ID: 1008907920

View in Genome Browser
Species Human (GRCh38)
Location 6:56699993-56700015
Sequence TCCCTATGGTATAGGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008907920_1008907931 13 Left 1008907920 6:56699993-56700015 CCCCCAAACCTATACCATAGGGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1008907931 6:56700029-56700051 CAGCAGGTTAGCAGCGGCCCAGG No data
1008907920_1008907927 -10 Left 1008907920 6:56699993-56700015 CCCCCAAACCTATACCATAGGGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1008907927 6:56700006-56700028 ACCATAGGGACTGGGCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 131
1008907920_1008907929 -3 Left 1008907920 6:56699993-56700015 CCCCCAAACCTATACCATAGGGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1008907929 6:56700013-56700035 GGACTGGGCTGCATGGCAGCAGG 0: 1
1: 0
2: 1
3: 86
4: 564
1008907920_1008907930 7 Left 1008907920 6:56699993-56700015 CCCCCAAACCTATACCATAGGGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1008907930 6:56700023-56700045 GCATGGCAGCAGGTTAGCAGCGG 0: 1
1: 0
2: 7
3: 38
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008907920 Original CRISPR TCCCTATGGTATAGGTTTGG GGG (reversed) Intronic
904775979 1:32906813-32906835 ACCCTGTGGTTTAGGCTTGGTGG - Intergenic
906180555 1:43814805-43814827 TCCCTGTGGTCTAGGTCTGGGGG + Intronic
910637496 1:89425339-89425361 TCCCTATGTTATGGCTATGGTGG - Intergenic
910922818 1:92367714-92367736 TCTCTATGGTTTGGGGTTGGAGG - Intronic
914861580 1:151390716-151390738 TCTCTATGTTATAGGTTTATTGG + Intergenic
915010513 1:152681654-152681676 TCCCTGAGGTATAGGTTGAGTGG - Intergenic
916654557 1:166862510-166862532 CCCCTGTGGTATAGTTTTGGTGG - Intronic
918967596 1:191372133-191372155 TCCTGGTGGTAAAGGTTTGGGGG + Intergenic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1069182500 10:65379366-65379388 TCCCTATAGTATTGTGTTGGTGG + Intergenic
1071156426 10:82694339-82694361 TCAAAATGATATAGGTTTGGGGG + Intronic
1071911191 10:90235734-90235756 TCCCTATTGTGCAGATTTGGTGG + Intergenic
1081646986 11:44796938-44796960 TTCCTATGGTATTGGCTTTGAGG + Intronic
1081804451 11:45882867-45882889 TCCCTAAGGTACAGGTTGGCAGG + Exonic
1082617051 11:55373514-55373536 TCCCACTGGCATAGGTTTTGAGG - Intergenic
1082660485 11:55903818-55903840 TGCCTATGTTGTAGGTTTGGTGG - Intergenic
1085756103 11:79202569-79202591 TCCCTGTGGTGTTTGTTTGGCGG + Intronic
1088121544 11:106376145-106376167 TCCCTTTGGTGAAGGTTTGATGG - Intergenic
1088810064 11:113386200-113386222 TCCCTCTGACATATGTTTGGGGG + Intergenic
1102888521 12:116539716-116539738 TACCTATGGTATTGGGTTGTTGG - Intergenic
1110768519 13:79307751-79307773 TCCCTATGTTATGGCTATGGTGG - Intergenic
1114139412 14:19894028-19894050 TCTCTATGGGAGTGGTTTGGGGG + Intergenic
1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG + Intronic
1115897314 14:38104809-38104831 TGCCTAGGGTATAGGTTATGAGG - Intergenic
1116641630 14:47470724-47470746 TCCCTGTGGGATAGGTTTAATGG + Intronic
1118933876 14:70267929-70267951 TCCCTATGTTATAGTTTTATAGG - Intergenic
1120701572 14:87704601-87704623 TCCCTGGGGCATATGTTTGGTGG - Intergenic
1133615012 16:7468238-7468260 TCCCAATGGTAAAGGTCGGGCGG - Intronic
1135382253 16:22004923-22004945 TCCCTAGGGGTTAGGTTTCGTGG - Intergenic
1140861570 16:79022944-79022966 TACCTATGGCATAGGGTTTGGGG + Intronic
1141788660 16:86218243-86218265 AGCCTAGGGTATAGGTCTGGGGG - Intergenic
1155506364 18:26537364-26537386 TCCTTATGGAATAGGTTTTTGGG - Intronic
1158077594 18:53548621-53548643 GCCCGAATGTATAGGTTTGGAGG - Intergenic
1165108218 19:33486781-33486803 TCCCAAGGGTATAGGCTGGGTGG + Intronic
1166908352 19:46132244-46132266 TCCCTGTGGCATAGCTGTGGGGG + Intergenic
1167655619 19:50762061-50762083 TTCCTATTTTATAGATTTGGGGG - Intergenic
1167701761 19:51052281-51052303 TCCCAAGAGTATTGGTTTGGGGG - Intergenic
931826529 2:66006216-66006238 TCCCTCTTGAATGGGTTTGGGGG - Intergenic
936661676 2:114549979-114550001 TCCCTAAGTTTTAGGTTTGGGGG - Intronic
938553918 2:132406236-132406258 TCCCCATTGTATATTTTTGGTGG + Intergenic
941704325 2:168641617-168641639 TCTCTATTGTATAGGTTGGAAGG + Intronic
944367074 2:198934311-198934333 TCCCTATATTATAGTTATGGGGG + Intergenic
944612192 2:201422220-201422242 CCCATACGGTATTGGTTTGGGGG + Intronic
946197258 2:218041655-218041677 TCCCTATTATATAAGTTTGTTGG + Intronic
948802533 2:240439377-240439399 GCCCTAAGGTCTAGTTTTGGGGG + Intronic
1169259196 20:4123042-4123064 TTCCTATGGTGCAGGTCTGGGGG - Intronic
1170281728 20:14656508-14656530 TCTCTATGATATAGGTTAGCTGG + Intronic
1171346885 20:24471746-24471768 TACCTTTGGTAGAGTTTTGGAGG + Intronic
1180579577 22:16818989-16819011 TCCCTATGCTACAGGTCAGGAGG + Intronic
1183414174 22:37673211-37673233 TTCCTATGGTTGAGGTTTTGGGG + Intergenic
951899782 3:27645511-27645533 TTCTTAGGGTATAGTTTTGGGGG + Intergenic
957996509 3:87696722-87696744 TCCCTATGTTATGGCTATGGTGG + Intergenic
958009053 3:87851726-87851748 TTGCTATGGTATAGGTTTACAGG + Intergenic
958216396 3:90585424-90585446 TTCCTAGTGTATAGTTTTGGCGG - Intergenic
961733195 3:128982895-128982917 TCACTATTGTAAATGTTTGGAGG - Intronic
963008267 3:140746671-140746693 TCCTTATCTTATAGTTTTGGAGG + Intergenic
964691075 3:159450707-159450729 TTCCTATAGGATGGGTTTGGGGG - Intronic
967771968 3:193344047-193344069 TTGCTTTGGTGTAGGTTTGGAGG - Exonic
972422246 4:38899376-38899398 TCACTATAGTATAGTCTTGGTGG + Intronic
976208947 4:82648192-82648214 TCCCTCTGGGAGATGTTTGGGGG + Intronic
981817873 4:148851743-148851765 TACTTATGGTATAGGGATGGTGG + Intergenic
986854987 5:11858000-11858022 TCCTTATGGCATATGTTTGGAGG + Intronic
987994707 5:25261779-25261801 TCCCTGAGGTTTACGTTTGGAGG - Intergenic
989533085 5:42530848-42530870 TCTCTTTGGAATAGGTTTGTGGG + Intronic
990344517 5:54858350-54858372 TCCCTCTGGTATGAGTTTGCAGG - Intergenic
996598970 5:125239067-125239089 TACCTATGGTATTAGTTTGCTGG + Intergenic
996855008 5:127995880-127995902 TCAGTATGGCATAGCTTTGGGGG - Intergenic
999101644 5:149030245-149030267 TCCCTATGGTATACGCCTTGGGG + Intronic
999414238 5:151380974-151380996 CCCCTCTGTTATAGGGTTGGAGG - Intergenic
1002965880 6:1966149-1966171 TAACTATGGTTTAGTTTTGGGGG - Intronic
1008907920 6:56699993-56700015 TCCCTATGGTATAGGTTTGGGGG - Intronic
1009222118 6:60995126-60995148 TTCTTAATGTATAGGTTTGGAGG + Intergenic
1010528063 6:76927737-76927759 TACCAAAAGTATAGGTTTGGAGG - Intergenic
1013373012 6:109486545-109486567 TTCCTATGGTATGGGTTTGTTGG - Intergenic
1023284610 7:38606137-38606159 TCCCCATGCTTTAGGTTTTGGGG + Intronic
1027170346 7:75867175-75867197 TCCCTGTGGCATAAGTTTCGGGG - Intronic
1033474813 7:141681759-141681781 TCCTGCTGGTATAGATTTGGAGG - Intronic
1036478396 8:9116070-9116092 CCCCTAATGTAAAGGTTTGGGGG - Intronic
1037264385 8:17041922-17041944 TAACTATGATAGAGGTTTGGGGG + Intronic
1037496471 8:19445848-19445870 TCCATATGTTTTTGGTTTGGAGG + Intronic
1038361978 8:26888990-26889012 TTCCTTTAGTATAGGTTTGCTGG + Intergenic
1039674439 8:39645340-39645362 TCCAGATGCAATAGGTTTGGAGG + Exonic
1040514880 8:48126483-48126505 TCCCTCTGGAATTGGTTGGGAGG + Intergenic
1041004115 8:53482953-53482975 TCCCTATGTTATGGCTATGGTGG - Intergenic
1044468798 8:92540852-92540874 TCCCTTTGGAAAAGTTTTGGAGG - Intergenic
1045512385 8:102822255-102822277 TCACTATGGTAAAGGGTTGTTGG + Intergenic
1047991619 8:130292407-130292429 TCCCTCTGGGATGGGATTGGGGG - Intronic
1050445225 9:5714812-5714834 TAGCTATGGGACAGGTTTGGGGG + Intronic
1050651943 9:7785873-7785895 TCCCTATGTTATGGCTATGGTGG + Intergenic
1050652862 9:7791779-7791801 TCCCTATGCTATGGCTATGGTGG + Intergenic
1057013683 9:91631713-91631735 GCCCAATGGTATACGTTTGGAGG - Intronic
1057781402 9:98053766-98053788 TCACTATGCTATAGCTGTGGGGG + Intergenic
1059772859 9:117444154-117444176 TGCCAATGGTACAGATTTGGGGG - Intergenic
1186520713 X:10204378-10204400 TTCCAATGATATATGTTTGGGGG - Intronic
1186648138 X:11529237-11529259 TCCCTATAGTTTAGGCTTTGTGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1192019819 X:67376278-67376300 TCTCTAAGCAATAGGTTTGGTGG - Intergenic
1193463901 X:81823827-81823849 CCCCCATGGTATAGATTTGGTGG + Intergenic
1195493541 X:105502640-105502662 TTCCTATGAAAAAGGTTTGGGGG - Intronic
1198735312 X:139778277-139778299 TTCTTATAGGATAGGTTTGGTGG - Intronic
1200786805 Y:7267773-7267795 TGTCTGTGGTATAGGTTTGAGGG - Intergenic
1201471999 Y:14344075-14344097 TGCCTAGGGTATAGGTTATGAGG + Intergenic