ID: 1008904335

View in Genome Browser
Species Human (GRCh38)
Location 6:56659559-56659581
Sequence AAACACTTATTCTTGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008904335_1008904339 -9 Left 1008904335 6:56659559-56659581 CCATGACCCAAGAATAAGTGTTT 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1008904339 6:56659573-56659595 TAAGTGTTTTAATGAATTATGGG No data
1008904335_1008904340 -8 Left 1008904335 6:56659559-56659581 CCATGACCCAAGAATAAGTGTTT 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1008904340 6:56659574-56659596 AAGTGTTTTAATGAATTATGGGG No data
1008904335_1008904338 -10 Left 1008904335 6:56659559-56659581 CCATGACCCAAGAATAAGTGTTT 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1008904338 6:56659572-56659594 ATAAGTGTTTTAATGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008904335 Original CRISPR AAACACTTATTCTTGGGTCA TGG (reversed) Intronic
903570658 1:24302381-24302403 AAACAATTATTCTTGAGCAAGGG - Intergenic
905398308 1:37682670-37682692 AACCACTTTTTCTTTTGTCAAGG + Exonic
907099365 1:51814281-51814303 AAACTTTTATTCTAGGTTCAGGG - Intronic
907967387 1:59346017-59346039 AGACATTTATTCTAAGGTCATGG + Intronic
908887329 1:68804607-68804629 GAACTTTTATTCTAGGGTCAGGG - Intergenic
908998807 1:70192951-70192973 AAACATTTATTTTAGGTTCAAGG - Intronic
909674172 1:78220619-78220641 ACACACTTATTCCTGGCCCAGGG - Intergenic
911411637 1:97516689-97516711 AAACACTTACTCTTAGCACATGG + Intronic
913616242 1:120562582-120562604 AAACACTTATGATTGGAGCAAGG + Intergenic
915818289 1:158993536-158993558 AAACATTTATTTTAGGTTCAGGG + Intergenic
917263625 1:173196212-173196234 AAAAACTGATTCTTTGGTGAAGG + Intronic
918013316 1:180608372-180608394 AAAAACAGATTTTTGGGTCAAGG + Intergenic
919237310 1:194862090-194862112 ACATACCTATTCTTGTGTCACGG + Intergenic
923006795 1:230056549-230056571 AAACACTCATTGTTGGATCCAGG - Intergenic
924427589 1:243967272-243967294 AAACAATTACTCTTAGGCCAGGG - Intergenic
924699836 1:246439941-246439963 AAACACTTTTTTTTGAGACAAGG - Intronic
1063798810 10:9546490-9546512 AAACAATTATTCTTGGCTACAGG + Intergenic
1065455227 10:25900198-25900220 ATACACTTGTTCTTTGGTTAAGG - Intergenic
1065544539 10:26806174-26806196 AAGCAGATATTCTTGGGGCAAGG - Intronic
1067162582 10:43839891-43839913 AAACTTTTATTTTTGGTTCAGGG + Intergenic
1068589143 10:58835958-58835980 AAGCATTTATTCCTGGTTCACGG - Intergenic
1068743544 10:60502254-60502276 AAATACTTACTCTTGCTTCATGG + Intronic
1070384441 10:75911977-75911999 AACCACTTTTGCTTGGGACAGGG + Intronic
1071052367 10:81466696-81466718 AAACATTTATTTTGGGTTCAGGG + Intergenic
1071077869 10:81775909-81775931 GAACAATGATTCTTAGGTCATGG - Intergenic
1071814327 10:89216870-89216892 AAACACTTTTTCTTGAGTACTGG + Intronic
1072441691 10:95462724-95462746 AAACTTTTTTTCTTTGGTCAGGG + Intronic
1075816193 10:125266428-125266450 AAATACTATTTCTTGGGACATGG - Intergenic
1078709111 11:13773297-13773319 AAACACTTATTGATGGCTCACGG + Intergenic
1078712192 11:13804572-13804594 AAACATTTATTTTAGGTTCAGGG + Intergenic
1081098127 11:38966409-38966431 TAACACTTATTATTGGTTCTCGG + Intergenic
1081150065 11:39617198-39617220 AAACATTTATTTTTGAGTAAGGG + Intergenic
1083013524 11:59426981-59427003 TAACTCTGTTTCTTGGGTCATGG + Intergenic
1083072138 11:59995573-59995595 AATCACTAATTCTGGGGTAATGG + Intergenic
1086568640 11:88257196-88257218 AAAAACTTATTTTAGGTTCAGGG + Intergenic
1087416639 11:97864666-97864688 AAACTCTTATTCTAAGTTCAGGG - Intergenic
1087443312 11:98213250-98213272 TAATAATTATTCTTGGGTCGTGG - Intergenic
1087484032 11:98738674-98738696 AAACACTAATTTTTGTGCCATGG + Intergenic
1087553177 11:99678401-99678423 AAATACTTATTCCTGGATGATGG + Intronic
1088158300 11:106836998-106837020 AAACTTTTATTTTTGGTTCAGGG + Intronic
1089379943 11:118022341-118022363 TAAGACTTATTGTTGGGCCAGGG - Intergenic
1092631836 12:10388017-10388039 AAACTTTTATTTTTGGTTCAGGG + Intronic
1093898727 12:24605684-24605706 AGACATTTATTTTTGGCTCATGG - Intergenic
1094764753 12:33579976-33579998 TAACTCTTATTTTAGGGTCAGGG - Intergenic
1095122135 12:38432131-38432153 AATCCCTTATTCTTGGCCCATGG - Intergenic
1095906771 12:47386322-47386344 AAACACTGATTTTTTGGTTATGG - Intergenic
1096996995 12:55844580-55844602 AAATACCTATTATTGGGTGATGG + Intergenic
1097112188 12:56668900-56668922 AATCATTTATTCTTGGGCCATGG + Intronic
1099395012 12:82127187-82127209 AAAAACTTATTTTAGGTTCAGGG - Intergenic
1101466582 12:104956256-104956278 TAATGCTTATTCTTGGGTAAAGG - Intronic
1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG + Intronic
1103174627 12:118851912-118851934 AACAGCATATTCTTGGGTCAAGG + Intergenic
1103211828 12:119172896-119172918 AAATACTTATTCCAGGTTCAGGG - Intergenic
1104201044 12:126589451-126589473 AAATATTTATTCTCTGGTCATGG + Intergenic
1108496060 13:51026448-51026470 AAAAACTTTTTCTTAGGACAGGG + Intergenic
1110809765 13:79799026-79799048 AAATTCTTAATATTGGGTCATGG - Intergenic
1111001514 13:82189984-82190006 AAACACTTATTTTTAGTACATGG + Intergenic
1113326785 13:109289975-109289997 CAACAATTATTCTTGAGACAGGG - Intergenic
1113862514 13:113497780-113497802 AAACATTTATTCTTAGCTAAAGG - Intronic
1117834983 14:59794686-59794708 AAACCCTTGTTCTTGGCTAAAGG + Intronic
1118325610 14:64778517-64778539 AAGCACTCCCTCTTGGGTCAGGG - Intronic
1120544054 14:85788233-85788255 AAACACTTATTCTTTCTTCCAGG + Intergenic
1125616012 15:41013954-41013976 CAACAGTTATTTTTGGGTTATGG - Intronic
1128453043 15:67818165-67818187 AAACACTTGTTCTTGGGAGGTGG - Intergenic
1129176441 15:73843193-73843215 AAAAATTTATTCTTGAGACACGG + Intergenic
1131314795 15:91325864-91325886 AAACATTTATTTTTGGTTCAGGG + Intergenic
1131374306 15:91910953-91910975 AAACACTTATTCTTAGGGGCAGG - Intronic
1134834137 16:17347189-17347211 AATCACTTTTTCTTGGTTCTCGG - Intronic
1137889591 16:52145055-52145077 AAACACTTATTTTAAGTTCAGGG - Intergenic
1140350625 16:74258695-74258717 AAACACTTACTTTTTGGTCATGG - Intergenic
1143317232 17:6041821-6041843 AAAGGCTTATTTTTGGCTCATGG + Intronic
1144759644 17:17700225-17700247 AAAGACCTATTCTTGGGGCCTGG + Intronic
1145223638 17:21109477-21109499 AACCATTTCTTCTTGGGCCATGG - Intergenic
1147775689 17:42899192-42899214 AAACCCTAACACTTGGGTCACGG - Intergenic
1151023626 17:70650726-70650748 AAACATTTATTTTTGATTCAGGG + Intergenic
1154039766 18:10842962-10842984 AATCTCTTATCCTTGAGTCATGG + Intronic
1155760583 18:29560383-29560405 AAGCAGTTATTCTTTGCTCAGGG - Intergenic
1156190696 18:34716806-34716828 AAACACATATACATGGGTAAAGG - Intronic
1156844714 18:41651759-41651781 AAACTGTTCTTCTTGGGTCTAGG - Intergenic
1157144328 18:45146103-45146125 AAACATTTATTTTAGGTTCAGGG + Intergenic
1159745145 18:72224558-72224580 AAACACTCACTCTAAGGTCAAGG + Intergenic
1163533191 19:17862594-17862616 AAACAGTGATTCTTGGGTTTAGG - Intronic
1164980291 19:32608441-32608463 AAACAGTGATTCTTGGGTTTAGG + Intronic
1165172181 19:33901591-33901613 AAACACTCATTCTTCGGCAAAGG + Intergenic
1165658482 19:37554000-37554022 AAACTATTATTTTAGGGTCAGGG + Intronic
1166147489 19:40847631-40847653 GAACACTTATTTGTGTGTCAGGG + Intronic
1166151635 19:40879516-40879538 GAACACTTATTTGTGTGTCAGGG + Intronic
1167302715 19:48688173-48688195 AAACACTTGACCTTTGGTCATGG - Intergenic
927897112 2:26790070-26790092 AACCACTTGTTCTTGGGTCATGG + Intronic
928792476 2:34974643-34974665 AAACATTTATTTTAGGTTCAGGG + Intergenic
930454611 2:51590778-51590800 AAACACTTAATTATGTGTCATGG - Intergenic
932115842 2:69046210-69046232 AAACTCTTATGCATGGGGCATGG - Intronic
932123546 2:69123231-69123253 AAACACTTATCCTGGCGTCTGGG - Intronic
933044979 2:77524556-77524578 TACCACTTTTTCTTGGGTGAAGG - Intronic
934892829 2:98085854-98085876 ACACTAATATTCTTGGGTCACGG - Intergenic
935542081 2:104360648-104360670 AACAACTTCCTCTTGGGTCAGGG + Intergenic
935599258 2:104905789-104905811 AAACACTGGTTCTTGGATTAGGG + Intergenic
935650464 2:105377771-105377793 AGACAGTGACTCTTGGGTCATGG - Intronic
935745779 2:106189176-106189198 AAACACTTATTCTTCAGTTATGG - Intronic
936259281 2:110944359-110944381 AAACTTTTATTCTAGGTTCAGGG + Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937080075 2:119134569-119134591 GAACACTATTTCCTGGGTCAGGG + Intergenic
937337506 2:121070998-121071020 ATACACTTTTTCTTGAGACAGGG - Intergenic
938882984 2:135610955-135610977 AAAAAATTATTCATGCGTCACGG + Intronic
939493403 2:142902340-142902362 TAACACTGAGTCTTGGGTTAAGG + Intronic
940403175 2:153269732-153269754 ACACACTTCTTCATGGCTCAGGG + Intergenic
940913753 2:159231608-159231630 AAACACTTATTTCTGTGTTATGG + Exonic
943652051 2:190467705-190467727 AAACTATTATTCTTAGTTCACGG - Intronic
944937691 2:204586311-204586333 AAACACTGATACTGGTGTCAGGG - Intronic
945847087 2:214958620-214958642 CTACATTTATTCTAGGGTCATGG - Intronic
947053203 2:226070563-226070585 AAGCACTTATTCATTGGTCCTGG - Intergenic
947562468 2:231168957-231168979 AAACACTTCCTCTTGCCTCATGG - Intronic
948911590 2:241007593-241007615 AAGCACTTATTTTTGGGTGATGG - Intronic
1170128472 20:12991771-12991793 AAGCACTTATACTTGGGTATTGG - Intergenic
1170529217 20:17273271-17273293 TAACACTTATTCATGTGACATGG + Intronic
1174748048 20:53084210-53084232 AAACACTTGTTCTTGATTCCAGG - Intronic
1178189656 21:30265799-30265821 AAACACTTGTGCCTGGGTCGTGG - Intergenic
1179218483 21:39386787-39386809 TAACACTTATACGTGGGTCTTGG + Intronic
1183969492 22:41466052-41466074 AAAGACCTATTCTTCGCTCATGG + Intronic
1184156559 22:42671358-42671380 CAACATTTATTCTAGGTTCAGGG - Intergenic
949772980 3:7598774-7598796 AAACACTTATTTTTTCATCATGG - Intronic
950023706 3:9806717-9806739 CAACACTTATACTGGGGCCAAGG - Intronic
953139049 3:40210659-40210681 AAAAAATTATTCTTGTCTCAGGG + Intronic
953635218 3:44657720-44657742 AAACTCTTACCCTTGTGTCAGGG - Intronic
955807371 3:62751419-62751441 AAGTACTTCTTCTTGGGACAGGG - Intronic
955888145 3:63621947-63621969 AAACAATAAATCTTGGGTTATGG + Intergenic
955935438 3:64098653-64098675 AATAACTTAGTCTTGGGTCCTGG + Exonic
957487451 3:80881263-80881285 AAGCGTTTATTCTTGGGTCCAGG + Intergenic
958770173 3:98416495-98416517 AAAAACTTCATCTTGGGTCCTGG + Intergenic
959037866 3:101386867-101386889 AGACACTTATTCTGGGGGCCTGG - Intronic
959314493 3:104785644-104785666 AGACACTTATTCTTGGATTTAGG - Intergenic
963006128 3:140727620-140727642 AAACAGTGATTCTTGGGGCCAGG - Intergenic
965897216 3:173593226-173593248 AAACAATTATTTTTGATTCAAGG + Intronic
970466826 4:16332595-16332617 AAACATTTATTTCTGGTTCAGGG + Intergenic
971413472 4:26400085-26400107 AAACAGTAATTCTACGGTCAAGG + Intronic
973030307 4:45329623-45329645 AAATACTTACTCTAGGGTGAGGG - Intergenic
974224837 4:59027050-59027072 AAATAATTGTTCTTGGTTCATGG - Intergenic
975575647 4:75859965-75859987 AAATCCATATGCTTGGGTCATGG + Exonic
976086162 4:81409251-81409273 AGACACTTACTCTTATGTCATGG - Intergenic
977285930 4:95106806-95106828 AAACACTTATTTTTCATTCAGGG + Intronic
977375707 4:96201238-96201260 AAACATTACTTGTTGGGTCATGG + Intergenic
978952405 4:114576615-114576637 AAACTCTTATTTTAGGTTCAGGG + Intergenic
981024414 4:140062409-140062431 AATCAGATATTCTTGGGGCAGGG + Intronic
981834169 4:149036034-149036056 AACCACTTATTTTTGGTTCGGGG + Intergenic
982928452 4:161370156-161370178 AAACATTTATTTTAGGTTCAGGG + Intergenic
983302095 4:165938890-165938912 AAACATCTATTCTTGCTTCATGG + Intronic
984475874 4:180234045-180234067 AAACACTTTTTTTTGGTCCATGG - Intergenic
984686165 4:182670825-182670847 ACACACTTATTCTTGTGTGGTGG - Intronic
986194871 5:5528786-5528808 AAACTTTTATTTTTGGTTCAGGG + Intergenic
987066132 5:14291443-14291465 AATTACTTATTCTTTGGTCTAGG + Intronic
987597154 5:20016447-20016469 AAACTTTTATTTTTGGTTCAGGG - Intronic
988340860 5:29969295-29969317 AAACTCTTATTTTAGGTTCAGGG - Intergenic
989151225 5:38301679-38301701 AAAGAATTATGCTTGGGTCATGG + Intronic
989789223 5:45374855-45374877 TAAAACTTATTTTTGGTTCATGG + Intronic
992136628 5:73752579-73752601 AAACACAAATTCAGGGGTCAGGG + Intronic
993284821 5:85980428-85980450 AAACACAGATTCTTATGTCAAGG + Intergenic
994129890 5:96214838-96214860 AAAGACTTTTTCTTGGATTATGG - Intergenic
994944292 5:106365676-106365698 AAACAGTTTTTCTTGGCTGAGGG - Intergenic
996073883 5:119165919-119165941 AGAAACTTATGCTTGGGACAGGG + Intronic
996318239 5:122185412-122185434 AAACTTTTATTCTAGGTTCAGGG + Intergenic
999661484 5:153867971-153867993 AAATACTTCTTCTTTGTTCATGG + Intergenic
1000111589 5:158113230-158113252 AAAAACATAATCTTGGTTCATGG + Intergenic
1000543001 5:162564236-162564258 ACACACTTATTCTTGGTACTAGG + Intergenic
1001378478 5:171285370-171285392 TGACACTTATTTTTGGTTCATGG - Intronic
1008904335 6:56659559-56659581 AAACACTTATTCTTGGGTCATGG - Intronic
1009661046 6:66611651-66611673 AAACACATATTTTTGGGACTAGG + Intergenic
1009894816 6:69735132-69735154 AGCCACTTATTCTTAGTTCAGGG + Intronic
1012812240 6:103973805-103973827 AAACAAAAATTCTTGGGTCATGG - Intergenic
1015281971 6:131443535-131443557 AAACACATAGTCTTGGGACCTGG + Intergenic
1015597422 6:134879026-134879048 GAATATTCATTCTTGGGTCATGG - Intergenic
1016488996 6:144575309-144575331 AAACAGTTATTTTTGGGTGCTGG - Intronic
1017314077 6:153008932-153008954 AAACTCGTATTTTTGGGTGAGGG - Exonic
1017371425 6:153713498-153713520 AGACACTTATTCCTGGGCAAAGG + Intergenic
1017932154 6:158966071-158966093 AAACTCTTATTTTAGGTTCAGGG + Intergenic
1019089398 6:169515087-169515109 AAACTCTCATTCATGGGTCGTGG + Intronic
1019844641 7:3485452-3485474 AAACACCTATGCTTGGGGTAGGG - Intronic
1020876481 7:13701311-13701333 AAACATTTCATTTTGGGTCAAGG + Intergenic
1024113990 7:46174805-46174827 AAAAACTGATTATTGAGTCATGG - Intergenic
1024675162 7:51631642-51631664 AAGCACTTATTTTATGGTCAAGG - Intergenic
1027421954 7:78025489-78025511 AAGCACTTATTTTTGTGTCGAGG - Intronic
1027506762 7:79025487-79025509 AAAAACTTATTTTAGGCTCAGGG - Intronic
1027652520 7:80887486-80887508 ATCCATTTAATCTTGGGTCAGGG - Intronic
1030739873 7:113096029-113096051 AAACATTTATGCTTGAGTCAGGG + Intergenic
1030885723 7:114934214-114934236 AAACATTTATTGTTGGGGTAAGG + Intronic
1031024257 7:116663022-116663044 AATCGCTTATTCTAGGGTCTGGG + Intergenic
1032371923 7:131364482-131364504 AAACATTTATTTTAGGTTCAGGG + Intronic
1032649427 7:133861395-133861417 AAACGTTTATTCTAGGTTCAGGG - Intronic
1032990527 7:137389991-137390013 AAGCCTTTGTTCTTGGGTCAAGG + Intronic
1037253845 8:16928976-16928998 AAACTTTTATTTTAGGGTCAAGG - Intergenic
1039379822 8:37074667-37074689 AAAAACTCATTCTTGGCTAAAGG + Intergenic
1040679934 8:49796499-49796521 AAACACATAGTTTAGGGTCAAGG + Intergenic
1041416074 8:57609847-57609869 AAAGACTTTTTCTTGTGTCTTGG + Intergenic
1042689675 8:71484174-71484196 AAAAACTGATGCTTGTGTCAGGG + Intronic
1043587764 8:81789091-81789113 AAACTCTTATTTTAGGTTCAGGG + Intergenic
1045034601 8:98167503-98167525 AAACACTTGTTACTGGCTCAGGG + Intergenic
1045316784 8:101050069-101050091 AAATATTTATTCTTGGGGCCGGG - Intergenic
1045580946 8:103479586-103479608 AATGACTCATTCTTGGGCCAAGG + Intergenic
1047433264 8:124811785-124811807 AAACACTTTTTCATGGATCCCGG + Intergenic
1047550027 8:125860916-125860938 ACACACTTATTTTTGGGAAATGG + Intergenic
1051316787 9:15844424-15844446 AAAGACGTATTCTTGAATCACGG + Intronic
1051470120 9:17429672-17429694 AATGACTTATCCATGGGTCATGG + Intronic
1052606175 9:30704936-30704958 AAACACATATTCTTGGAATAAGG - Intergenic
1058286073 9:103180093-103180115 AATCAGCTATTCCTGGGTCATGG + Intergenic
1060360773 9:122954717-122954739 AAACACTCAGTATTGGGTAAAGG - Intronic
1186662731 X:11685477-11685499 CACTACTTTTTCTTGGGTCATGG + Intergenic
1191586104 X:62828320-62828342 AAACACTTCCTTTTGGTTCATGG - Intergenic
1191817332 X:65260554-65260576 AAACATTTATTTTAGGTTCAGGG - Intergenic
1193700872 X:84759729-84759751 TAACACATATTCTTTGGACATGG + Intergenic
1194267876 X:91778177-91778199 CAACTCTTATTCTTGTTTCAAGG - Intergenic
1194501227 X:94684018-94684040 AAACACTTCTTGTTGGCTAAGGG - Intergenic
1194593438 X:95829870-95829892 AAACTTTTATTTTAGGGTCAGGG + Intergenic
1196009986 X:110876381-110876403 AAGCAATTATTCTTGCCTCAAGG + Intergenic
1196174011 X:112620379-112620401 CAAGACTTCTTCTTGGGCCAGGG - Intergenic
1198061108 X:133045888-133045910 CAACAATCATTGTTGGGTCAAGG + Intronic
1200585084 Y:4999102-4999124 CAACTCTTATTCTTGTTTCAAGG - Intergenic
1201365400 Y:13200426-13200448 AAATATTTTTTCTTGAGTCAGGG + Intergenic