093 TTTCAGATGCTAAAAGGAGGAGG + Intergenic
995710297 5:115028345-115028367 TGTGAAATGCTAACAGTAAGTGG - Intergenic
997671386 5:135677031-135677053 TGTCTAATGCTAATAGTAGAGGG + Intergenic
998036223 5:138919045-138919067 TGTAAACTGCAAAAAGTAGGGGG + Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999802027 5:155047144-155047166 TCTCCATTCCTAAAAGTAGGGGG - Intergenic
1001722412 5:173867467-173867489 TGTGCAATGGGAAAAGAAGGAGG + Intergenic
1004942579 6:20575923-20575945 TCTCAAATGCTAAGAGGAGGAGG + Intronic
1005064093 6:21801552-21801574 AGTGCAATGCTGAAAGTTGGAGG + Intergenic
1005612851 6:27543626-27543648 TGTTCACTGACAAAAGTAGGAGG - Intergenic
1007452448 6:41950559-41950581 TGTCCCAGGCTCATAGTAGGTGG + Intronic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011509577 6:88085867-88085889 TGTCCATTGCTAATCGTGGGAGG - Intergenic
1014587662 6:123219875-123219897 AATCCATTGCTAAAAGTAGAAGG + Intronic
1014598197 6:123372409-123372431 TGTGCAATGCTAAAATCAAGGGG + Intronic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1018230334 6:161669336-161669358 TGTCCCATGATTAAAGTAGCTGG - Intronic
1019505965 7:1391290-1391312 AGTCCAATGCTAACTGTAAGAGG + Intergenic
1023924519 7:44656341-44656363 CTTCGAATGCTAACAGTAGGAGG + Intronic
1024597809 7:50954832-50954854 TGTCCAATGGTCACAGGAGGAGG + Intergenic
1024662913 7:51515882-51515904 AGTACAATGTTAAAAGGAGGTGG + Intergenic
1026279774 7:68911920-68911942 TGTTCAATGCAAAAAGTAGAAGG - Intergenic
1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG + Intronic
1031295236 7:119993737-119993759 TTTAAAATGCTAAAAGGAGGAGG - Intergenic
1036721173 8:11176930-11176952 TGGCCAATGCTAAGAGAAGGTGG + Intronic
1038459119 8:27701883-27701905 TGTTCAGTGCTAAAACTGGGAGG + Intergenic
1043367157 8:79546130-79546152 TGTCCAGTGCTGAAAGTAGCTGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1047262895 8:123277964-123277986 GGTCCTATGCTAGAAGTAGAGGG - Intergenic
1047810102 8:128399218-128399240 TGTTCATTGCTAGAAATAGGGGG - Intergenic
1047937014 8:129791872-129791894 TGTCCAATACTAAAAGTCGTGGG + Intergenic
1048825362 8:138419420-138419442 TGTCTAATACTATCAGTAGGGGG - Intronic
1048931385 8:139318207-139318229 TGTCCAATTCTTAAAGCAGGTGG + Intergenic
1050966923 9:11816539-11816561 TGTCTAACACTAAAAGTTGGGGG + Intergenic
1051262760 9:15280789-15280811 TTCCCAATTCCAAAAGTAGGAGG + Intronic
1051499997 9:17765945-17765967 TCTCTAATACAAAAAGTAGGAGG + Intronic
1052465422 9:28823215-28823237 TGTCAAATGTTAGCAGTAGGGGG + Intergenic
1052525320 9:29610519-29610541 TGTCCCTTGCTAAAAGTGGAGGG - Intergenic
1056255245 9:84792504-84792526 TGTACAAGGACAAAAGTAGGTGG - Intronic
1058576623 9:106410475-106410497 TGTCCTATGCTAAAAGTCTTAGG - Intergenic
1060561634 9:124549763-124549785 TGTCCATTGTTAAAAGGAGGAGG - Intronic
1186321284 X:8428280-8428302 TCTCTAAAGCTAAAAGTAGAGGG - Intergenic
1192149275 X:68701905-68701927 TGTCCCATGCTAGAATTGGGTGG + Intronic
1192831891 X:74758975-74758997 TGACCAATGTGAAAAGTAGGTGG - Intronic
1193076421 X:77360516-77360538 AATCCAATGCTAAAAGTAGTTGG + Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1194881841 X:99262190-99262212 TGTTCAATACTGAAAGCAGGAGG + Intergenic
1195631557 X:107060724-107060746 TGATGAATGCTAAAAGTAGTGGG + Intergenic
1195656594 X:107337168-107337190 TTTCCAATTCTAAAAGTCAGTGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199587780 X:149434490-149434512 TGTCCTATGCTAGAGGGAGGTGG - Intergenic
1202244525 Y:22805331-22805353 TGTGCAATGGGAAAAGGAGGTGG - Intergenic
1202397514 Y:24439077-24439099 TGTGCAATGGGAAAAGGAGGTGG - Intergenic
1202473267 Y:25231010-25231032 TGTGCAATGGGAAAAGGAGGTGG + Intergenic