ID: 1008888768

View in Genome Browser
Species Human (GRCh38)
Location 6:56460628-56460650
Sequence CTGCATGCATAGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008888762_1008888768 12 Left 1008888762 6:56460593-56460615 CCAGAGTTAATGGTGTATTGCTA 0: 1
1: 1
2: 0
3: 4
4: 103
Right 1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008888768 Original CRISPR CTGCATGCATAGAGGGGGCA TGG Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
901677702 1:10896529-10896551 TGGCATGCCTAGAGAGGGCATGG - Intergenic
901780982 1:11594346-11594368 ATTCCTGCCTAGAGGGGGCAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905340316 1:37273536-37273558 CTGGATGCTGAGAGTGGGCAAGG - Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905662133 1:39735779-39735801 CAGCATGCCTAGAGAGGGCATGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906845410 1:49186173-49186195 ATGTATGCATAGGGGAGGCAGGG - Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908872183 1:68626144-68626166 GGGCATGCATGTAGGGGGCAGGG + Intergenic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
912470240 1:109901742-109901764 CTGCATGCATACAGGATGCTGGG - Intergenic
916556946 1:165901426-165901448 GTGCATGCACAGAGAGGCCAGGG - Intronic
917557355 1:176103461-176103483 ATGCATGCCCAGAGAGGGCATGG + Intronic
917671092 1:177274271-177274293 CTGCAGGCATCCTGGGGGCAGGG + Intronic
918210965 1:182350310-182350332 CTGAATGCAGAGAGGTTGCATGG + Intergenic
920194364 1:204217060-204217082 CTGGAGGCATAGAAGTGGCAGGG + Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922966872 1:229697802-229697824 TTGCATGCCCAGAGAGGGCATGG - Intergenic
923545506 1:234920405-234920427 CTGCATGAATGGAAGGGGCTGGG - Intergenic
1064102046 10:12472410-12472432 CTCCCTGCATAGAGGGAGAAGGG - Intronic
1065825057 10:29563033-29563055 ATGCATGGAGAGAGGGGGAAGGG + Intronic
1065952352 10:30663786-30663808 ATGCATGGAGAGAGGGGGAAGGG - Intergenic
1074918159 10:117979190-117979212 ATGCATGCATAGAGGTGGAGGGG + Intergenic
1075071210 10:119320962-119320984 CTGTATCCTGAGAGGGGGCAGGG - Intronic
1075883607 10:125877033-125877055 ATGAATGTATGGAGGGGGCAGGG + Intronic
1077236651 11:1485103-1485125 CTGGATGCATGGAGGGGCCGAGG - Intronic
1077495709 11:2885693-2885715 CAGCAGGCATCGAGGGGGCGCGG - Exonic
1078667988 11:13341872-13341894 CTGCATTCAAAGAGGGCACAGGG - Intronic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1082855923 11:57806560-57806582 CTACATGCATAGACAGGGAAAGG - Intronic
1083397503 11:62401723-62401745 CTGCAGGAAGAGAGAGGGCAGGG + Intergenic
1084615195 11:70231250-70231272 CTGCCTGCACAGAGGAGCCAGGG + Intergenic
1088679994 11:112231829-112231851 CAGCATGCATTTATGGGGCAGGG + Intronic
1088903558 11:114137048-114137070 CTGTATGCATAGAGGGCCCAGGG + Intronic
1089207817 11:116779096-116779118 CTGCCTGCAGAGAGGGGGAGTGG - Intronic
1089607835 11:119651909-119651931 CCACATGCAGAGAGGGGTCATGG + Intronic
1091019069 11:132082423-132082445 CTGCATGCATACCGGGGGAATGG - Intronic
1095477786 12:42603509-42603531 GTGCATGCATAGAGGGTGGAGGG - Intergenic
1096123915 12:49106048-49106070 CTGCCTTCTTTGAGGGGGCAGGG - Intronic
1096258185 12:50075239-50075261 CTGCAGGCATACAGGGGCCTGGG + Intronic
1100184970 12:92129071-92129093 CTGCATGGAGGGAGGGGGAAGGG + Intronic
1102252229 12:111395001-111395023 CTGAAGGAATAGAGAGGGCAGGG + Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1113539343 13:111094068-111094090 CTGCATGCATACAGGGTTAAAGG - Intergenic
1113737307 13:112688237-112688259 CAGCAAGGATAGAGAGGGCATGG + Intergenic
1118681014 14:68241711-68241733 CTGCTTGCAGGGAGAGGGCAGGG - Intronic
1119154167 14:72393159-72393181 CTTCATGCATAGGGGTGGCTTGG - Intronic
1121269403 14:92627909-92627931 CTGCATGCAAAGCAGAGGCAAGG + Intronic
1122327551 14:100891559-100891581 AGTCAAGCATAGAGGGGGCAGGG - Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133146609 16:3791728-3791750 GTGCATGTATGCAGGGGGCAGGG + Intronic
1133908025 16:10039310-10039332 GTGCATTCGTAGCGGGGGCAGGG + Intronic
1134787301 16:16956308-16956330 TTCCATGCATGGTGGGGGCATGG - Intergenic
1135022751 16:18976635-18976657 CGGAATGCCTAGAGAGGGCATGG + Intergenic
1135960781 16:26993037-26993059 CAGCAGTCATCGAGGGGGCAGGG + Intergenic
1137723451 16:50641346-50641368 CTGGAGGCTTAGAGTGGGCAGGG - Intergenic
1137845215 16:51680962-51680984 CTGCATGTATTGAGTGGCCATGG + Intergenic
1138419923 16:56892552-56892574 CTGCATGGCTAGAGGGGCCTTGG - Intronic
1138431550 16:56972271-56972293 GTGCCTGCAGAGAGGGGTCAGGG - Intronic
1138918681 16:61500129-61500151 CTGCATGAAAAAAGGGGGCTGGG + Intergenic
1140380643 16:74484079-74484101 CATCAAGCAAAGAGGGGGCAGGG - Intronic
1141202474 16:81908508-81908530 CTGCATGGAGACGGGGGGCAAGG + Exonic
1142941009 17:3379783-3379805 CATCCTGCATAGAAGGGGCAGGG + Intergenic
1143282298 17:5764021-5764043 CAGCAGGCATGGAGGGGGCCTGG - Intergenic
1144520969 17:15951962-15951984 CTGCATGCCTGGAGGTGGCCTGG + Intronic
1144891930 17:18499300-18499322 CTGCAAACATAGAGGTGGCCCGG + Intergenic
1145140292 17:20445017-20445039 CTGCAAACATAGAGGTGGCCCGG - Intergenic
1145996189 17:29106319-29106341 CTGAATTCATGGAGGGGGCTCGG - Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1151502447 17:74500009-74500031 CTGCTTGCATAGGGAGGTCATGG + Intergenic
1152716804 17:81904147-81904169 CTGGGTGCATGGTGGGGGCAGGG + Intronic
1155475582 18:26233602-26233624 CTGCATGCATAAAGGGGCTTGGG + Intronic
1157121269 18:44913464-44913486 AGACATGCATAGAGGGTGCAGGG + Intronic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1161901953 19:7125696-7125718 CTGCACCCATGGAGAGGGCATGG + Intronic
1165804631 19:38572912-38572934 GTGCATAGATAGAGGGGTCAGGG - Intronic
1165953759 19:39489214-39489236 CTGCATCCAGAGAGGGGTCATGG + Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
925231590 2:2237724-2237746 CTGCCTCCAAAGAGGGGGCCAGG + Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
927203874 2:20594839-20594861 CTTCATGGATGGAAGGGGCAAGG + Intronic
927532162 2:23816581-23816603 ATACATGCATAGAGAGGACATGG + Intronic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930258873 2:49122318-49122340 CCTAATGCATAGAGGGGGGATGG + Intronic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
936052622 2:109236290-109236312 CTGCATGCAGTGTCGGGGCAGGG + Intronic
936481961 2:112892536-112892558 ATGGAGGCATAGAGGAGGCATGG + Intergenic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
942991510 2:182208260-182208282 CTGCATGGCTGGTGGGGGCAGGG + Intronic
946411330 2:219516742-219516764 CTGCAGGCATGGTGGGGGCCAGG - Intronic
947125576 2:226865150-226865172 TTGCATGCATAAAGGAAGCAAGG + Intronic
947205743 2:227659489-227659511 CTGCACGCAGTGAGGAGGCAAGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
947668655 2:231923134-231923156 CAGCATGCACAGAGGGGACCTGG + Intronic
948330436 2:237160426-237160448 CTGCATGCACTCAGGGGGTACGG + Intergenic
948802250 2:240438251-240438273 CTGCAGCCATAGGGGGTGCAGGG - Intronic
948896393 2:240929901-240929923 CTGCGTGCATGGAGGTGGGAGGG - Intronic
1169914739 20:10673875-10673897 CTGCATGGAAAAAGGGGGGAGGG + Exonic
1170844610 20:19951901-19951923 CTGCATGCAAACAGGAGGGAAGG - Intronic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1173090630 20:39967612-39967634 GTGCATGAACACAGGGGGCATGG - Intergenic
1173503715 20:43571272-43571294 ATGCATGTACATAGGGGGCAGGG + Intronic
1174036820 20:47673639-47673661 CTGCATGCATTGAAGGGGATGGG - Intronic
1174390416 20:50215478-50215500 TTGCATGCATGTAGGGGACATGG + Intergenic
1175440796 20:58989827-58989849 TTGCAGGGAGAGAGGGGGCAGGG - Intronic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177745168 21:25203877-25203899 GTGCATGCATAGAGATGGAAGGG + Intergenic
1178339563 21:31774504-31774526 CTTCATGCAGTGAGGTGGCAAGG + Intergenic
1179486670 21:41715004-41715026 GTGCATACAAAGCGGGGGCAGGG - Intergenic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1181027561 22:20134625-20134647 CTGAGTGCAGAGAGGGGGCTGGG - Intronic
1182000211 22:26913840-26913862 CTGGCTGCATATAGGGGCCATGG - Intergenic
1182860034 22:33551727-33551749 GTGGATGCGTAGAGGGGACAGGG - Intronic
1183213467 22:36465033-36465055 TTGCCTGCAGAGAGGCGGCAGGG - Intergenic
1183382774 22:37498689-37498711 CTGGCTGCATCGAGGTGGCATGG + Intronic
1183492648 22:38124824-38124846 CAGCAAGCCTAGAGGTGGCAGGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
950431532 3:12953851-12953873 CTACCTGCACAGTGGGGGCAAGG + Intronic
951510027 3:23489920-23489942 CAGCATGCATATGGGGGGAAGGG - Intronic
951647932 3:24914361-24914383 CTGCAGGAATATTGGGGGCAGGG + Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
952943245 3:38459147-38459169 CTGCATCCAGAGTGGGGGGATGG - Intronic
953837197 3:46357034-46357056 CAGCATGCCTAGTGAGGGCATGG - Intronic
953928641 3:46995190-46995212 CTGCCTGCACACAGGTGGCACGG - Exonic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
958933586 3:100233583-100233605 CTGCATGAAGAAAGGGGCCAGGG + Intergenic
960610981 3:119554532-119554554 CTGCAGGCCTAGAGGGGGAGAGG + Intronic
964555817 3:157936723-157936745 CTACATGTATAGTGAGGGCAAGG + Intergenic
964741889 3:159975140-159975162 GTGCATGACTAGAGAGGGCATGG + Intergenic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
967746952 3:193067386-193067408 CTTCCTGCATAGAGGTGTCATGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968982431 4:3857493-3857515 CTGTATGCATGCAGGGTGCAGGG + Intergenic
969352625 4:6606494-6606516 GGGCATGTACAGAGGGGGCATGG - Intronic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
976780172 4:88749953-88749975 CTGCTTGCCTAGAGGGGCCCTGG + Intronic
977401733 4:96541236-96541258 TTGCATGCCTAGAGAGGGCATGG + Intergenic
981455858 4:144952491-144952513 GGGCATGCATAGAGGGGCCAAGG - Intergenic
982090367 4:151875259-151875281 CTGCATGAACAGGGGAGGCATGG + Intergenic
984067750 4:175070100-175070122 ATGCAAGCAGAGATGGGGCAAGG + Intergenic
984189001 4:176582278-176582300 GTGACTGGATAGAGGGGGCAGGG + Intergenic
993450636 5:88069283-88069305 CTGCATCCCTGGTGGGGGCAGGG - Intergenic
994083390 5:95731836-95731858 CTGCACGGACAGAGGGGGCGAGG - Intronic
997264790 5:132489241-132489263 CTGCATGCAGGGAGTGTGCACGG - Intronic
999331308 5:150675200-150675222 CTGCATGCCTGTAGGGGGAATGG + Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1011741622 6:90366498-90366520 CTGGGTGCATAGAGGGGCGAAGG - Intergenic
1013054297 6:106568335-106568357 CTGCATGCCTCAAGGAGGCAAGG - Intronic
1015544393 6:134346819-134346841 CTGCATGCACTGAGTGGCCAGGG + Intergenic
1015714740 6:136180891-136180913 CTGCATGCAGGGAGGTTGCATGG - Intronic
1017046884 6:150355479-150355501 CTGCTTACATAGAGATGGCAGGG - Intergenic
1017743796 6:157429063-157429085 CTGCATGGATGGTGGGGGCGTGG + Intronic
1019704947 7:2493160-2493182 CTGGATGGACAGTGGGGGCATGG + Intergenic
1020395979 7:7718325-7718347 CTGTATGCATAGTGAGGGCATGG + Intronic
1021589081 7:22241388-22241410 CTAAATAAATAGAGGGGGCAGGG + Intronic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1023362460 7:39430780-39430802 CTGGATGCATCTACGGGGCAGGG - Intronic
1025118412 7:56278392-56278414 CTGTATGTCTAGAGTGGGCAGGG + Intergenic
1025638460 7:63346082-63346104 CTACATGCATAGAGGGATGAGGG + Intergenic
1025644236 7:63402007-63402029 CTACATGCATAGAGGGATGAGGG - Intergenic
1025713832 7:63935070-63935092 CTACATGCATAGAGGGATGAGGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1026742800 7:72989785-72989807 CTGCCTGCTTAGGGGGTGCATGG - Intergenic
1026802652 7:73410175-73410197 CTGCCTGCTTAGGGGGTGCATGG - Intergenic
1027028913 7:74874490-74874512 CTGCCTGCTTAGGGGGTGCATGG - Intergenic
1027100935 7:75375293-75375315 CTGCCTGCTTAGGGGGTGCATGG + Intergenic
1027400364 7:77799482-77799504 CCGCCTGCTCAGAGGGGGCAGGG - Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029316104 7:99715951-99715973 CTGCACGCATAGAGGAAGGATGG - Intronic
1029321765 7:99768547-99768569 TTGCATGCATAGAGGAAGGATGG - Intronic
1029665114 7:101990056-101990078 CTGCATGCAAATAAGAGGCATGG + Intronic
1033806143 7:144956105-144956127 CTGCATAGATGGAGGGGACAGGG - Intergenic
1036649356 8:10632510-10632532 CTGCAGGCATGCAGGGGGAAAGG - Intronic
1039700017 8:39952615-39952637 CTACGTGTGTAGAGGGGGCATGG + Intronic
1039955148 8:42201693-42201715 CTGCATGCATGGTGTGGGAAAGG - Intronic
1041958383 8:63582779-63582801 CAGAATGCATAGTGGGGGAAGGG + Intergenic
1043569804 8:81589755-81589777 CTGCCTGCACAGAGGGGAAAAGG - Intergenic
1047193516 8:122700336-122700358 CTGCAGGGATAGAGAAGGCAGGG + Intergenic
1047309253 8:123677851-123677873 CTGCCTGCAGAGAGAGGGAATGG - Intergenic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049692067 8:143965845-143965867 CTGCATGGTCACAGGGGGCATGG - Intronic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1059481366 9:114593158-114593180 CAGAAAGCATAGAGGAGGCAGGG + Intronic
1059768968 9:117409989-117410011 CTGCATGCGTAGAGCTGGCGGGG - Intronic
1060683499 9:125586528-125586550 TTGCATGCCTTGAGGGTGCAGGG - Intronic
1061232411 9:129322377-129322399 ATGCAACCTTAGAGGGGGCAGGG + Intergenic
1061751530 9:132780927-132780949 CTGCAAGGAGGGAGGGGGCAGGG - Intronic
1062258445 9:135643296-135643318 CTACATGCATAGAAGGGTTATGG - Intergenic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1190499200 X:51058373-51058395 CTGCATGCTCAGAGGGCCCAAGG + Intergenic
1190506737 X:51134074-51134096 CTGCATGCTCAGAGGGTCCAGGG - Intergenic
1190566381 X:51734099-51734121 CCACCTGCATAGAAGGGGCAAGG + Intergenic
1190620860 X:52285280-52285302 CTGCAGCCATACAGGGGGCAGGG + Intergenic
1190984883 X:55491215-55491237 CTGCCTGCATAAAGGGTGCAGGG - Intergenic
1191902422 X:66054302-66054324 GTGCCCGCATAGAGGGGGGATGG + Intergenic
1192496197 X:71617960-71617982 CTGCATGCATTTGGGGGGCGTGG - Intronic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1195859265 X:109363798-109363820 CGGCATGCAGAGAGGGAACAAGG - Intergenic
1201772230 Y:17625964-17625986 TGGCATGTATAGAGGGGGCCTGG - Intergenic
1201829325 Y:18280022-18280044 TGGCATGTATAGAGGGGGCCTGG + Intergenic