ID: 1008904482

View in Genome Browser
Species Human (GRCh38)
Location 6:56661438-56661460
Sequence CTGTAAAGCTTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 268}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008904482_1008904496 19 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904496 6:56661480-56661502 GTGGCAGCATGCGGGGGGAGGGG No data
1008904482_1008904492 13 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904492 6:56661474-56661496 GGATCAGTGGCAGCATGCGGGGG 0: 1
1: 0
2: 1
3: 8
4: 142
1008904482_1008904485 -8 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904485 6:56661453-56661475 CTTTACAGCCCTATTGTTAGTGG 0: 1
1: 0
2: 1
3: 7
4: 106
1008904482_1008904489 10 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904489 6:56661471-56661493 AGTGGATCAGTGGCAGCATGCGG No data
1008904482_1008904494 17 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904494 6:56661478-56661500 CAGTGGCAGCATGCGGGGGGAGG 0: 1
1: 1
2: 2
3: 25
4: 292
1008904482_1008904493 14 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904493 6:56661475-56661497 GATCAGTGGCAGCATGCGGGGGG No data
1008904482_1008904495 18 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904495 6:56661479-56661501 AGTGGCAGCATGCGGGGGGAGGG 0: 1
1: 0
2: 3
3: 10
4: 271
1008904482_1008904491 12 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904491 6:56661473-56661495 TGGATCAGTGGCAGCATGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1008904482_1008904490 11 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904490 6:56661472-56661494 GTGGATCAGTGGCAGCATGCGGG 0: 1
1: 0
2: 0
3: 18
4: 154
1008904482_1008904487 0 Left 1008904482 6:56661438-56661460 CCATCTTCCCTCAAGCTTTACAG 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1008904487 6:56661461-56661483 CCCTATTGTTAGTGGATCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008904482 Original CRISPR CTGTAAAGCTTGAGGGAAGA TGG (reversed) Intronic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902997367 1:20237034-20237056 GTGTACAGCTTGACAGAAGAAGG - Intergenic
902997367 1:20237034-20237056 GTGTACAGCTTGACAGAAGAAGG - Intergenic
904235393 1:29113230-29113252 CAGTAAAGCTGCAGAGAAGAGGG + Intronic
904235393 1:29113230-29113252 CAGTAAAGCTGCAGAGAAGAGGG + Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
905718214 1:40172232-40172254 CTGGAAAGATTGAGGGCAGAAGG - Intronic
905718214 1:40172232-40172254 CTGGAAAGATTGAGGGCAGAAGG - Intronic
906234923 1:44200501-44200523 CTGGAAGGCTTGAGGGAAGCGGG - Intergenic
906234923 1:44200501-44200523 CTGGAAGGCTTGAGGGAAGCGGG - Intergenic
908409793 1:63851879-63851901 CTGGAAAGATCCAGGGAAGATGG + Intronic
908409793 1:63851879-63851901 CTGGAAAGATCCAGGGAAGATGG + Intronic
909804210 1:79854586-79854608 TTTTAAAGGTTGAGGGAACAAGG - Intergenic
909804210 1:79854586-79854608 TTTTAAAGGTTGAGGGAACAAGG - Intergenic
914743792 1:150486454-150486476 CTTTAAAGCTGGAGCAAAGATGG - Intergenic
914743792 1:150486454-150486476 CTTTAAAGCTGGAGCAAAGATGG - Intergenic
915163240 1:153933880-153933902 CAGAAAAGAATGAGGGAAGATGG + Intronic
915163240 1:153933880-153933902 CAGAAAAGAATGAGGGAAGATGG + Intronic
916250386 1:162732329-162732351 CTGTGAAGCTTGTGGGAAGCAGG + Intronic
916250386 1:162732329-162732351 CTGTGAAGCTTGTGGGAAGCAGG + Intronic
917266161 1:173223068-173223090 CTGAAAAGCTTGAGGCAAGCTGG - Intergenic
917266161 1:173223068-173223090 CTGAAAAGCTTGAGGCAAGCTGG - Intergenic
919491765 1:198213201-198213223 CTGTTAATCTTAAGGGAAGGGGG + Intronic
919491765 1:198213201-198213223 CTGTTAATCTTAAGGGAAGGGGG + Intronic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
921669687 1:217912235-217912257 TTCTAAAGTTTGAGGAAAGAAGG + Intergenic
921669687 1:217912235-217912257 TTCTAAAGTTTGAGGAAAGAAGG + Intergenic
923214676 1:231837497-231837519 ATGTAATGCTTCATGGAAGAGGG - Intronic
923214676 1:231837497-231837519 ATGTAATGCTTCATGGAAGAGGG - Intronic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
924080698 1:240394665-240394687 CTTTAAAGCTTCAGAGAACAGGG + Intronic
924080698 1:240394665-240394687 CTTTAAAGCTTCAGAGAACAGGG + Intronic
1063299142 10:4836198-4836220 CTGAAATGCTTGAGAGAAAAAGG - Intronic
1063299142 10:4836198-4836220 CTGAAATGCTTGAGAGAAAAAGG - Intronic
1066455177 10:35566172-35566194 CTCACAAGCTTGAGGTAAGATGG + Exonic
1066455177 10:35566172-35566194 CTCACAAGCTTGAGGTAAGATGG + Exonic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068653525 10:59550383-59550405 CTGTGAAGCTAGAAGCAAGACGG + Intergenic
1068653525 10:59550383-59550405 CTGTGAAGCTAGAAGCAAGACGG + Intergenic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1070499817 10:77062016-77062038 CTGTACAGCATGAGGGAATTTGG + Intronic
1070499817 10:77062016-77062038 CTGTACAGCATGAGGGAATTTGG + Intronic
1071420921 10:85498267-85498289 TTGAAAAGCTTGAGGGAAAGAGG - Intergenic
1071420921 10:85498267-85498289 TTGAAAAGCTTGAGGGAAAGAGG - Intergenic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1072258432 10:93643214-93643236 CTGCAAACCTGGAGGCAAGATGG - Intronic
1072258432 10:93643214-93643236 CTGCAAACCTGGAGGCAAGATGG - Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075764718 10:124884315-124884337 CTGCAAAGGTTGGGGTAAGAGGG + Intergenic
1075764718 10:124884315-124884337 CTGCAAAGGTTGGGGTAAGAGGG + Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077737898 11:4810756-4810778 CTGTTCAGATTGAGTGAAGAGGG - Intronic
1077737898 11:4810756-4810778 CTGTTCAGATTGAGTGAAGAGGG - Intronic
1078852401 11:15176863-15176885 CTGGGAAGCTTCAGGAAAGAAGG - Intronic
1078852401 11:15176863-15176885 CTGGGAAGCTTCAGGAAAGAAGG - Intronic
1079426884 11:20352061-20352083 CTTTAAAGTTTGAGGTATGAGGG + Intergenic
1079426884 11:20352061-20352083 CTTTAAAGTTTGAGGTATGAGGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080192169 11:29564000-29564022 CTGTGCAGATTGTGGGAAGATGG - Intergenic
1080192169 11:29564000-29564022 CTGTGCAGATTGTGGGAAGATGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1084057340 11:66644127-66644149 TTTTAAAGCTTGAGGTGAGAGGG + Exonic
1084057340 11:66644127-66644149 TTTTAAAGCTTGAGGTGAGAGGG + Exonic
1085064934 11:73486066-73486088 ATGTAAAGTTTGGGGGAAAACGG + Intronic
1085064934 11:73486066-73486088 ATGTAAAGTTTGGGGGAAAACGG + Intronic
1086092166 11:83015715-83015737 ATTTAGAGATTGAGGGAAGAAGG + Intronic
1086092166 11:83015715-83015737 ATTTAGAGATTGAGGGAAGAAGG + Intronic
1086439060 11:86809971-86809993 TTTTAAAGCTAGAGGGAAAAAGG - Exonic
1086439060 11:86809971-86809993 TTTTAAAGCTAGAGGGAAAAAGG - Exonic
1087060515 11:93972627-93972649 ATGAAAAGGTTGAGGGAAGGGGG - Intergenic
1087060515 11:93972627-93972649 ATGAAAAGGTTGAGGGAAGGGGG - Intergenic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1089080407 11:115771927-115771949 CTGTAAAACTTCAGGCTAGAAGG + Intergenic
1089080407 11:115771927-115771949 CTGTAAAACTTCAGGCTAGAAGG + Intergenic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1091011584 11:132006259-132006281 CGAGAAAGCTTGAGGGGAGAGGG + Intronic
1091011584 11:132006259-132006281 CGAGAAAGCTTGAGGGGAGAGGG + Intronic
1091296328 11:134476327-134476349 CTGGAAACCTTTAGGGAAAAGGG + Intergenic
1091296328 11:134476327-134476349 CTGGAAACCTTTAGGGAAAAGGG + Intergenic
1097048333 12:56204768-56204790 GTGGAAAGCTTGAGGGGAGTAGG - Exonic
1097048333 12:56204768-56204790 GTGGAAAGCTTGAGGGGAGTAGG - Exonic
1099556493 12:84114699-84114721 CTCAAGAGCTTGAGGCAAGAGGG + Intergenic
1099556493 12:84114699-84114721 CTCAAGAGCTTGAGGCAAGAGGG + Intergenic
1099766176 12:86988593-86988615 ATGTAAAGATTTAGGGAATAAGG + Intergenic
1099766176 12:86988593-86988615 ATGTAAAGATTTAGGGAATAAGG + Intergenic
1100240457 12:92706030-92706052 ATTTAAACCTTGAGGGAAGGAGG + Intronic
1100240457 12:92706030-92706052 ATTTAAACCTTGAGGGAAGGAGG + Intronic
1100391005 12:94146894-94146916 CTGGAAGGCTTAAGGAAAGAAGG - Intergenic
1100391005 12:94146894-94146916 CTGGAAGGCTTAAGGAAAGAAGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101455563 12:104826898-104826920 ATGTAAAGTGTCAGGGAAGAGGG + Intronic
1101455563 12:104826898-104826920 ATGTAAAGTGTCAGGGAAGAGGG + Intronic
1104340857 12:127947129-127947151 TTGTGAGGCTTGAGGCAAGATGG - Intergenic
1104340857 12:127947129-127947151 TTGTGAGGCTTGAGGCAAGATGG - Intergenic
1105829122 13:24148806-24148828 CTGGAAAGCTTGAGGAAGGCAGG + Intronic
1105829122 13:24148806-24148828 CTGGAAAGCTTGAGGAAGGCAGG + Intronic
1106489085 13:30200499-30200521 CTAGAAATCGTGAGGGAAGATGG - Intergenic
1106489085 13:30200499-30200521 CTAGAAATCGTGAGGGAAGATGG - Intergenic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1110872730 13:80471327-80471349 CTGTGTAGCTTAAGGGAATATGG + Intergenic
1110872730 13:80471327-80471349 CTGTGTAGCTTAAGGGAATATGG + Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111420082 13:88000167-88000189 CTCTCAAGCTTGGGGGAAGCAGG + Intergenic
1111420082 13:88000167-88000189 CTCTCAAGCTTGGGGGAAGCAGG + Intergenic
1111724504 13:91988741-91988763 CCTTAAAGCTTGATGGAAAATGG - Intronic
1111724504 13:91988741-91988763 CCTTAAAGCTTGATGGAAAATGG - Intronic
1115521032 14:34233300-34233322 CTGTAAAGTTGGAGCCAAGAAGG + Intronic
1115521032 14:34233300-34233322 CTGTAAAGTTGGAGCCAAGAAGG + Intronic
1116003308 14:39267082-39267104 CTGCGAAGCTTGCGCGAAGAAGG + Intronic
1116003308 14:39267082-39267104 CTGCGAAGCTTGCGCGAAGAAGG + Intronic
1117210493 14:53493505-53493527 GTGAAAAGCCTGAGGGAAAAAGG - Intergenic
1117210493 14:53493505-53493527 GTGAAAAGCCTGAGGGAAAAAGG - Intergenic
1117636838 14:57753389-57753411 CTGTAAAGGCTCAGGGAAGCTGG - Intronic
1117636838 14:57753389-57753411 CTGTAAAGGCTCAGGGAAGCTGG - Intronic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1118136424 14:63033151-63033173 CCGTAAAGGTTGAGGGGAGGAGG - Intronic
1118136424 14:63033151-63033173 CCGTAAAGGTTGAGGGGAGGAGG - Intronic
1118867388 14:69714194-69714216 CTTTAAAGCTGGCGGGAGGAGGG - Exonic
1118867388 14:69714194-69714216 CTTTAAAGCTGGCGGGAGGAGGG - Exonic
1121843180 14:97151420-97151442 CTTTAAAGATTGAGAGAGGAAGG + Intergenic
1121843180 14:97151420-97151442 CTTTAAAGATTGAGAGAGGAAGG + Intergenic
1122150395 14:99722419-99722441 CTGTAAAACGTGAGGAGAGAAGG - Intronic
1122150395 14:99722419-99722441 CTGTAAAACGTGAGGAGAGAAGG - Intronic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1127136716 15:55931908-55931930 CTGGGAAGGTTGAGGGAAAATGG - Intronic
1127136716 15:55931908-55931930 CTGGGAAGGTTGAGGGAAAATGG - Intronic
1128983579 15:72203189-72203211 CTGTAAGGTTTAGGGGAAGAGGG + Intronic
1128983579 15:72203189-72203211 CTGTAAGGTTTAGGGGAAGAGGG + Intronic
1129123844 15:73421204-73421226 CTCTAGAGGTTGAGGCAAGAGGG - Intergenic
1129123844 15:73421204-73421226 CTCTAGAGGTTGAGGCAAGAGGG - Intergenic
1129465978 15:75724400-75724422 CTGTAAGGCTTCAAGGAAGTTGG - Intronic
1129465978 15:75724400-75724422 CTGTAAGGCTTCAAGGAAGTTGG - Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1130191074 15:81736425-81736447 TTGAAAAGCTTGAGAAAAGAAGG + Intergenic
1130191074 15:81736425-81736447 TTGAAAAGCTTGAGAAAAGAAGG + Intergenic
1130561973 15:84965879-84965901 CTGTTAAGCTGGAGGGAGGCGGG + Intergenic
1130561973 15:84965879-84965901 CTGTTAAGCTGGAGGGAGGCGGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131492960 15:92878811-92878833 CTGTGAAGCTTCGGGGAAGCAGG + Intergenic
1131492960 15:92878811-92878833 CTGTGAAGCTTCGGGGAAGCAGG + Intergenic
1131550468 15:93352540-93352562 CTTTAAAGCTAGAGAGAAAAGGG + Intergenic
1131550468 15:93352540-93352562 CTTTAAAGCTAGAGAGAAAAGGG + Intergenic
1131962568 15:97805049-97805071 CTGTAAGGATTCAGGGAAGCTGG - Intergenic
1131962568 15:97805049-97805071 CTGTAAGGATTCAGGGAAGCTGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1138731675 16:59201949-59201971 CTGTAAGGCTAGAAGCAAGATGG + Intergenic
1138731675 16:59201949-59201971 CTGTAAGGCTAGAAGCAAGATGG + Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139963199 16:70729661-70729683 CTGTAATGGTTGGGGAAAGAAGG - Intronic
1139963199 16:70729661-70729683 CTGTAATGGTTGGGGAAAGAAGG - Intronic
1140020445 16:71233348-71233370 CTGTAAATCCTAGGGGAAGAAGG - Intergenic
1140020445 16:71233348-71233370 CTGTAAATCCTAGGGGAAGAAGG - Intergenic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1141308390 16:82888598-82888620 CAGAAAAGCTTGGAGGAAGATGG + Intronic
1141308390 16:82888598-82888620 CAGAAAAGCTTGGAGGAAGATGG + Intronic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1142889680 17:2934962-2934984 CAGAAAAGCTTTAGGGAAGACGG + Intronic
1142889680 17:2934962-2934984 CAGAAAAGCTTTAGGGAAGACGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1144009317 17:11131236-11131258 TGGGAAAGGTTGAGGGAAGACGG - Intergenic
1144009317 17:11131236-11131258 TGGGAAAGGTTGAGGGAAGACGG - Intergenic
1144348357 17:14369952-14369974 CTCTCACGCATGAGGGAAGACGG + Intergenic
1144348357 17:14369952-14369974 CTCTCACGCATGAGGGAAGACGG + Intergenic
1145880461 17:28349163-28349185 CTGTAAAGGTTTAGGCAAAATGG + Intronic
1145880461 17:28349163-28349185 CTGTAAAGGTTTAGGCAAAATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146979374 17:37145532-37145554 CTGTAAAGCCTAAGAGAAGGTGG - Intronic
1146979374 17:37145532-37145554 CTGTAAAGCCTAAGAGAAGGTGG - Intronic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1154955462 18:21250083-21250105 CTGGAAAGGTTAGGGGAAGAGGG + Intronic
1154955462 18:21250083-21250105 CTGGAAAGGTTAGGGGAAGAGGG + Intronic
1156712868 18:39967541-39967563 CTGTAAAGAATGGGGGGAGAAGG + Intergenic
1156712868 18:39967541-39967563 CTGTAAAGAATGGGGGGAGAAGG + Intergenic
1157445749 18:47745643-47745665 CTGTAACCCACGAGGGAAGATGG - Intergenic
1157445749 18:47745643-47745665 CTGTAACCCACGAGGGAAGATGG - Intergenic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1159617953 18:70603382-70603404 CTGTAAAGATTGAGGAGAGAGGG + Intergenic
1159617953 18:70603382-70603404 CTGTAAAGATTGAGGAGAGAGGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159749770 18:72285807-72285829 CTGCGAAGGTTGAGGGAAGCAGG + Intergenic
1159749770 18:72285807-72285829 CTGCGAAGGTTGAGGGAAGCAGG + Intergenic
1160038441 18:75322074-75322096 CTGTCAAGCCTGAGGGCAGCCGG + Intergenic
1160038441 18:75322074-75322096 CTGTCAAGCCTGAGGGCAGCCGG + Intergenic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165368729 19:35388481-35388503 CTGTAAGGCTAGAAGCAAGACGG - Intergenic
1165368729 19:35388481-35388503 CTGTAAGGCTAGAAGCAAGACGG - Intergenic
1167805943 19:51785532-51785554 TTGTAAAGATTGAGGGAAAAGGG - Intronic
1167805943 19:51785532-51785554 TTGTAAAGATTGAGGGAAAAGGG - Intronic
925636865 2:5949143-5949165 CTGTAATGCTTGTGTGTAGAGGG + Intergenic
925636865 2:5949143-5949165 CTGTAATGCTTGTGTGTAGAGGG + Intergenic
926942549 2:18153700-18153722 TTGTAAAGAATGAGGGCAGAGGG + Intronic
926942549 2:18153700-18153722 TTGTAAAGAATGAGGGCAGAGGG + Intronic
928232342 2:29509451-29509473 CTGAAAAGCATGAGAGAAGGAGG - Intronic
928232342 2:29509451-29509473 CTGAAAAGCATGAGAGAAGGAGG - Intronic
929401037 2:41582010-41582032 GTGTAAAGAATGAGTGAAGATGG - Intergenic
929401037 2:41582010-41582032 GTGTAAAGAATGAGTGAAGATGG - Intergenic
929589326 2:43134753-43134775 GAGAGAAGCTTGAGGGAAGAAGG - Intergenic
929589326 2:43134753-43134775 GAGAGAAGCTTGAGGGAAGAAGG - Intergenic
930579205 2:53189463-53189485 CTGTAAAGCTAGAGGAGAAAGGG - Intergenic
930579205 2:53189463-53189485 CTGTAAAGCTAGAGGAGAAAGGG - Intergenic
930996430 2:57724383-57724405 TTGCAGAGCTTGAGAGAAGAGGG - Intergenic
930996430 2:57724383-57724405 TTGCAGAGCTTGAGAGAAGAGGG - Intergenic
932256212 2:70289514-70289536 CTGTAAAGAGTGAGGGAGTAGGG + Intronic
932256212 2:70289514-70289536 CTGTAAAGAGTGAGGGAGTAGGG + Intronic
932344734 2:70988256-70988278 CTGTGAAGCTTAAGAGCAGATGG - Exonic
932344734 2:70988256-70988278 CTGTGAAGCTTAAGAGCAGATGG - Exonic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
937681282 2:124647527-124647549 CTGTAGAGCCTGTGGGAAAAGGG + Intronic
937681282 2:124647527-124647549 CTGTAGAGCCTGTGGGAAAAGGG + Intronic
937685407 2:124690912-124690934 CTGCAAACCTTGAGGGTAAAGGG - Intronic
937685407 2:124690912-124690934 CTGCAAACCTTGAGGGTAAAGGG - Intronic
939473797 2:142659376-142659398 CTTTAAAGAGTGAGGGGAGAAGG - Intergenic
939473797 2:142659376-142659398 CTTTAAAGAGTGAGGGGAGAAGG - Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941650781 2:168090382-168090404 GGGGAAAGCATGAGGGAAGATGG - Intronic
941650781 2:168090382-168090404 GGGGAAAGCATGAGGGAAGATGG - Intronic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
945499224 2:210548835-210548857 CAATAAAGTTTTAGGGAAGATGG + Intronic
945499224 2:210548835-210548857 CAATAAAGTTTTAGGGAAGATGG + Intronic
947469751 2:230390129-230390151 CAGTTTAGCTTGAGGGAAGGAGG + Intronic
947469751 2:230390129-230390151 CAGTTTAGCTTGAGGGAAGGAGG + Intronic
947794361 2:232884887-232884909 CTGTGAAGTTTGGGGGAAGCTGG + Intronic
947794361 2:232884887-232884909 CTGTGAAGTTTGGGGGAAGCTGG + Intronic
1169576447 20:6967379-6967401 TTTAAAAGCTTGAGGTAAGAAGG - Intergenic
1169576447 20:6967379-6967401 TTTAAAAGCTTGAGGTAAGAAGG - Intergenic
1169863741 20:10177824-10177846 CTGTAAAGCATAAGGGGTGAGGG + Intergenic
1169863741 20:10177824-10177846 CTGTAAAGCATAAGGGGTGAGGG + Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172885647 20:38229120-38229142 TTGTAAGGCTTGAGGGCAGTTGG - Intronic
1172885647 20:38229120-38229142 TTGTAAGGCTTGAGGGCAGTTGG - Intronic
1174581390 20:51574230-51574252 CTGATCAGCTGGAGGGAAGATGG - Intergenic
1174581390 20:51574230-51574252 CTGATCAGCTGGAGGGAAGATGG - Intergenic
1175092994 20:56520172-56520194 CTGGCCAGCTTGAGGGAAGAAGG + Intronic
1175092994 20:56520172-56520194 CTGGCCAGCTTGAGGGAAGAAGG + Intronic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
1180684565 22:17655273-17655295 CTGTAAAGCCTCAGGGCAGGTGG - Intronic
1180684565 22:17655273-17655295 CTGTAAAGCCTCAGGGCAGGTGG - Intronic
1181028411 22:20138521-20138543 CTGGAAAGCTTCCCGGAAGAGGG + Intronic
1181028411 22:20138521-20138543 CTGGAAAGCTTCCCGGAAGAGGG + Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1183084080 22:35475696-35475718 CTGCAAAGCATGAGGGAAGGGGG + Intergenic
1183084080 22:35475696-35475718 CTGCAAAGCATGAGGGAAGGGGG + Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949251861 3:1994866-1994888 CTGTAAACCTTGAGGGATCTGGG - Intergenic
949251861 3:1994866-1994888 CTGTAAACCTTGAGGGATCTGGG - Intergenic
950786539 3:15441234-15441256 GGGTAAAGCTGGAGGGCAGAGGG - Exonic
950786539 3:15441234-15441256 GGGTAAAGCTGGAGGGCAGAGGG - Exonic
951164432 3:19467871-19467893 GTGTAATGCTGGAGGCAAGATGG - Intronic
951164432 3:19467871-19467893 GTGTAATGCTGGAGGCAAGATGG - Intronic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
957145296 3:76415070-76415092 CTGTAAATCATTAGGGAACAAGG + Intronic
957145296 3:76415070-76415092 CTGTAAATCATTAGGGAACAAGG + Intronic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960556613 3:119036954-119036976 CTGAGAAGCATGAGGGCAGATGG + Intronic
960556613 3:119036954-119036976 CTGAGAAGCATGAGGGCAGATGG + Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961944516 3:130672237-130672259 CAGTAAAGTTTGTGGAAAGATGG - Intronic
961944516 3:130672237-130672259 CAGTAAAGTTTGTGGAAAGATGG - Intronic
961962852 3:130869734-130869756 CTGTGAAGGTTGAGAGAGGAGGG + Intronic
961962852 3:130869734-130869756 CTGTGAAGGTTGAGAGAGGAGGG + Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
963034039 3:141009656-141009678 CTTTAAAGCAGGTGGGAAGAGGG + Intergenic
963034039 3:141009656-141009678 CTTTAAAGCAGGTGGGAAGAGGG + Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964895849 3:161593851-161593873 CTGTAAAGCTTCAGTGATGCAGG + Intergenic
964895849 3:161593851-161593873 CTGTAAAGCTTCAGTGATGCAGG + Intergenic
964920632 3:161891488-161891510 CTGTAAGGCTAGAGACAAGATGG - Intergenic
964920632 3:161891488-161891510 CTGTAAGGCTAGAGACAAGATGG - Intergenic
965061419 3:163788998-163789020 CTTTCAAGCTTGAGGCAATAAGG + Intergenic
965061419 3:163788998-163789020 CTTTCAAGCTTGAGGCAATAAGG + Intergenic
965727530 3:171734685-171734707 CTGTATGGCTTGGGGAAAGAAGG + Intronic
965727530 3:171734685-171734707 CTGTATGGCTTGGGGAAAGAAGG + Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968444788 4:646379-646401 CTGAAAACCTCGAGGGAAGCTGG - Intronic
968444788 4:646379-646401 CTGAAAACCTCGAGGGAAGCTGG - Intronic
969147545 4:5137299-5137321 CTGAAAAGCTTCTGGCAAGAAGG + Intronic
969147545 4:5137299-5137321 CTGAAAAGCTTCTGGCAAGAAGG + Intronic
969885318 4:10210076-10210098 CTGTAATGCTTCAGGGACTAAGG + Intergenic
969885318 4:10210076-10210098 CTGTAATGCTTCAGGGACTAAGG + Intergenic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
971240282 4:24882179-24882201 ATGCAAAGCCTGAAGGAAGATGG + Intronic
971240282 4:24882179-24882201 ATGCAAAGCCTGAAGGAAGATGG + Intronic
971642913 4:29158377-29158399 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
971642913 4:29158377-29158399 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
974988512 4:69058507-69058529 CTGCAAAGTTTAAGGGAAGGCGG + Intronic
974988512 4:69058507-69058529 CTGCAAAGTTTAAGGGAAGGCGG + Intronic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
978716819 4:111854657-111854679 CTGTTAAGCCTGAGAGAATATGG + Intergenic
978716819 4:111854657-111854679 CTGTTAAGCCTGAGAGAATATGG + Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979976596 4:127204300-127204322 ATGAAAAGATTGTGGGAAGAGGG + Intergenic
979976596 4:127204300-127204322 ATGAAAAGATTGTGGGAAGAGGG + Intergenic
980277559 4:130674472-130674494 CTATAAAGCCTGTGGGAACAAGG + Intergenic
980277559 4:130674472-130674494 CTATAAAGCCTGTGGGAACAAGG + Intergenic
980308334 4:131094493-131094515 CTCTACAGGTTGAGGGAGGATGG + Intergenic
980308334 4:131094493-131094515 CTCTACAGGTTGAGGGAGGATGG + Intergenic
981927502 4:150155888-150155910 ATGTAAAGCAGGAAGGAAGAAGG + Intronic
981927502 4:150155888-150155910 ATGTAAAGCAGGAAGGAAGAAGG + Intronic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
987138304 5:14920165-14920187 TTGTAAAGTTAAAGGGAAGAGGG + Intergenic
987138304 5:14920165-14920187 TTGTAAAGTTAAAGGGAAGAGGG + Intergenic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
988827683 5:34955431-34955453 CTGTAAAGTATGACGGAACAAGG + Exonic
988827683 5:34955431-34955453 CTGTAAAGTATGACGGAACAAGG + Exonic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
994735861 5:103555080-103555102 CTGTTAAGATTGGGGGAAGAAGG - Intronic
994735861 5:103555080-103555102 CTGTTAAGATTGGGGGAAGAAGG - Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996990961 5:129630634-129630656 CTATAAAACTTCAGGGAAAAAGG + Intronic
996990961 5:129630634-129630656 CTATAAAACTTCAGGGAAAAAGG + Intronic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
998041827 5:138955393-138955415 CTGTAAATCTTGCAGGGAGATGG + Intronic
998041827 5:138955393-138955415 CTGTAAATCTTGCAGGGAGATGG + Intronic
998264839 5:140660048-140660070 CTGTAAAGCTTCAGCCAGGAGGG - Intronic
998264839 5:140660048-140660070 CTGTAAAGCTTCAGCCAGGAGGG - Intronic
999517825 5:152318627-152318649 CTCTAAAGCTTGATGCATGATGG + Intergenic
999517825 5:152318627-152318649 CTCTAAAGCTTGATGCATGATGG + Intergenic
999617258 5:153437469-153437491 CTGGAATGCTTGAGGGTTGAAGG - Intergenic
999617258 5:153437469-153437491 CTGGAATGCTTGAGGGTTGAAGG - Intergenic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000413998 5:160964469-160964491 GTGGAGAGCTTGAGGGAATATGG - Intergenic
1000413998 5:160964469-160964491 GTGGAGAGCTTGAGGGAATATGG - Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003340032 6:5211688-5211710 CTGAAAAGCTGATGGGAAGATGG + Intronic
1003340032 6:5211688-5211710 CTGAAAAGCTGATGGGAAGATGG + Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003513700 6:6801932-6801954 CCCTCAAGCATGAGGGAAGAAGG + Intergenic
1003513700 6:6801932-6801954 CCCTCAAGCATGAGGGAAGAAGG + Intergenic
1003538566 6:6998020-6998042 CTGTAAAGGTCCAGGGAAGCAGG - Intergenic
1003538566 6:6998020-6998042 CTGTAAAGGTCCAGGGAAGCAGG - Intergenic
1005991186 6:30903434-30903456 CAGTAAAGCCTGTGGGAAGTGGG + Intergenic
1005991186 6:30903434-30903456 CAGTAAAGCCTGTGGGAAGTGGG + Intergenic
1006731130 6:36236857-36236879 CTGTAAGGCTGGTTGGAAGAGGG + Intergenic
1006731130 6:36236857-36236879 CTGTAAGGCTGGTTGGAAGAGGG + Intergenic
1007959809 6:45948405-45948427 CTTTAGAGGTTGAGGGAAGTCGG - Intronic
1007959809 6:45948405-45948427 CTTTAGAGGTTGAGGGAAGTCGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1010041591 6:71391178-71391200 CTGTAAAGCCTAAGAAAAGAAGG + Intergenic
1010041591 6:71391178-71391200 CTGTAAAGCCTAAGAAAAGAAGG + Intergenic
1010284796 6:74063619-74063641 TAGTAAAGCTGTAGGGAAGAAGG + Intergenic
1010284796 6:74063619-74063641 TAGTAAAGCTGTAGGGAAGAAGG + Intergenic
1013088110 6:106874026-106874048 CTGAAAAGAGTGTGGGAAGAAGG - Intergenic
1013088110 6:106874026-106874048 CTGAAAAGAGTGTGGGAAGAAGG - Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1015173175 6:130277374-130277396 CTGTAAGGCTAGAAGCAAGATGG + Intronic
1015173175 6:130277374-130277396 CTGTAAGGCTAGAAGCAAGATGG + Intronic
1015843710 6:137497132-137497154 CTGAAAACCCTTAGGGAAGAAGG - Intergenic
1015843710 6:137497132-137497154 CTGAAAACCCTTAGGGAAGAAGG - Intergenic
1015886806 6:137926156-137926178 TGGTAAAGCTGGAGGGAAAAGGG + Intergenic
1015886806 6:137926156-137926178 TGGTAAAGCTGGAGGGAAAAGGG + Intergenic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1023369252 7:39496653-39496675 CTGTACAGAGTGAGGAAAGAAGG - Intergenic
1023369252 7:39496653-39496675 CTGTACAGAGTGAGGAAAGAAGG - Intergenic
1023675281 7:42622282-42622304 CTGTAAAGCAGGAGGAAATATGG + Intergenic
1023675281 7:42622282-42622304 CTGTAAAGCAGGAGGAAATATGG + Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1031149494 7:118036744-118036766 TTGTAGAGCTTGAGGGATAAAGG + Intergenic
1031149494 7:118036744-118036766 TTGTAGAGCTTGAGGGATAAAGG + Intergenic
1031342618 7:120622624-120622646 CTTTAAAGCCTGAGAGAAGATGG - Intronic
1031342618 7:120622624-120622646 CTTTAAAGCCTGAGAGAAGATGG - Intronic
1031577357 7:123431030-123431052 CTGGAAAACTTGAGAGCAGAAGG + Intergenic
1031577357 7:123431030-123431052 CTGGAAAACTTGAGAGCAGAAGG + Intergenic
1031838111 7:126703665-126703687 CTTGAAAGATTGAGGCAAGAGGG - Intronic
1031838111 7:126703665-126703687 CTTGAAAGATTGAGGCAAGAGGG - Intronic
1032878331 7:136062064-136062086 GTGAAAAGCTTGAGGGAAGTAGG - Intergenic
1032878331 7:136062064-136062086 GTGAAAAGCTTGAGGGAAGTAGG - Intergenic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1035876668 8:3196991-3197013 TTGGAAAGCATGAGAGAAGAAGG - Intronic
1035876668 8:3196991-3197013 TTGGAAAGCATGAGAGAAGAAGG - Intronic
1036018995 8:4820935-4820957 AAGTAAAGCTTGAGGAAAGATGG - Intronic
1036018995 8:4820935-4820957 AAGTAAAGCTTGAGGAAAGATGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1039219907 8:35319012-35319034 TTCTAAAGACTGAGGGAAGAAGG - Intronic
1039219907 8:35319012-35319034 TTCTAAAGACTGAGGGAAGAAGG - Intronic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1039959904 8:42238298-42238320 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1039959904 8:42238298-42238320 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1040424598 8:47272992-47273014 GTGTTAAGCATGAGAGAAGAGGG - Intronic
1040424598 8:47272992-47273014 GTGTTAAGCATGAGAGAAGAGGG - Intronic
1041836642 8:62223720-62223742 CTGTAAAGCTTGGTGGAGGGAGG + Intergenic
1041836642 8:62223720-62223742 CTGTAAAGCTTGGTGGAGGGAGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042351321 8:67780569-67780591 CTGGTAGGCCTGAGGGAAGAAGG - Intergenic
1042351321 8:67780569-67780591 CTGGTAGGCCTGAGGGAAGAAGG - Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1043494347 8:80783659-80783681 TTGTACAGGTTGAGGGAAGGGGG - Intronic
1043494347 8:80783659-80783681 TTGTACAGGTTGAGGGAAGGGGG - Intronic
1043947049 8:86265083-86265105 CTGTGAAGCTAGAAGCAAGATGG + Intronic
1043947049 8:86265083-86265105 CTGTGAAGCTAGAAGCAAGATGG + Intronic
1045410113 8:101908778-101908800 CTTTACAGCTTGAGGGATAAAGG - Intronic
1045410113 8:101908778-101908800 CTTTACAGCTTGAGGGATAAAGG - Intronic
1045646781 8:104307180-104307202 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1045646781 8:104307180-104307202 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1045649353 8:104327969-104327991 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1045649353 8:104327969-104327991 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1045726327 8:105178037-105178059 GCGCAAAGCCTGAGGGAAGAGGG + Intronic
1045726327 8:105178037-105178059 GCGCAAAGCCTGAGGGAAGAGGG + Intronic
1045775836 8:105801605-105801627 CTCTGAAGCTTGAGGGACCATGG - Exonic
1045775836 8:105801605-105801627 CTCTGAAGCTTGAGGGACCATGG - Exonic
1046343568 8:112891512-112891534 CTATGAAGCTTGAAGGGAGAGGG + Intronic
1046343568 8:112891512-112891534 CTATGAAGCTTGAAGGGAGAGGG + Intronic
1046516472 8:115268437-115268459 TTTTGAAGCTTGAGGAAAGACGG + Intergenic
1046516472 8:115268437-115268459 TTTTGAAGCTTGAGGAAAGACGG + Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1047265998 8:123309798-123309820 CTGTAAAGTTTCTGGGAAGATGG - Intergenic
1047265998 8:123309798-123309820 CTGTAAAGTTTCTGGGAAGATGG - Intergenic
1047682121 8:127264896-127264918 CAGCAAAGCTTGAAGCAAGAAGG - Intergenic
1047682121 8:127264896-127264918 CAGCAAAGCTTGAAGCAAGAAGG - Intergenic
1048394167 8:133997701-133997723 CTATAGAGGTTGAGGGAAGGGGG - Intergenic
1048394167 8:133997701-133997723 CTATAGAGGTTGAGGGAAGGGGG - Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG + Intronic
1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG + Intronic
1051786917 9:20755117-20755139 CTGAAAAGCTTGAGGGAAAAGGG - Intronic
1051786917 9:20755117-20755139 CTGAAAAGCTTGAGGGAAAAGGG - Intronic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1052729170 9:32265119-32265141 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1052729170 9:32265119-32265141 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1055191194 9:73527028-73527050 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1055191194 9:73527028-73527050 CTGTAAGGCTAGAAGCAAGATGG - Intergenic
1055468146 9:76585620-76585642 CTGTGAGGCTTGAAGCAAGATGG + Intergenic
1055468146 9:76585620-76585642 CTGTGAGGCTTGAAGCAAGATGG + Intergenic
1055627747 9:78191883-78191905 GAGTTAAGCTTGAGGGAACATGG + Intergenic
1055627747 9:78191883-78191905 GAGTTAAGCTTGAGGGAACATGG + Intergenic
1056343984 9:85671779-85671801 CTGAGAAGCTAGAGAGAAGAGGG - Intronic
1056343984 9:85671779-85671801 CTGAGAAGCTAGAGAGAAGAGGG - Intronic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057211085 9:93201487-93201509 CTGTAGAGCTTGTGGGAGCAGGG + Intronic
1057211085 9:93201487-93201509 CTGTAGAGCTTGTGGGAGCAGGG + Intronic
1060218525 9:121752524-121752546 CAGGAAGGCTTCAGGGAAGAAGG + Intronic
1060218525 9:121752524-121752546 CAGGAAGGCTTCAGGGAAGAAGG + Intronic
1061356668 9:130110754-130110776 CTGTGAAGCTTGCGGGAAAGCGG + Intronic
1061356668 9:130110754-130110776 CTGTGAAGCTTGCGGGAAAGCGG + Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186450126 X:9665407-9665429 CTGTGAAGCTAGAGACAAGATGG - Intronic
1186450126 X:9665407-9665429 CTGTGAAGCTAGAGACAAGATGG - Intronic
1186709108 X:12174009-12174031 CTCTAAAGGTTGAGGGAGAAGGG - Intronic
1186709108 X:12174009-12174031 CTCTAAAGGTTGAGGGAGAAGGG - Intronic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1195050885 X:101095867-101095889 CTGTTACGGTTGAGGGAACAGGG + Exonic
1195050885 X:101095867-101095889 CTGTTACGGTTGAGGGAACAGGG + Exonic
1197411437 X:126120906-126120928 TTGTACAGCTTGAGGGCTGAGGG - Intergenic
1197411437 X:126120906-126120928 TTGTACAGCTTGAGGGCTGAGGG - Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic