ID: 1008883649

View in Genome Browser
Species Human (GRCh38)
Location 6:56408906-56408928
Sequence GAATTGAACTGATATGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008883647_1008883649 6 Left 1008883647 6:56408877-56408899 CCAACGACAGTCTCAGACTGTGC No data
Right 1008883649 6:56408906-56408928 GAATTGAACTGATATGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008883649 Original CRISPR GAATTGAACTGATATGTATC AGG Intergenic
No off target data available for this crispr