ID: 1008902701

View in Genome Browser
Species Human (GRCh38)
Location 6:56640340-56640362
Sequence CTGGAGTGACAGATGGAGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008902693_1008902701 26 Left 1008902693 6:56640291-56640313 CCTGAACTGAAATTTGGAACTAA 0: 1
1: 0
2: 0
3: 10
4: 245
Right 1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG 0: 1
1: 0
2: 0
3: 30
4: 274
1008902697_1008902701 2 Left 1008902697 6:56640315-56640337 CCTGATGGGAAACCAGGTGTATA 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG 0: 1
1: 0
2: 0
3: 30
4: 274
1008902699_1008902701 -10 Left 1008902699 6:56640327-56640349 CCAGGTGTATAAGCTGGAGTGAC 0: 1
1: 0
2: 1
3: 7
4: 65
Right 1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG 0: 1
1: 0
2: 0
3: 30
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008902701 Original CRISPR CTGGAGTGACAGATGGAGTC AGG Exonic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
902240211 1:15083389-15083411 CTGGAGTGACACAGGCAGCCTGG - Intronic
903023867 1:20413265-20413287 AAGGAGTGACAGATGGTGCCCGG - Intergenic
904602969 1:31683847-31683869 CTGGAGTGGGAAATGGAGGCAGG - Intronic
906349158 1:45042540-45042562 ATGGTGTGAGAGATGGAGGCAGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
908393284 1:63702799-63702821 CTGGAGTGGGAGAGGGAGGCAGG + Intergenic
909464497 1:75958181-75958203 CTAGGGTGACAGATGGAGGCAGG + Intergenic
910555353 1:88525898-88525920 CTTGAGTAAAAGATGGAGTCTGG - Intergenic
910870160 1:91826166-91826188 AGAGAGTGACAGGTGGAGTCAGG + Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911114833 1:94236845-94236867 CTGGAGTGAGGGCTGCAGTCAGG + Intronic
911847766 1:102776229-102776251 CTGCAGTGACTGATGGGCTCTGG - Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
915250479 1:154584779-154584801 CTCCAGTGACAGATGGATTAGGG - Exonic
916239061 1:162621304-162621326 CTGGAGAGACTGATGGGTTCTGG + Intergenic
916758653 1:167797236-167797258 CTGGTGTGTCAGAGGGACTCAGG - Intergenic
917130854 1:171741508-171741530 CTGGTGTGACAGATTGGGTGTGG - Intronic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
918362838 1:183776615-183776637 CAGGAGTGAGGGATGGAGGCGGG + Intronic
920872709 1:209807185-209807207 CTGTAGTAACTGATGGAGTTGGG - Intergenic
921886608 1:220313660-220313682 CTGGAGTGACACTTGGCATCAGG + Intergenic
922752763 1:228078425-228078447 CTGGAGTGACAGAGGCGGCCTGG - Intergenic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
924674972 1:246166579-246166601 CTGGAGTCTCGGCTGGAGTCTGG + Intronic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1066329795 10:34407926-34407948 CTGTGGTGAGAGATGGAGGCAGG - Intronic
1066392554 10:34989993-34990015 TTGGAGTGAGAGCGGGAGTCAGG - Intergenic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070523406 10:77274692-77274714 CTGGGATGACAAATGGAGTCGGG - Intronic
1070733897 10:78850543-78850565 GTGGAGTTCCAGATGGATTCAGG - Intergenic
1071304533 10:84286818-84286840 CTGGAGTTAGGGATGGAGTAGGG + Intergenic
1073630775 10:105146509-105146531 CTGGTCTTTCAGATGGAGTCAGG - Intronic
1074786635 10:116847940-116847962 CTGGAGTGAGAGCTGGATTGTGG + Intergenic
1074998356 10:118777001-118777023 GTGGAGAGATAAATGGAGTCCGG - Intergenic
1075676792 10:124301510-124301532 CTGCAGTGAGAGCTGGTGTCTGG - Intergenic
1076097525 10:127744209-127744231 CTGGATTGTCAGAAGGAGTCTGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077640106 11:3873652-3873674 CTGGAGTGAGGGGTGGAGCCTGG + Intronic
1078386606 11:10898507-10898529 CTAAAGTCACACATGGAGTCAGG + Intergenic
1078659651 11:13277214-13277236 CCGGAGGGAGAGAGGGAGTCAGG + Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1080622543 11:33998545-33998567 GTGGAGGGGGAGATGGAGTCTGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1084525750 11:69697065-69697087 CTTGATTGGCAGATGGAGACAGG + Intergenic
1084532150 11:69733873-69733895 CTGTAGTGGAAGATGGACTCTGG - Intergenic
1085834705 11:79940289-79940311 CTGGAGTGACAGGTTAAGCCAGG - Intergenic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1087841643 11:102926804-102926826 GTGGAGTGCCAGAGGAAGTCTGG + Intergenic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1091568370 12:1663468-1663490 CTGGAGAGAGAGATGGCCTCTGG + Intergenic
1091788086 12:3255192-3255214 CTGGCGGGACAGACAGAGTCAGG - Intronic
1091848189 12:3673874-3673896 CAGCAGTCACTGATGGAGTCAGG + Intronic
1092284644 12:7121727-7121749 CTGGAGTTCCAGCTGGAATCTGG + Intergenic
1093275948 12:17126850-17126872 CTCAAGTGACAGAAGGAGTGAGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1100183004 12:92106009-92106031 GTGGATTGGCAGAGGGAGTCTGG + Intronic
1100449322 12:94690251-94690273 CTGGAGTAATAGATGGAGGCTGG - Intergenic
1102454580 12:113063676-113063698 CTGGAGTGGCAGGTGGTGGCTGG + Intronic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1106608943 13:31259645-31259667 CTGGACTGAAAGGCGGAGTCTGG - Intronic
1108088428 13:46819602-46819624 CTGGAGTGAAGGAAGGAGTATGG + Intergenic
1108191989 13:47951061-47951083 CTGGAGTGTTAGATGGTGCCTGG - Intronic
1108561017 13:51644102-51644124 GGGGAGAGACAGAGGGAGTCAGG + Intronic
1109162922 13:58998563-58998585 CTGGAGTGGGGGATGGACTCAGG + Intergenic
1109306015 13:60642718-60642740 CTTGAATGTCAGCTGGAGTCGGG + Intergenic
1109311836 13:60704086-60704108 CTGGAGTGAGAGAGCGAGGCAGG + Intergenic
1111578934 13:90197466-90197488 CTGAAGTGACAGCTGAAGACAGG - Intergenic
1113769202 13:112897858-112897880 CTGGAGTGAGGGCTGCAGTCAGG + Intronic
1114671096 14:24411501-24411523 CTGGTGTGTCAGGTGGAGTCCGG + Intronic
1114802743 14:25796978-25797000 CTGCAGTGACGGCTGGAGTCAGG - Intergenic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1117276889 14:54202887-54202909 CCGGGGTTACAGACGGAGTCTGG + Intergenic
1119575648 14:75719147-75719169 CTGGAGTGACAGTAAGAGTGAGG - Intronic
1119646029 14:76349174-76349196 CTGGCGGGGCAGCTGGAGTCCGG + Intronic
1121060191 14:90900626-90900648 CTGGAGTGACAAATGTTGCCAGG - Exonic
1121377706 14:93429983-93430005 ATGGAGAGACACTTGGAGTCGGG - Intronic
1121420696 14:93811351-93811373 TTGGTGTGACAGATGGGGTCAGG + Intergenic
1121908124 14:97766080-97766102 CTGGATTGACAGAAGAAGCCAGG - Intergenic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123936592 15:25197003-25197025 CTGCAGTGGCACATGGGGTCCGG + Intergenic
1124705632 15:31961416-31961438 CAGGAGTGAGAGAGGGAGTTGGG - Intergenic
1125823675 15:42656973-42656995 TTGGAGGAACAGATGGTGTCTGG - Intronic
1126845148 15:52752796-52752818 GTGGAGGGACAGGTGAAGTCAGG + Intergenic
1127706505 15:61552434-61552456 CTGGAATGACAGATGGGATTTGG + Intergenic
1129929653 15:79399813-79399835 CTGCAGTGACAGCTGAAATCAGG + Intronic
1131667982 15:94590576-94590598 CTGGAGTGACGGAAGGAGAAAGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132935607 16:2479211-2479233 TTGGAGTGAAGGATGGAGTATGG + Intronic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1134404697 16:13946154-13946176 CAGAAGTGAAAGATGGAGGCAGG - Intronic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1136856574 16:33664194-33664216 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1137000669 16:35227517-35227539 ATGGATTCACAGATGGATTCTGG + Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139428853 16:66900393-66900415 ATGGAGTGGCAGAGGGGGTCTGG + Intergenic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1203118152 16_KI270728v1_random:1512669-1512691 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1142589055 17:993208-993230 CTGGTCTGACAGATGGAATAAGG - Intergenic
1142755977 17:2016615-2016637 CTGCGGTGAGAGACGGAGTCTGG + Intronic
1143064589 17:4235808-4235830 CCGCAGTGACAGCTGGAGTCTGG - Exonic
1145239760 17:21233792-21233814 AGGCAGAGACAGATGGAGTCTGG - Intergenic
1147050363 17:37789889-37789911 CTGGGGTGACAGGTGCAGGCAGG + Intergenic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151412511 17:73940779-73940801 CTGGAGTGACAAATGGTCTGAGG - Intergenic
1151775237 17:76196766-76196788 CTGGAGTGAGATAGGGAATCAGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1152888439 17:82866282-82866304 CTGGGGTGAAAAATGGAGTGAGG - Intronic
1153039478 18:798492-798514 TTGGAGTGACTGATGGGGTAGGG + Intronic
1155919520 18:31589117-31589139 CTACAGTTACAGATGGATTCTGG + Intergenic
1156760726 18:40585781-40585803 CTGAAGTGAAGGAGGGAGTCTGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162232732 19:9281209-9281231 CTGGAGGGAAAGATGGATTTAGG + Intergenic
1162232843 19:9282034-9282056 CTGGAGGGAAAGATGGATTTAGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1164419442 19:28075773-28075795 GTGGAGGGACAGAAGCAGTCAGG + Intergenic
1165761816 19:38326059-38326081 CTTCACTGACAGATGGAGTGCGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167120614 19:47514460-47514482 CTGGGGGGACGGAGGGAGTCCGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167784377 19:51625434-51625456 TTGGAATGAGAGATGGAGGCAGG + Intronic
925552426 2:5090799-5090821 CTGGAGTGACAGACTGATTAAGG - Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
928224543 2:29436941-29436963 CAGGAGTGACAGAGGTAGTGAGG + Intronic
928428263 2:31197238-31197260 CTGGAGTGACAGGTGAACTTTGG - Exonic
929251054 2:39756082-39756104 CTGAAGGGACAGATGGGTTCAGG + Intronic
929451668 2:42042230-42042252 AGCGAGTGACAGATGGACTCAGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
931804205 2:65788782-65788804 CCTGAGTAACAGATGGAGGCAGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
936450695 2:112631925-112631947 CTGGGGTACCAGGTGGAGTCTGG - Intergenic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
942867762 2:180696944-180696966 GGGGAGAGTCAGATGGAGTCGGG + Intergenic
942888893 2:180963290-180963312 CTAGAGAGACAGATCTAGTCTGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946192849 2:218016513-218016535 CTGCAGTGTGAGAAGGAGTCTGG + Intergenic
947794563 2:232885791-232885813 CTGCAGTGACACATGGGGCCCGG + Intronic
1169117020 20:3072340-3072362 CTGGAGGAAGAGGTGGAGTCAGG - Intronic
1169209092 20:3755729-3755751 CTGGAGTGATGGAGGGAGTTGGG - Intronic
1169303515 20:4468196-4468218 TTGGAGTGAAAGATGGAGAAAGG + Intergenic
1170054743 20:12189260-12189282 CTGGATTTACAGAATGAGTCAGG - Intergenic
1170784236 20:19453591-19453613 CGGGAGTGGCCGATGGAGCCTGG + Intronic
1171008600 20:21492725-21492747 ATGGATTGACAGATGGTGTCTGG + Intergenic
1172508194 20:35479733-35479755 CTTGAGTGACAGTTTGAATCTGG - Exonic
1172620939 20:36318260-36318282 TTGGAGAGACAGCTGGTGTCAGG - Intronic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173944639 20:46940933-46940955 GTGGCGAGACAGATGGAGTCAGG - Intronic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174549973 20:51355087-51355109 CTCTGGTGACAGATGGAGTGGGG + Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175529765 20:59666410-59666432 CTGGAATGTCAGGTGGATTCAGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176650649 21:9543903-9543925 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1178330551 21:31686856-31686878 CTGGAGTGGAAGATGGTTTCAGG - Intronic
1178582377 21:33847647-33847669 GTGGAGTGTCAGATGGTCTCTGG + Intronic
1178665556 21:34543335-34543357 CTGGAGTCGGAGATGGAGACAGG + Intronic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179708533 21:43196147-43196169 GTGGAGTCACTGTTGGAGTCAGG + Intergenic
1179944020 21:44658464-44658486 CTGGAGTGAGAGAAGGACTCTGG - Intronic
1180007986 21:45032098-45032120 CTGCAGTGACAGACGGGGGCTGG + Intergenic
1181436112 22:22911959-22911981 CGTGAGTGACAGAGGGAGTGGGG - Intergenic
1182103560 22:27673580-27673602 CTGGAGTGACAGAGCGAGACTGG - Intergenic
1182420670 22:30247147-30247169 CTGGACTAGCAGATGGAGACTGG + Intergenic
1183104898 22:35608711-35608733 GTGAAGTCACACATGGAGTCGGG - Intronic
950471538 3:13189482-13189504 ATGGAATGAGAGATGTAGTCAGG - Intergenic
950491087 3:13305491-13305513 GTGGGGTGACAGATGTAGTTCGG + Intergenic
950633345 3:14298629-14298651 CTGGAGTGACAGATGCCTTCAGG - Intergenic
952376002 3:32767934-32767956 TGGGAGAGACAGATGGGGTCAGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953342194 3:42144105-42144127 CAGGAGTGACAGGTGGGGTGAGG - Intronic
954467908 3:50667727-50667749 CTGGAGTGACAGACTGGGGCTGG + Intergenic
955190352 3:56755850-56755872 ATGGAGTGACCAATGGAGGCAGG + Intronic
955195632 3:56802294-56802316 CTGTAGTGACACCTGGAGGCAGG + Intronic
955346898 3:58168077-58168099 CTGGAGGGAGAGCTGGACTCTGG + Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956786233 3:72644583-72644605 CTGGGGTGAAAGATGCAATCAGG + Intergenic
957865164 3:86013452-86013474 CTGGAGTGCCAGATAAATTCTGG + Intronic
960233619 3:115256188-115256210 CTGGAGTAACTGAGGGAGACAGG + Intergenic
961773185 3:129265115-129265137 CCTGGGTGACAGATGGAGGCCGG - Intronic
962479997 3:135789660-135789682 TTGAAGTGAAAGATGGGGTCAGG - Intergenic
962520829 3:136196150-136196172 CTGGAGTGGCGCGTGGAGTCGGG - Intronic
967162058 3:186747713-186747735 CTGCAGTGAGAGATGGATGCAGG + Intergenic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969477042 4:7427705-7427727 CAGGAGTGTCACATGGAGGCAGG + Intronic
970625718 4:17877546-17877568 CTGGTGTGAGAGATGGAGGCTGG + Intronic
970794142 4:19891729-19891751 CTAGAGTGACAGCTTGAGTGAGG - Intergenic
973029969 4:45325326-45325348 CTGGAGTGCCAGATAAATTCTGG - Intergenic
974950729 4:68580886-68580908 CTAGAGTGAGAGCTGGAGTGAGG - Intronic
975461439 4:74658273-74658295 TTGGTGTGGCAGAAGGAGTCTGG - Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977868555 4:102061018-102061040 TTGGAGTGAAAGATGGAATATGG - Intronic
978316010 4:107437974-107437996 CTGGAGTAACAAATTGAGTTTGG + Intergenic
978533743 4:109739490-109739512 GTGGTGTGACAGAGGGAGACTGG + Intergenic
982338441 4:154267622-154267644 ATGGAGGGACAGATGAACTCTGG - Intronic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988669911 5:33370389-33370411 GGGGAGTGGCAGATGGAGTGGGG + Intergenic
989439711 5:41456006-41456028 GTACAGTGATAGATGGAGTCTGG + Intronic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
991159268 5:63477761-63477783 CTGGAGGGACAGAATGAGTTTGG + Intergenic
993653245 5:90547498-90547520 CTTCATTGACAGATAGAGTCAGG - Intronic
995685201 5:114765206-114765228 TTGGAGTGCCAGAAGGAGACAGG - Intergenic
996114119 5:119599569-119599591 AAGGAGTGACAGATGGCATCTGG + Intronic
997370425 5:133356364-133356386 CTGGATTTAGAGATGAAGTCTGG + Intronic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1000327665 5:160184560-160184582 CTGGAGTGAGCCATGGTGTCTGG + Intergenic
1003161509 6:3638540-3638562 CTGGAGTAACTGATGCAGTCAGG + Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003703280 6:8494619-8494641 CTGGAGTCACAGAATGTGTCTGG - Intergenic
1004521331 6:16363756-16363778 TTGGAGTGGCAGGTGGGGTCAGG + Intronic
1004790481 6:19021132-19021154 ATGGAGTGAGAGATTGGGTCTGG + Intergenic
1005170773 6:22981832-22981854 CTGGAGTATCTGAAGGAGTCTGG + Intergenic
1006288266 6:33114386-33114408 CTGGTGTGACAGGAGGACTCGGG - Intergenic
1006363739 6:33602431-33602453 ATGGAGTGACACAAGGACTCTGG - Intergenic
1006722825 6:36170070-36170092 CTAGAATGGGAGATGGAGTCAGG + Intergenic
1007020829 6:38519428-38519450 ATGCAGTGACAGATGAAGACAGG + Intronic
1007424092 6:41735586-41735608 GTGGAGTGACAGCCGGAGCCCGG - Intronic
1008741709 6:54616284-54616306 TTGGAGTGCCAGAAGGAGACAGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1010334708 6:74666880-74666902 CTGGAGGGAGATATGGATTCAGG - Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010437389 6:75849572-75849594 CTGCAGTGAGTGATGGAGACAGG + Intronic
1011795035 6:90943622-90943644 CTGGAGTGAAAGCTGGGATCAGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013413209 6:109900515-109900537 CAGGAGTGGCAGAGGGATTCAGG - Intergenic
1014463202 6:121723752-121723774 GTGGTGTGACAGATTCAGTCAGG + Intergenic
1014602575 6:123432693-123432715 GTGGAGTGAAAGATAAAGTCAGG - Intronic
1015629986 6:135222527-135222549 CAGGACTGACAGATAAAGTCAGG + Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015757124 6:136619051-136619073 CTGGACTGACATATGGAGCCTGG + Intronic
1016300222 6:142622302-142622324 CCAGAGAGACAGATGGAGACTGG + Intergenic
1016756988 6:147697964-147697986 CTGGGGTGGGAGATGGATTCAGG + Intronic
1016896017 6:149053981-149054003 CAGGGGTGACAGATGGTGGCAGG - Intronic
1017975834 6:159356587-159356609 CTGGGGTTGCAGATTGAGTCAGG - Intergenic
1024152230 7:46583701-46583723 CTGCAGTGACTGTTGGAATCAGG - Intergenic
1028893664 7:96016432-96016454 ATTGAGTGACATATGGAGACTGG + Intronic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029259739 7:99293657-99293679 CTGCAGTGACAAATAGAGCCAGG - Intergenic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1029805509 7:102991972-102991994 CTGGAGTGAAAGAATGAGTGAGG - Intronic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1034347520 7:150396668-150396690 CTGGGGGGACAGGAGGAGTCTGG + Exonic
1034460891 7:151197465-151197487 CTAGAGTAACTGATGGGGTCGGG + Intronic
1036091159 8:5667238-5667260 CAGGAGTGACAGATGAACTGTGG - Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039149709 8:34490213-34490235 CTGGAGGGTCTGCTGGAGTCAGG + Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1043812769 8:84762622-84762644 TTGGAGTGACAGCTGAACTCAGG + Intronic
1044545688 8:93456556-93456578 TTGGAGTGGCAGATGGTTTCTGG + Intergenic
1045151107 8:99409218-99409240 GTGGAGTGAGAGATGAGGTCAGG + Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047357959 8:124141155-124141177 CTGGTGTTACAGGTGGAGACAGG - Intergenic
1048609254 8:136004129-136004151 CAGCAGTGACAGTGGGAGTCTGG + Intergenic
1049236790 8:141516131-141516153 CTGGAGTGACAGCGTGAGTTGGG - Intronic
1049318989 8:141985906-141985928 CTGGAGTGATTGATGGGGTGAGG - Intergenic
1050257235 9:3807864-3807886 CTAGAGTGAGAGGTGGAGTGTGG - Intergenic
1050507829 9:6365877-6365899 CCTGATTCACAGATGGAGTCAGG + Intergenic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1055928898 9:81539794-81539816 ATGTAGTGACAGAGGTAGTCAGG - Intergenic
1056374812 9:85997433-85997455 GTGGAATGACAGCTTGAGTCTGG - Intronic
1056546072 9:87614946-87614968 CTGGAGTGAGGGTTGGAGACAGG + Intronic
1057210857 9:93200289-93200311 CTGCAGTGACAGACAAAGTCTGG - Intronic
1059620533 9:116000056-116000078 CTAGAGTGATAGATGGGGACCGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1062286879 9:135777302-135777324 CTGGAGTCAGGGCTGGAGTCAGG - Intronic
1062520415 9:136955348-136955370 CTGGTGGGGGAGATGGAGTCGGG - Intronic
1203628388 Un_KI270750v1:47456-47478 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1189284929 X:39845254-39845276 CTTGAGTGGCAGTGGGAGTCAGG + Intergenic
1189397867 X:40639801-40639823 TAGGAGTTACAGATGGAATCCGG + Intronic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1195091615 X:101464876-101464898 TTGGAATCACAGATGGAGTGCGG + Intronic
1196949932 X:120867177-120867199 CTTGACTGACAGAGGAAGTCTGG - Intergenic
1197519502 X:127479597-127479619 CTAGATTGACAGATGGAAGCAGG + Intergenic
1197782215 X:130170765-130170787 CTGGAGTTTCAGAGGGAGTTGGG - Intergenic
1200155808 X:153974369-153974391 CTGGTGTCTCAGCTGGAGTCAGG + Intronic
1200219374 X:154383643-154383665 CTGGAGTAATAGCTGGTGTCAGG + Intergenic
1200916041 Y:8572090-8572112 ATGGAGAGACAGTAGGAGTCCGG + Intergenic