ID: 1008906318

View in Genome Browser
Species Human (GRCh38)
Location 6:56681267-56681289
Sequence CTGTGTTACCAATTGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008906318 Original CRISPR CTGTGTTACCAATTGGATGT GGG (reversed) Intronic
905518605 1:38580366-38580388 CTGTGTTCCCAGTGGGACGTGGG - Intergenic
906300230 1:44676137-44676159 CTTGGTTACTAATTGGGTGTGGG + Intronic
907023462 1:51091765-51091787 TTGTGATACCACTTGGATCTGGG - Intergenic
909259908 1:73474367-73474389 CTGTGTTCCCAATGGGATCCTGG + Intergenic
909497931 1:76300309-76300331 CTGTGATAAGAAATGGATGTGGG + Intronic
910048946 1:82954663-82954685 CTGAGTGACCTGTTGGATGTGGG - Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
910781482 1:90940252-90940274 CTGGGTTATAAATTAGATGTTGG + Exonic
913565840 1:120071219-120071241 AGGTGTGACTAATTGGATGTGGG + Intergenic
913632291 1:120722334-120722356 AGGTGTGACTAATTGGATGTGGG - Intergenic
914286430 1:146230588-146230610 AGGTGTGACTAATTGGATGTGGG + Intergenic
914547461 1:148681330-148681352 AGGTGTGACTAATTGGATGTGGG + Intergenic
914619054 1:149389028-149389050 AGGTGTGACTAATTGGATGTGGG - Intergenic
916662062 1:166931727-166931749 CTTGGTGACCAATTGGATGAGGG + Intronic
917638837 1:176962447-176962469 CTGTGTTCAAAATTGTATGTTGG + Intronic
921160123 1:212466650-212466672 CCATGCTACCATTTGGATGTGGG - Intergenic
921774236 1:219078737-219078759 CTTTGTCACCACTTGGATCTTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063501111 10:6555504-6555526 CTGTGCTATCATTTGGATGGGGG + Intronic
1063904532 10:10768200-10768222 ATGTTTCACCAATTGGATGCAGG - Intergenic
1069319833 10:67155103-67155125 CTATGTTACCAGTAGGCTGTTGG + Intronic
1072848842 10:98863629-98863651 CTGTCTTACTAATTGCAGGTAGG - Intronic
1074275108 10:111993591-111993613 TTGTGTTGCTAATTGGATATGGG - Intergenic
1076442581 10:130490491-130490513 CTGTGTCACTAATTTGGTGTTGG + Intergenic
1078871340 11:15348022-15348044 CTGTGTTAGGAATTGGAAGCAGG + Intergenic
1079364650 11:19798772-19798794 TGGTGTTACCAAGTGGATGGTGG + Intronic
1080162392 11:29192565-29192587 CTGTGGTTCCAATGGGATGTGGG + Intergenic
1087007613 11:93484753-93484775 CTGAGGTACCAATTAGCTGTTGG + Intronic
1094509635 12:31088474-31088496 CTGTGTTCCCATTTGCATGGAGG + Intronic
1100400496 12:94225172-94225194 CTGACTTGCCAATTGGAAGTTGG + Intronic
1101008271 12:100424110-100424132 TTGTGTTACAAGTTGAATGTGGG + Intergenic
1101287980 12:103336009-103336031 CTCAGTACCCAATTGGATGTTGG + Intronic
1103627483 12:122231082-122231104 CTGTGGGACCAGTTGGATGTTGG + Exonic
1109198176 13:59402253-59402275 GTGTATTACCAACTGGTTGTAGG + Intergenic
1109446183 13:62443996-62444018 CTGTGTTTCCATCTGGATATAGG + Intergenic
1110883330 13:80600755-80600777 CTGTGTTAGAAATTGAAGGTTGG + Intergenic
1113888542 13:113724625-113724647 CTGGGTTGCCATCTGGATGTGGG + Intronic
1114569163 14:23653807-23653829 CTGTCATACCAATGGGAGGTCGG + Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1129065282 15:72898185-72898207 CTGTGTTACCTTTTGAATGTAGG + Intergenic
1130687766 15:86053913-86053935 CTGTGTTACCAAGTGCATGGGGG + Intergenic
1133385610 16:5367788-5367810 CTGTGTTACTTTCTGGATGTGGG - Intergenic
1137695860 16:50461560-50461582 CTCTGTTACTAATTAGCTGTGGG + Intergenic
1138457424 16:57129378-57129400 CTGTGTGACCAAGTGAGTGTGGG + Intronic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1154111317 18:11570840-11570862 CTGTGTTACCAAGTGGTAGGTGG + Intergenic
1156068785 18:33178282-33178304 CTTAGTCACTAATTGGATGTGGG - Intronic
1158137146 18:54220603-54220625 CTGTGTGAACAATTGGGTGCAGG + Intronic
1158542745 18:58371582-58371604 CTGTGATACCAACTGTATTTTGG + Intronic
1159912671 18:74161379-74161401 CTTTGTGACCAAGTGCATGTGGG + Intergenic
1159972850 18:74675201-74675223 CTTTGTTAACATTTGGGTGTAGG + Intronic
1165147693 19:33742113-33742135 CTGTTTAACCAAATGGCTGTGGG + Intronic
1166058867 19:40312039-40312061 ATGTTTTACATATTGGATGTGGG - Intergenic
930297194 2:49569665-49569687 CTGTGGTAACATTTGGATGCAGG + Intergenic
930563491 2:52989875-52989897 TTGGGATACCAATTGAATGTGGG - Intergenic
930746845 2:54893371-54893393 CTGTGTTACCCAATGGCTGAAGG + Intronic
931116263 2:59170049-59170071 CTTTCTTACCAATTGGAGGAAGG + Intergenic
934614916 2:95764804-95764826 CTCTGTTACCAATGGGCTGTGGG + Intergenic
934645987 2:96059683-96059705 CTCTGTTACCAATGGGCTGTGGG - Intergenic
934839390 2:97615773-97615795 CTCTGTTACCAATGGGCTGTGGG - Intergenic
936635422 2:114250731-114250753 CTGTGTTAAGCATTGGATTTTGG + Intergenic
936932273 2:117802270-117802292 CTGGGTGACCAATTGGATATGGG - Intergenic
938015403 2:127863130-127863152 CTGTTGTACAAATTGGAGGTGGG + Exonic
939187809 2:138881117-138881139 CTTTCTTACCAATAGGATCTGGG + Intergenic
941910646 2:170761405-170761427 CTGGGTTATGAATTGGATATGGG + Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
946920350 2:224574534-224574556 CTGTGTTACCATTTGTATATGGG - Intronic
1174306601 20:49617837-49617859 CTGTGTCACCAAATGGCTCTTGG + Intergenic
1175276995 20:57778923-57778945 CTTTGTTATCAGTTGGATATTGG + Intergenic
1176702550 21:10073198-10073220 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1178234799 21:30829093-30829115 ATGTATTACAAATTGGGTGTGGG - Exonic
1178615250 21:34127390-34127412 GTGTGTGATCAATTAGATGTGGG + Intronic
1179029502 21:37708306-37708328 ATGTCTTAACAATTGGATTTTGG - Intronic
1180204168 21:46247088-46247110 CTTTGCTAACAATTGGATTTAGG - Intronic
950653712 3:14423729-14423751 CTGGGTTAGCAAGTGCATGTAGG + Intronic
951059754 3:18191469-18191491 ATGTGTTACCTAGTGGATTTGGG - Intronic
952214194 3:31259791-31259813 CTGGGTTACCATTTAGGTGTGGG - Intergenic
952589882 3:34938752-34938774 CTGTATTACAAATTGAGTGTGGG + Intergenic
955122954 3:56079820-56079842 CTGTGTTAAGAATAGGCTGTAGG + Intronic
960682763 3:120266276-120266298 CTGAGTTACAAATTGGAGATGGG - Intronic
961113588 3:124307841-124307863 CAGTGTTACTAACTGGATCTTGG - Intronic
962011164 3:131392291-131392313 GTTTGTTACCAATGGAATGTGGG - Intergenic
964627950 3:158776943-158776965 CTGTGTTACAGACTGGAAGTGGG + Intronic
964988963 3:162782391-162782413 CTTTGTTAACAATTGGAAGAAGG + Intergenic
968503149 4:960435-960457 ATGTGTCACCAATGGGATGAGGG + Exonic
972547754 4:40096750-40096772 TTGGCTTACCAGTTGGATGTGGG + Intronic
973539231 4:51919530-51919552 CTGTGTTACCAATTTCACATAGG - Intergenic
981466260 4:145075938-145075960 CTGTCTTACCCATGGGATGGGGG + Intronic
983550635 4:169013945-169013967 CTTTGTGACTGATTGGATGTGGG - Intergenic
985898237 5:2763395-2763417 CAGTGTTAGCAGTGGGATGTGGG - Intergenic
988855697 5:35226265-35226287 CTGTGTTAGCAAGTAGTTGTGGG + Intronic
993486157 5:88488531-88488553 CTTTGTAACCTATTGGATGGAGG + Intergenic
993595638 5:89851737-89851759 CTTTGTAACTAATAGGATGTGGG + Intergenic
999136668 5:149324945-149324967 CTGTGTAACCATTAGGATATTGG - Intronic
999444382 5:151627842-151627864 CTGTGTTACTCACTGGCTGTGGG - Intergenic
999639012 5:153652403-153652425 CTGTTTTACAAAGTTGATGTGGG - Intronic
1004808910 6:19238282-19238304 CTGTTGTACAAATTGTATGTTGG - Intergenic
1008906318 6:56681267-56681289 CTGTGTTACCAATTGGATGTGGG - Intronic
1010382048 6:75236613-75236635 CTGTGTTAGAAATTGGTTCTGGG - Intergenic
1013312821 6:108913324-108913346 CTGTGTTAAAAATTAGATTTAGG + Intronic
1013371373 6:109473614-109473636 CTGTCTTCCCTATTGAATGTTGG + Intronic
1013673802 6:112434737-112434759 CTTTTTAACAAATTGGATGTAGG - Intergenic
1015733901 6:136377029-136377051 CTTTCTTACCAACTGGATGTAGG + Intronic
1016139541 6:140592078-140592100 CTGTCTTACCTATTGACTGTAGG - Intergenic
1018546382 6:164941322-164941344 TTGTTTTCCCTATTGGATGTTGG - Intergenic
1024719304 7:52117331-52117353 CTTTGTGATCAATTTGATGTAGG - Intergenic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1031356871 7:120797733-120797755 CTGGGTTATAAATTGGCTGTGGG - Intronic
1032552416 7:132796898-132796920 CTTTGTGACCAAGTGGATATGGG - Intronic
1032904963 7:136353955-136353977 TTGTGTTATCAATTGGATATAGG - Intergenic
1040440021 8:47431358-47431380 GTGTGTTACAGATTGAATGTTGG - Intronic
1041372657 8:57179173-57179195 CTGAATTACCAACTGGATGATGG - Intergenic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1042157087 8:65855964-65855986 CTTTGTAACTGATTGGATGTGGG - Intergenic
1042736158 8:71991935-71991957 ATTTGTGACCAGTTGGATGTGGG - Intronic
1045287268 8:100803096-100803118 CTGACTTACCATTGGGATGTTGG + Intergenic
1046155840 8:110289201-110289223 CTGTATCAGCCATTGGATGTGGG - Intergenic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1048924708 8:139261143-139261165 CTGTGTTACACATTGGAACTTGG - Intergenic
1051628004 9:19116551-19116573 CTGTGGTACACCTTGGATGTTGG + Exonic
1053639750 9:40059992-40060014 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1053766383 9:41405489-41405511 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1054320498 9:63656296-63656318 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1054544999 9:66316648-66316670 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1055826041 9:80325982-80326004 CTGTGTTACCAATGGGAAGTGGG - Intergenic
1055953933 9:81756554-81756576 CTCTGCTGCCATTTGGATGTGGG + Intergenic
1202787568 9_KI270719v1_random:43306-43328 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1185829829 X:3290156-3290178 CTGTTTTATCAATTGGTTATTGG + Intergenic
1186186072 X:7020885-7020907 GTCTATTAGCAATTGGATGTGGG + Intergenic
1188465304 X:30472818-30472840 CTGTGTTATGAATAGGAAGTGGG - Intergenic
1189460823 X:41241482-41241504 TTTTGTTACAAATTCGATGTGGG + Intergenic
1189474812 X:41343117-41343139 CTGAGTTACCAATCAGCTGTTGG + Intronic
1190512982 X:51192942-51192964 CTGTGTTACCAATAGGAGTGGGG - Intergenic
1195530392 X:105947587-105947609 CTGTGTCTCAAATTTGATGTTGG + Intronic
1195881711 X:109599949-109599971 CAGTGTTAACAGTTTGATGTGGG - Intergenic
1197215740 X:123865327-123865349 CTTTGTTTCCAATTAGCTGTGGG + Intronic
1199654014 X:149976671-149976693 CAGTATTACCATTTGGGTGTAGG - Intergenic
1200275612 X:154729558-154729580 CTGGGTCACCAAATGCATGTGGG + Intronic
1201248182 Y:12027809-12027831 CTGTATTATCAATTGGTTGTTGG - Intergenic