ID: 1008888995

View in Genome Browser
Species Human (GRCh38)
Location 6:56463620-56463642
Sequence GACACAGAAGTGGATCTGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008888991_1008888995 -6 Left 1008888991 6:56463603-56463625 CCTGCGCAGCCTGACTGGACACA 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1008888995 6:56463620-56463642 GACACAGAAGTGGATCTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 242
1008888990_1008888995 -3 Left 1008888990 6:56463600-56463622 CCGCCTGCGCAGCCTGACTGGAC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1008888995 6:56463620-56463642 GACACAGAAGTGGATCTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 242
1008888988_1008888995 9 Left 1008888988 6:56463588-56463610 CCTGTGGGGAGGCCGCCTGCGCA 0: 1
1: 0
2: 4
3: 11
4: 117
Right 1008888995 6:56463620-56463642 GACACAGAAGTGGATCTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008888995 Original CRISPR GACACAGAAGTGGATCTGTT GGG Exonic
900415745 1:2533802-2533824 GACCTAGAAGTGGAGCTGCTGGG - Intergenic
901512639 1:9725070-9725092 GACCCAGCAGTGGAGCTGGTGGG + Intronic
902827578 1:18987578-18987600 AACACAGAAGTTAATCTGTGTGG + Intergenic
904320729 1:29696479-29696501 GACAAAGAAGGGGATCAGTAGGG - Intergenic
905360356 1:37415128-37415150 GAAATAGGAGTGGATCTCTTGGG - Intergenic
906027793 1:42689210-42689232 GAAACAGAAGTGAGTCTGTTGGG + Intronic
908046494 1:60175546-60175568 CACACATAAGTGGAAATGTTGGG - Intergenic
909049811 1:70753753-70753775 GACACAGAAGTTGATCTGAAGGG - Intergenic
910244655 1:85125395-85125417 GTTTCAGAAGTGGAACTGTTAGG - Intronic
913588320 1:120298215-120298237 TACCCAGTAGTGGAACTGTTAGG + Intergenic
913619865 1:120600154-120600176 TACCCAGTAGTGGAACTGTTAGG - Intergenic
914319265 1:146543975-146543997 GACACAGATGTGGACTTGTGTGG - Intergenic
914570335 1:148910088-148910110 TACCCAGTAGTGGAACTGTTAGG + Intronic
914602493 1:149220181-149220203 TACCCAGTAGTGGAACTGTTAGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917728925 1:177854885-177854907 TACACAGAATTGGCACTGTTGGG - Intergenic
917954543 1:180080523-180080545 GACACAGATGTGCAGCTTTTGGG - Exonic
918609344 1:186469486-186469508 TACTCAGAAGTGGAATTGTTAGG - Intergenic
919886998 1:201941943-201941965 GACACACAAGTTGACCGGTTGGG + Intronic
920657346 1:207886810-207886832 GAGACAGAAAAGCATCTGTTGGG + Exonic
923351625 1:233112980-233113002 GACAAGAAAGTGGATGTGTTAGG + Intronic
923905630 1:238380882-238380904 AACACATCACTGGATCTGTTAGG - Intergenic
1063171604 10:3514763-3514785 GACACATGAGAGGATGTGTTGGG + Intergenic
1065568978 10:27048451-27048473 GTCCCAGAAGTGAAGCTGTTAGG + Intronic
1066008873 10:31173966-31173988 GACACAGAAGTGTTTAGGTTGGG - Intergenic
1067152833 10:43750783-43750805 TACCCAGAAGTGGAATTGTTGGG + Intergenic
1068032453 10:51720310-51720332 GACTCAGAATTGGAACTTTTAGG - Intronic
1068952374 10:62790277-62790299 GACACTGAAGGAGAACTGTTAGG + Intergenic
1069276388 10:66596074-66596096 GAGACAGAAGTGGGTCTCCTTGG - Intronic
1069528545 10:69196571-69196593 TACATGGAAGTGGATCTGCTCGG + Intronic
1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG + Intergenic
1071833245 10:89393032-89393054 CAGACAGAAGTGAATCTGATGGG - Intronic
1072590866 10:96827418-96827440 GAAACAGAGGTGGCTGTGTTGGG + Intergenic
1075200332 10:120397258-120397280 CACATAGCAGTGGATCTGCTGGG - Intergenic
1077757619 11:5051198-5051220 TACATAGAAGTGGAATTGTTAGG + Intergenic
1080852995 11:36087558-36087580 GTTAAAGAAGTGGTTCTGTTTGG + Intronic
1081723771 11:45310626-45310648 GACACATAAGGGCATATGTTTGG - Intergenic
1081891440 11:46545663-46545685 GTCCCAGAAGTGGATCTCATTGG + Exonic
1083762442 11:64826090-64826112 GCCACAGAAGGGGAGCTCTTGGG - Intronic
1084968672 11:72757671-72757693 GATCCAGAAGGGCATCTGTTAGG - Intronic
1085166957 11:74411050-74411072 GAAACAGAAGTGGAGCTGAAAGG - Intergenic
1088719553 11:112579887-112579909 GACACAGCAGTGACTGTGTTTGG + Intergenic
1091493700 12:953888-953910 CACACAGCAGTGGAACCGTTGGG + Intronic
1093197767 12:16149004-16149026 GACACAGCAGTGGAAATGTGTGG + Intergenic
1093247799 12:16761809-16761831 GTCACAGGAGTGGATCCCTTAGG + Intergenic
1094080647 12:26531115-26531137 GACACAGAAATGGACTTGCTTGG - Intronic
1094633793 12:32204046-32204068 TACACAGAAGTGGAAATGTGAGG + Intronic
1095118527 12:38385235-38385257 GAAACGGAATTGGAACTGTTCGG - Intergenic
1098678462 12:73321039-73321061 GACACAGAAGTTGAGCTGAAGGG + Intergenic
1099085883 12:78245341-78245363 GACACAGCAGAGGAGCTATTAGG - Intergenic
1100159440 12:91841305-91841327 GACACAGAAGCAGATCTTATGGG + Intergenic
1101755520 12:107618101-107618123 GAGATGGAAGTGGATCTGCTGGG - Intronic
1101858416 12:108463115-108463137 GACAAAGAAGTGCATGTGGTAGG - Intergenic
1103665397 12:122560341-122560363 TACCCAGAAGTGGAAATGTTGGG + Intronic
1109098306 13:58145376-58145398 GACAGAGTAGGGAATCTGTTTGG - Intergenic
1113174967 13:107553745-107553767 GAGACAGAAGAGGCTCTGTTTGG - Intronic
1114339508 14:21728341-21728363 GACTAAGAAGTAGTTCTGTTTGG - Intergenic
1115392223 14:32866396-32866418 CACACAGAAGTGGGACTGCTGGG + Intergenic
1115470873 14:33767176-33767198 GAGACAGAAGCAGATCTGCTAGG + Intronic
1116143372 14:41030815-41030837 GACATAGATGTGGCTCTTTTGGG + Intergenic
1116756275 14:48952600-48952622 GACACAGAAGTGACTCCTTTAGG - Intergenic
1116822457 14:49638715-49638737 GAAATAGAAGTGGATATATTTGG - Intergenic
1118818629 14:69330066-69330088 GACCCAGCAGTGGAGCTGCTAGG + Intronic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1119483628 14:74974841-74974863 GGGACAGAAGTGAATCTGGTTGG - Intergenic
1120749513 14:88185115-88185137 CACACAGAAGGGGACCTGATTGG - Exonic
1121025378 14:90611867-90611889 GAGACAGACGTGGTTCTTTTTGG - Intronic
1121294609 14:92808332-92808354 GACATAGAAATAGAGCTGTTTGG + Intronic
1125425718 15:39547400-39547422 GACACAGAAGTGGGATTGGTGGG - Intergenic
1128117475 15:65119594-65119616 GACACAGAATTGCATCTGGAAGG + Intronic
1131579127 15:93624267-93624289 GAGACAGAAGTGTATGTATTAGG - Intergenic
1136023864 16:27457374-27457396 GCCACAGAAGTGCATCTGCCTGG + Intergenic
1136450624 16:30352552-30352574 GCCCCAGAAGTGGATGTTTTAGG - Exonic
1137504279 16:49038274-49038296 TACACAGAAGTGGAACTGCTGGG + Intergenic
1139155656 16:64438497-64438519 TACATAGGAGTGGAACTGTTGGG - Intergenic
1139373453 16:66482056-66482078 GCCACAGAAGGGGATTTGTAGGG + Intronic
1140014259 16:71166109-71166131 GACACAGATGTGGACTTGTGTGG + Intronic
1141622361 16:85243143-85243165 GACACACAAATGTATCAGTTTGG + Intergenic
1142491527 17:283004-283026 GAGGCAGAGGTGGATGTGTTGGG + Intronic
1143112016 17:4558247-4558269 GACACAGAGGCTGATGTGTTGGG - Exonic
1143954026 17:10655033-10655055 GACACTGAAATGGAAGTGTTCGG - Exonic
1148228597 17:45916883-45916905 GGCACAGAAGGGGATCTGCAGGG - Intronic
1149669572 17:58394061-58394083 GAAACAGAATTGGATGTGGTTGG + Intronic
1150270703 17:63862641-63862663 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1150274332 17:63886162-63886184 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1150276476 17:63900990-63901012 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1152521725 17:80860377-80860399 GACACAGCAGTGGCTTTGTGTGG - Intronic
1152962111 18:86249-86271 CACACAGAAGTGCATCTGGCAGG - Intergenic
1153109037 18:1561584-1561606 TACTCAGAAGTGGGTCTTTTGGG + Intergenic
1154445510 18:14432297-14432319 AACTCAGAGGTGAATCTGTTAGG - Intergenic
1154451592 18:14480960-14480982 CACACAGAAGTGGAATTGCTGGG - Intergenic
1156524752 18:37756379-37756401 GACCTAGTAGTGGCTCTGTTAGG + Intergenic
1158000075 18:52608123-52608145 GACACAGAAGTTGAGAGGTTAGG - Intronic
1158645842 18:59246335-59246357 GAAGCAGAAGGGGATGTGTTTGG - Intergenic
1161743883 19:6042927-6042949 GCCACAGAAGTGGGCTTGTTCGG + Intronic
1163351584 19:16779532-16779554 TACAGAGAAGTGAATCTGTGGGG - Intronic
1165007290 19:32817617-32817639 TACTCAGAAGTGGAGCTGCTGGG + Intronic
1167103384 19:47417437-47417459 GACACAGAAGGGCATCTCCTGGG - Intronic
925848852 2:8060474-8060496 GACAAAGAAGTGGATAGCTTGGG - Intergenic
926106223 2:10153511-10153533 GACACAGCAGAGGAGCTGGTGGG - Intronic
926671810 2:15583682-15583704 AACACATAAGGGGGTCTGTTAGG + Intergenic
927479110 2:23436549-23436571 GTCACAGGTGTGGATCTGCTGGG + Intronic
928869560 2:35960788-35960810 GATACAGCAGGGGATCTGTATGG + Intergenic
929253494 2:39783432-39783454 GAGGCAGAAGTGGAACTGCTGGG + Intergenic
929324121 2:40585479-40585501 TACATAGATGTGGAACTGTTGGG + Intronic
930729733 2:54716519-54716541 TACCTAGAAGTGGAACTGTTGGG + Intergenic
936602017 2:113906009-113906031 TACCCAGAAGTGGAATTGTTGGG + Intronic
937126145 2:119476214-119476236 GACCCAGAAGTAGATCTATGGGG + Intronic
938187151 2:129241632-129241654 GACACAGAATTGAATATTTTTGG + Intergenic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
941019047 2:160388693-160388715 GACACAAAAGAGGATCTGAAGGG - Intronic
944319649 2:198323833-198323855 TAAACAGAAGTGCATGTGTTCGG - Intronic
944442076 2:199752945-199752967 GACACAGCAGTGTATCTAATTGG + Intergenic
944681487 2:202081361-202081383 TACCCAGAAGTGGAATTGTTTGG + Intronic
945761756 2:213923264-213923286 CCCACAGAAGTGGAACTGCTGGG + Intronic
946516021 2:220412384-220412406 CACACAGAAGTGGGGCTGCTGGG + Intergenic
946748964 2:222873868-222873890 TTCACAGAAGTGGAATTGTTTGG + Intronic
1168768247 20:396664-396686 GACAGAGAAGTGGTTCTGTATGG + Exonic
1170379807 20:15745249-15745271 TACACAGAACTGGAATTGTTAGG + Intronic
1171012599 20:21516717-21516739 GACCCAGAATAGGATCTGGTTGG + Intergenic
1171376624 20:24698417-24698439 CACACAGAAGTGAATCTTTCTGG - Intergenic
1173642097 20:44610432-44610454 GACAGAGAAGAGGATCAGTATGG - Intronic
1174382121 20:50162640-50162662 GACATAGAGGTGCATTTGTTTGG + Intergenic
1174944612 20:54971271-54971293 GACACACAACTCGATCTGGTTGG - Intergenic
1176444553 21:6809262-6809284 CACACAGAAGTGGAATTGCTGGG + Intergenic
1176450471 21:6857559-6857581 AACTCAGAGGTGAATCTGTTAGG + Intergenic
1176822719 21:13674300-13674322 CACACAGAAGTGGAATTGCTGGG + Intergenic
1176828640 21:13722577-13722599 AACTCAGAGGTGAATCTGTTAGG + Intergenic
1182938483 22:34250145-34250167 CACACAGAAGTGGAGTTGCTTGG + Intergenic
1182964381 22:34507486-34507508 TACACAGAAGTGGATGAGTTGGG - Intergenic
1183107549 22:35625589-35625611 GACATAGAAGTTGGTGTGTTAGG + Intronic
1184360840 22:44017702-44017724 GACACAGAGATGCATCTGTGGGG - Intronic
1185014985 22:48337487-48337509 GACAAAGCAGTTGATCTGTTTGG + Intergenic
949777770 3:7651668-7651690 GACAGAGAAGAGGACCTCTTTGG - Intronic
950035407 3:9881587-9881609 CACACAGAAGTGGAACTGCTGGG - Intergenic
950466494 3:13158437-13158459 GACAGAAAACTGGATTTGTTTGG + Intergenic
950599432 3:14018858-14018880 GACGCAGAAGTGGGGCTGTTTGG + Intronic
950842388 3:15979925-15979947 CACCCAGAAGTGGAACTGCTGGG - Intergenic
952023009 3:29045517-29045539 GAGACAGAAGTAGATATATTTGG + Intergenic
952564374 3:34637227-34637249 GACATAGAAGTAGATGTGTGAGG - Intergenic
954912106 3:54119406-54119428 GACACAGAAGTGAATGTTTTAGG - Intergenic
955033332 3:55241797-55241819 GAAAAAGAAGTGGTTGTGTTAGG + Intergenic
955865301 3:63375862-63375884 GACACTCAAGTGGACATGTTTGG - Intronic
956241137 3:67131856-67131878 AACACAGAAGAAGGTCTGTTAGG - Intergenic
958048721 3:88318420-88318442 GACACACGAGTGGCTCTGGTAGG + Intergenic
958657502 3:97021194-97021216 GGCACAAATGTGGAACTGTTAGG - Intronic
960640839 3:119821147-119821169 GGCACTGAAGTGCATTTGTTTGG - Intergenic
961516203 3:127438871-127438893 CACACACAAATGGATCTGTAGGG + Intergenic
962085842 3:132190747-132190769 GACACAGCAGTGGCTATGTCTGG - Intronic
962473233 3:135732052-135732074 CACACAAAAGTGGACCTATTGGG + Intergenic
962705859 3:138043873-138043895 CACACAGAATTGGATCTGGGTGG - Intergenic
963151124 3:142046456-142046478 GTGGCAGAAGTGGATTTGTTGGG - Intronic
964624024 3:158741672-158741694 GACACTGACATGGATGTGTTTGG + Intronic
970762188 4:19503421-19503443 GACACAGTGGTGAACCTGTTAGG - Intergenic
970861223 4:20705007-20705029 GACATAGAAGTTAACCTGTTTGG + Intronic
970885668 4:20984999-20985021 GGCACAGAACAGGGTCTGTTTGG - Intronic
970921826 4:21403594-21403616 GACACGGAAGTCGTTCTATTAGG - Intronic
971238405 4:24864788-24864810 CACACATAAGTGGATCTGTGTGG - Intronic
971898752 4:32631241-32631263 GACACAGAAGTGTAGCTATCAGG - Intergenic
975833650 4:78397766-78397788 GAGACAGAAATGGATCTCTTAGG + Intronic
976294219 4:83453917-83453939 GACAGTGAAGTGGACATGTTTGG - Exonic
977371514 4:96143037-96143059 GACACAGAAGTGGAAATGGGTGG + Intergenic
978057506 4:104290625-104290647 TAAAGAGAAGTGGATGTGTTTGG - Intergenic
978684073 4:111417277-111417299 GGCTCAAAAGTGGATCTTTTAGG + Intergenic
978871212 4:113580608-113580630 GACTCAGAAGTAGGTCTGTTTGG + Intronic
980539691 4:134177472-134177494 CACACAGAAGTGGGACTGCTGGG - Intergenic
980701627 4:136439526-136439548 GACACAGATGTACATATGTTAGG + Intergenic
981691719 4:147516096-147516118 GACACAGAAGGCAATCTGCTGGG - Intronic
982196881 4:152925308-152925330 CAGACAGAAGTAGATCTTTTAGG + Intergenic
984848092 4:184125057-184125079 GAAACAGGAGTGGATCTGGTAGG + Intronic
986897220 5:12385052-12385074 CACACAGAAGTGGGACTGCTGGG + Intergenic
987583467 5:19824704-19824726 CACACAGAAGTGGGACTGCTGGG - Intronic
989768040 5:45109477-45109499 TACACAGAAGTGGAATAGTTAGG + Intergenic
990142913 5:52726101-52726123 CACACAGAAGTGGAACTTTCTGG - Intergenic
990155881 5:52876935-52876957 GACAAAGAAGTGCATTTGGTAGG + Intronic
990279169 5:54231370-54231392 GACAGAGAAGTGGATGTTATAGG - Intronic
991170785 5:63622925-63622947 TACCCAGAAGTGGAACTGTTGGG + Intergenic
992314326 5:75536816-75536838 CACACAGATGTGGAGCTGCTGGG + Intronic
992684016 5:79181711-79181733 GAGAGAGAAGCAGATCTGTTAGG + Intronic
993395292 5:87379261-87379283 GACACAGAAGTGCAGCAGGTAGG + Intronic
993646846 5:90473705-90473727 GAAACAGAAGTGGCTCTGCGAGG + Intronic
997125473 5:131222753-131222775 GACACAGAAGAGGATGTGAGTGG + Intergenic
998259939 5:140622448-140622470 TACACAGGAGTGGAGGTGTTAGG + Intergenic
1000968617 5:167689415-167689437 CACACAGTAGTGGATCTGAAGGG + Intronic
1002173769 5:177390027-177390049 CACACAGCAGTGGATGTGCTTGG + Intronic
1003399256 6:5778538-5778560 GACAGAGAAGTGGGTCTGAAAGG + Intergenic
1003966002 6:11252862-11252884 GACACAGAAATGGAAGTGATAGG + Intronic
1004077998 6:12362935-12362957 AGAACAGAAGTGGATATGTTAGG + Intergenic
1005385592 6:25281187-25281209 GAGAGAGAAGAGGATCTGCTGGG - Intronic
1006531368 6:34657763-34657785 GACACTGAATTGGAGCTGTTTGG - Intronic
1007126348 6:39429000-39429022 GACCCAGAAGAGGAACTGCTGGG + Intronic
1007942882 6:45798727-45798749 GACACAGAAGTGGGTCGGGAAGG - Intergenic
1007969900 6:46040922-46040944 GACACAGAAGTTAAGCTCTTGGG + Intronic
1008789934 6:55217938-55217960 TATACAGAAGGGGATTTGTTAGG + Intronic
1008888995 6:56463620-56463642 GACACAGAAGTGGATCTGTTGGG + Exonic
1009798487 6:68502728-68502750 GAAACAGAATTGGTGCTGTTAGG + Intergenic
1009848642 6:69166594-69166616 CACACAGAATTGGAGCTGTGGGG + Intronic
1011624149 6:89269962-89269984 CACCCAGAAGAGGATCTTTTGGG - Intronic
1012984834 6:105864756-105864778 GAAATAGAAGTGGAATTGTTAGG + Intergenic
1014366061 6:120543615-120543637 TTAACAGAAGTGGATCTTTTGGG + Intergenic
1014537335 6:122630157-122630179 TACACAGAAGTGGAATTGCTAGG - Intronic
1014698616 6:124655635-124655657 GACACAGAAGTGGTTCAGATAGG - Intronic
1015067340 6:129046834-129046856 GAAATAGAAGTTTATCTGTTAGG - Intronic
1020369040 7:7413064-7413086 GTCTCAGAGGTTGATCTGTTAGG + Intronic
1020712894 7:11631033-11631055 ATCACAGAAGTGTAGCTGTTGGG - Intronic
1021105714 7:16637472-16637494 GATAGAGAAGTAGCTCTGTTGGG + Intronic
1021610714 7:22455250-22455272 CACACAGAAGAGGAACTGCTGGG + Intronic
1022897498 7:34766331-34766353 TACTCAGAAGTGGAATTGTTGGG - Intronic
1023075998 7:36483236-36483258 TGCACAGAAGTGGGACTGTTGGG + Intergenic
1023385368 7:39651436-39651458 GACACTCAAGTGGATCAGTGTGG - Intronic
1023895717 7:44431363-44431385 AACACAGAACAGGCTCTGTTGGG + Intronic
1026229251 7:68469065-68469087 GAGAGAGAAGTGGTTTTGTTTGG + Intergenic
1027187377 7:75980453-75980475 GAGACAGACGTGGATCTCTCTGG + Exonic
1028454643 7:91025633-91025655 AAGACACAAGTGGCTCTGTTTGG + Intronic
1028956137 7:96693746-96693768 CACACACAAGTGGAATTGTTGGG - Intronic
1028988467 7:97025641-97025663 TAAACAGAAGTGGAGCTGTTTGG - Intergenic
1029439797 7:100581172-100581194 GGCACAGAAGGGGAGCTGGTGGG - Intronic
1029807186 7:103009969-103009991 CACACAGAAGTGGGGCTGCTGGG - Intronic
1031010609 7:116522946-116522968 GAAACTGAAGTGGATCACTTGGG + Intergenic
1032115469 7:129113138-129113160 TACACAGGAGTGGAACTGCTGGG + Intergenic
1032122957 7:129169813-129169835 GACCCAGAAGTCGATGTCTTGGG + Intergenic
1033217849 7:139506554-139506576 GGCACAGAAGTGTATGTGCTAGG + Intergenic
1034464424 7:151218130-151218152 GACACACGAGTGGCTCTGGTAGG - Exonic
1034943011 7:155244204-155244226 GACCCAGAAGTGGAACTGAGGGG - Intergenic
1035920268 8:3668700-3668722 GACACAGAGATGGATGAGTTGGG + Intronic
1039625763 8:39050735-39050757 GAGAAAGAAGTGAATTTGTTGGG + Intronic
1040397861 8:47016596-47016618 GAGACAGAAGTGGGCCTCTTGGG + Intergenic
1041661718 8:60407462-60407484 TACACAGCAGTGGATTTCTTGGG + Intergenic
1042384231 8:68154083-68154105 GGCACAGCAGTGGAACTGTGAGG - Intronic
1043150130 8:76705100-76705122 TAAACAGAAGTGGATTTTTTTGG - Exonic
1044592914 8:93931287-93931309 AACACAGACGTGAATTTGTTTGG - Intergenic
1045231896 8:100313797-100313819 GAGACAGAAGTGGATGGTTTTGG + Intronic
1047414515 8:124653054-124653076 GCCACGGAAGTGAATATGTTTGG - Intronic
1047805765 8:128357604-128357626 TTCCCAGAAGTGGAACTGTTGGG - Intergenic
1049806292 8:144542149-144542171 TACACAGAAGTGGAGCAGGTGGG + Intronic
1050970300 9:11862634-11862656 GACACAGAAGTGAAATTGATAGG - Intergenic
1051891281 9:21945171-21945193 GACACAGAAGTGGGACTACTGGG - Intronic
1052957099 9:34261626-34261648 GAAACAGCATTGGATCTATTTGG - Intronic
1057811886 9:98263828-98263850 TAACCAGAAGTGCATCTGTTAGG - Intergenic
1058797203 9:108510448-108510470 GACACCGAAGAGGATTTCTTAGG - Intergenic
1060214753 9:121731996-121732018 GACACAGAAATGGCTCTGGTGGG + Intronic
1061514253 9:131079392-131079414 GAGACAGAAGTAGCTCTGTCCGG + Intronic
1061746115 9:132741419-132741441 AACACTGAAGTCGCTCTGTTTGG + Intronic
1062736029 9:138137868-138137890 CACACAGAAGTGCATCTGGCAGG + Intergenic
1203518711 Un_GL000213v1:26958-26980 AACTCAGAGGTGAATCTGTTAGG - Intergenic
1203524645 Un_GL000213v1:75265-75287 CACACAGAAGTGGAATTGCTGGG - Intergenic
1186851736 X:13586705-13586727 TACACAGGAGTGGAATTGTTGGG - Intronic
1187399279 X:18945253-18945275 GAAACATAAGTGGATCTTCTCGG + Intronic
1188317317 X:28690478-28690500 GACACAGAACTGGAAATATTTGG + Intronic
1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG + Intergenic
1189390345 X:40570985-40571007 GAGACAGAAGCGGAGCTGGTGGG + Intergenic
1191217914 X:57952266-57952288 CACACAGCAGTGGAGCTGCTTGG + Intergenic
1191762886 X:64663652-64663674 CACACAGAAGTGGGGCTGCTGGG - Intergenic
1193074406 X:77340313-77340335 GATACAGAAGTGTGTGTGTTTGG + Intergenic
1193162327 X:78241507-78241529 CACACAGAAGTGGGGCTATTGGG - Intergenic
1194441460 X:93939581-93939603 GACACAGTATTGGGACTGTTGGG - Intergenic
1195455550 X:105065238-105065260 GACATGGAAATGGTTCTGTTTGG + Intronic
1195822988 X:108967629-108967651 GACAAAGAATTGGCTCTGTTTGG - Intergenic
1196737451 X:118992305-118992327 GAAACAGACTTGGAGCTGTTGGG + Intronic
1198038685 X:132827206-132827228 GACAAAGATGGGGTTCTGTTGGG - Intronic
1199075414 X:143520219-143520241 GACACAGGATAGGATCTGCTTGG + Intergenic
1200281977 X:154784787-154784809 CACACAGAAGTAGATGTGGTGGG - Intronic
1200313767 X:155108442-155108464 TACACAGAAGTGGAATTGCTGGG + Intronic