ID: 1008894773

View in Genome Browser
Species Human (GRCh38)
Location 6:56540357-56540379
Sequence TTCTTGCTGATACGAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008894769_1008894773 10 Left 1008894769 6:56540324-56540346 CCTGGGCCCCTGTTTTTCTGGGT 0: 1
1: 0
2: 1
3: 15
4: 278
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008894771_1008894773 3 Left 1008894771 6:56540331-56540353 CCCTGTTTTTCTGGGTGCTGCTT 0: 1
1: 0
2: 5
3: 28
4: 354
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008894765_1008894773 22 Left 1008894765 6:56540312-56540334 CCAATATTCCTGCCTGGGCCCCT 0: 1
1: 0
2: 0
3: 22
4: 261
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008894770_1008894773 4 Left 1008894770 6:56540330-56540352 CCCCTGTTTTTCTGGGTGCTGCT 0: 1
1: 0
2: 2
3: 27
4: 332
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008894766_1008894773 14 Left 1008894766 6:56540320-56540342 CCTGCCTGGGCCCCTGTTTTTCT 0: 1
1: 0
2: 3
3: 52
4: 532
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1008894772_1008894773 2 Left 1008894772 6:56540332-56540354 CCTGTTTTTCTGGGTGCTGCTTT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008894773 Original CRISPR TTCTTGCTGATACGAATTTC AGG Intronic
904714011 1:32453196-32453218 TTCTTGCTGATGTGGATTCCGGG - Intergenic
920586083 1:207162794-207162816 TTCTTCCTTATACCAATTTTAGG - Intergenic
924047002 1:240042052-240042074 TTCTGGCTGATGACAATTTCTGG - Intronic
1066186605 10:33015561-33015583 TTCTTGCTGACAGAAAATTCTGG + Intergenic
1066670223 10:37829285-37829307 TTCCTGCTGATACAAGTCTCTGG + Exonic
1069389401 10:67917224-67917246 TACTTGGTGCTAAGAATTTCAGG + Exonic
1071324909 10:84503909-84503931 TTCTTTCTCTTACAAATTTCAGG + Intronic
1073673444 10:105618215-105618237 TTCTTGCTATTGTGAATTTCTGG - Intergenic
1077791646 11:5447448-5447470 TTCCTGCTGTTACAAATCTCTGG + Intronic
1079152940 11:17917655-17917677 AGCTTGCTGAAATGAATTTCTGG - Intronic
1079746161 11:24132964-24132986 TTCTTCCTGATTCGATCTTCAGG + Intergenic
1080343196 11:31293344-31293366 TTCTTGCTCTTTCTAATTTCTGG - Intronic
1080514942 11:33011523-33011545 TTTTTGCTGACTCAAATTTCAGG - Intergenic
1081503304 11:43688464-43688486 TTCTTTCTGATACAGATTTGTGG - Intronic
1087002403 11:93434182-93434204 TTCTTGCTGGTCATAATTTCTGG + Intronic
1088056610 11:105588809-105588831 TTATTTATGATACGGATTTCTGG - Intergenic
1088067089 11:105732582-105732604 TTCTTGCTGCTACCACTTTGTGG + Intronic
1089666494 11:120023559-120023581 TTCTGGCTGCTGTGAATTTCAGG + Intergenic
1091382767 12:73138-73160 TTCAGGCTGAAAGGAATTTCAGG + Intronic
1095038643 12:37420066-37420088 TTCTGGCCGAAACGAATGTCAGG - Intergenic
1095184156 12:39181467-39181489 TTGTTCCTGAAAAGAATTTCAGG - Intergenic
1098292134 12:68966589-68966611 TTCTTGCTGATATGACTTCATGG + Intronic
1105282405 13:18975207-18975229 TTCTGGCTGTTACCCATTTCTGG + Intergenic
1105419368 13:20239042-20239064 TTCCTGTTGATACAAATATCTGG + Intergenic
1107202895 13:37743298-37743320 TTCTTGCTAATATGAAGTTATGG - Intronic
1108122974 13:47209536-47209558 TTCTGGCTGGTAGGAATTTGAGG + Intergenic
1109243394 13:59921202-59921224 TTCTTGCTTCTACTAATTTTGGG - Intronic
1109414628 13:62022360-62022382 TTCTGGCTGATTCTTATTTCTGG - Intergenic
1111381079 13:87452951-87452973 TTATTGCTTATATGAAGTTCTGG + Intergenic
1111726488 13:92016443-92016465 TTCTTGCTTATAACAATTACAGG - Intronic
1112946757 13:104937757-104937779 TTCTTGCTAATAAAAATTTGAGG - Intergenic
1117210266 14:53490178-53490200 TTCTTTGTGATACCAATATCTGG - Intergenic
1118669808 14:68111755-68111777 TTCTTGCTGACAGCCATTTCAGG - Intronic
1120227381 14:81806447-81806469 TTCTAGCTGAAATGATTTTCAGG - Intergenic
1123177894 14:106439140-106439162 TTCATGCTAATTCAAATTTCTGG - Intergenic
1125194651 15:37032214-37032236 TACTTGCTCATACCAGTTTCTGG - Intronic
1125378231 15:39057406-39057428 TTCTTGCTGATTTGAGTTTCTGG - Intergenic
1134328060 16:13225207-13225229 TTCTTGCCTCTTCGAATTTCTGG - Intronic
1136001813 16:27300316-27300338 ATCTTGCTGAAATAAATTTCTGG + Intergenic
1145308150 17:21686744-21686766 TTCTGGCTGAAACCAATGTCAGG - Intergenic
1145709750 17:26961221-26961243 TTTTTGTTAATATGAATTTCGGG - Intergenic
1148356046 17:46976701-46976723 TTCTTTCTGAAACCATTTTCTGG + Intronic
1148801042 17:50226016-50226038 TTCTTACTTATGCAAATTTCTGG + Intergenic
1155425583 18:25703283-25703305 TTTTTGCTGATATGTATTTCTGG - Intergenic
1156048991 18:32908980-32909002 TTCTTGATCCTACCAATTTCTGG + Intergenic
1157110852 18:44818932-44818954 TTCTTGGTGATTCTAATTACCGG + Intronic
1161356680 19:3823042-3823064 TTCCTGCTGATACCAAAATCCGG + Intronic
1163107724 19:15135637-15135659 TTCTTGCTGGTACAATTTTGAGG - Intergenic
1202683007 1_KI270712v1_random:27519-27541 TTTTTGTTAATATGAATTTCAGG - Intergenic
926553367 2:14327714-14327736 TTCTGGCTGATTGAAATTTCTGG - Intergenic
927091235 2:19714287-19714309 TTATTGTTGATACAAATATCTGG - Intergenic
929322369 2:40559671-40559693 TTCTTGCCGTTAGGAGTTTCAGG - Intronic
929561057 2:42956837-42956859 TTCTTGCTGCCACGAGGTTCTGG + Intergenic
930361698 2:50388554-50388576 TTCCTGCTGAGAAGCATTTCCGG - Intronic
932000368 2:67879251-67879273 TCCTTGCTGAGATGAATTGCTGG + Intergenic
934102892 2:88669718-88669740 TTCCTGCTGTGAGGAATTTCTGG - Intergenic
934189155 2:89769316-89769338 TTTTTGTTCATATGAATTTCAGG + Intergenic
934248788 2:90327654-90327676 TTTTTGTTAATATGAATTTCAGG + Intergenic
934260791 2:91475828-91475850 TTTTTGTTAATATGAATTTCAGG - Intergenic
935025103 2:99269277-99269299 TTCTGGTGGATATGAATTTCAGG - Intronic
936375655 2:111939171-111939193 TTCTTGCTGATGCGACTCTGCGG + Intronic
941217197 2:162726827-162726849 TACTTTCTGATACGACATTCTGG + Intronic
942970054 2:181947771-181947793 TTCTTGCTGAAACTAATTTGAGG + Intergenic
943181793 2:184553663-184553685 ATCTTTCTGATACCCATTTCTGG + Intergenic
945965800 2:216185159-216185181 TTCTTGCTGTTACCAATCCCGGG + Intronic
1171523847 20:25794792-25794814 TTCTGGCCGAAACGAATGTCAGG - Intronic
1171552980 20:26061091-26061113 TTCTGGCCGAAACGAATGTCAGG + Intergenic
1174554486 20:51383995-51384017 TTCAGGATGATCCGAATTTCAGG - Intergenic
1175548285 20:59795300-59795322 TTCCTCCTGTTACTAATTTCTGG + Intronic
1176282418 20:64321618-64321640 TTCAGGCTGAAAGGAATTTCAGG - Intergenic
1178185650 21:30216842-30216864 TTCTTGCTGCTTTGAATTCCTGG + Intergenic
1178602778 21:34009379-34009401 TTCCTGCTGTTACCAACTTCTGG - Intergenic
1179206821 21:39288992-39289014 TTCTGGCTGTTAGTAATTTCTGG + Intronic
1179313105 21:40214125-40214147 TTCTTGCTCCTAAGGATTTCAGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
951066540 3:18273342-18273364 TTCTTGTTGAGAAGAAATTCTGG + Intronic
952330226 3:32357752-32357774 TTCTGCCTGAAAGGAATTTCTGG - Intronic
954877390 3:53811151-53811173 TTGTTGCTGACACAAATTTTGGG - Exonic
956178459 3:66496356-66496378 GTCTTGCTGATATGAAATTGTGG - Intronic
956930088 3:74033901-74033923 TTCTTGCTGGAAGGAATTTCTGG - Intergenic
957593682 3:82232825-82232847 TTCTTCCTGAGACTATTTTCTGG - Intergenic
958701217 3:97592729-97592751 TTCCTGCTGGTAGGTATTTCAGG + Exonic
958812065 3:98871997-98872019 TTCTTCCTGATTCAAATTTGTGG + Intronic
958864756 3:99486877-99486899 TTCCTGCTGATACGAGATCCAGG + Intergenic
959557869 3:107743333-107743355 TTTTTGTGGCTACGAATTTCAGG + Intronic
962237675 3:133721118-133721140 TTCTTCCTTCTACCAATTTCAGG + Intergenic
964161069 3:153645888-153645910 TTCTTACTGATTTGAGTTTCTGG - Intergenic
965843333 3:172932608-172932630 TTCTTGCTGATGTGAATTTGTGG - Intronic
966025800 3:175279665-175279687 TTCTTCCTGCTTCAAATTTCAGG - Intronic
968882013 4:3305892-3305914 TTCCTGCTGATAGGATTTCCGGG + Intronic
969233283 4:5846919-5846941 TTCTTGCTCAGTAGAATTTCAGG - Intronic
973075648 4:45922436-45922458 GTCTTGCTGATACCCATTTTGGG + Intergenic
976659139 4:87520904-87520926 TTCTAGGAGATACAAATTTCAGG - Intronic
980250503 4:130308905-130308927 ATCTTGCTAATAAGATTTTCAGG + Intergenic
981249943 4:142587795-142587817 TTCTTTCTGATTCTACTTTCTGG - Intronic
984383107 4:179020066-179020088 TTCTTGTTGATACGAAATGTAGG - Intergenic
984487885 4:180395388-180395410 ATCTTGCCCATATGAATTTCTGG + Intergenic
984693208 4:182752496-182752518 TCCTTGCTGAGAGGAATTTTGGG + Intronic
986427349 5:7647383-7647405 TTCTTCCTGAGACAAATTGCAGG + Intronic
988355809 5:30172688-30172710 TTCTGACTGATACCAACTTCAGG + Intergenic
989326565 5:40203254-40203276 TTCTTTCTGATGCCAATATCAGG + Intergenic
990004661 5:50932270-50932292 TTCTTGCTCATAAGAAATGCAGG + Intergenic
990125142 5:52507565-52507587 TTTTTGCTGGTACAGATTTCTGG + Intergenic
990442247 5:55858676-55858698 TTCTTCCTGAAATGAATTACTGG + Intronic
993401758 5:87461960-87461982 TTTTGGGTGATACGAATTTTAGG - Intergenic
994704646 5:103187269-103187291 TTGTAGCTGTTACGAATTTCAGG + Intronic
999189593 5:149737191-149737213 CACTTGCTGATAGGAATTTAAGG + Intronic
999645928 5:153717100-153717122 GTCTTGCTGATCCAAATTACAGG + Intronic
1005558741 6:27015189-27015211 TTCTTGCTGTTAATGATTTCTGG - Intergenic
1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG + Intronic
1018618824 6:165711418-165711440 TTCTAGCTAACATGAATTTCTGG - Intronic
1020886604 7:13825642-13825664 TTCCTGCTGATACTAATCTCTGG + Intergenic
1021216077 7:17916823-17916845 ATCATCCTGATACCAATTTCTGG + Intronic
1022240645 7:28509357-28509379 TTCTTGCAGATCTGAATTCCAGG + Intronic
1022566245 7:31405640-31405662 CTCTTGTTGATACCCATTTCAGG + Intergenic
1024412066 7:49055066-49055088 TTTTTGCTGAAACCAATTTATGG + Intergenic
1025301244 7:57821124-57821146 TTCTGGCCGAAACGAATATCAGG + Intergenic
1026886845 7:73954820-73954842 ATCTTTCTGATAAAAATTTCAGG + Intergenic
1030516449 7:110544395-110544417 TTGTTGCTGTTATCAATTTCTGG - Intergenic
1030969170 7:116033213-116033235 TTCTTTGTGAGAAGAATTTCAGG - Intronic
1041369050 8:57141187-57141209 TGCTAGCTGATGGGAATTTCTGG + Intergenic
1043260997 8:78196294-78196316 TTGTTACTGATACAAATTTTTGG - Intergenic
1044247598 8:89967667-89967689 TTCTTGCTGAGACCTTTTTCCGG - Intronic
1048207217 8:132424736-132424758 TTCTTGCTTCTTCCAATTTCTGG + Intronic
1050959806 9:11714622-11714644 TTTTTTCTGATAGGATTTTCAGG - Intergenic
1053169807 9:35870346-35870368 TTCTTTCTGAAAGGATTTTCTGG - Exonic
1053785054 9:41647309-41647331 TTCTGGCCGAAACGAATGTCAGG - Intergenic
1054173781 9:61861260-61861282 TTCTGGCTGAAACGAATGTAAGG - Intergenic
1054663759 9:67719521-67719543 TTCTGGCTGAAACGAATGTAAGG + Intergenic
1055905984 9:81293338-81293360 TTTTTGATGATACTAATTGCTGG + Intergenic
1056027372 9:82512997-82513019 ATCATGCTGATCGGAATTTCTGG + Intergenic
1056618559 9:88190578-88190600 TTCTTGCTTCTAGGAATGTCTGG + Intergenic
1059007490 9:110418841-110418863 GTTTGGCTGATACGAAATTCTGG - Intronic
1187455794 X:19440199-19440221 TTCCTGCTGATGCTAACTTCAGG + Intronic
1188023814 X:25187373-25187395 TTCTTGCTGTTAATAATCTCTGG + Intergenic
1190591326 X:52005195-52005217 TTTTTCCTGTTACTAATTTCTGG + Intergenic
1193526944 X:82603293-82603315 TTCATCCTGATACCAAATTCTGG + Intergenic
1195794408 X:108628983-108629005 GACTTGATGATAGGAATTTCTGG + Intronic
1201400765 Y:13601722-13601744 TTCTCTCTGTTACAAATTTCTGG - Intergenic