ID: 1008908179

View in Genome Browser
Species Human (GRCh38)
Location 6:56703643-56703665
Sequence GAGGATGAGGATAAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 773}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008908179 Original CRISPR GAGGATGAGGATAAGGGGGT AGG (reversed) Intronic
901105382 1:6751857-6751879 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901286118 1:8080188-8080210 GAGGATGGGAATTAGGGAGTAGG + Intergenic
901475313 1:9485394-9485416 GAGGAAGAGGAGAAGGGAGTGGG - Intergenic
901777084 1:11567502-11567524 GGGGATAAGGACATGGGGGTTGG - Intergenic
901777096 1:11567543-11567565 GTGGATAAGGACATGGGGGTTGG - Intergenic
901841777 1:11958205-11958227 GAGGATGAGGTTCATGGGATGGG - Intronic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
901881358 1:12195691-12195713 GAGGAGGAGGACAAGGGAGGGGG + Intronic
902385337 1:16072873-16072895 GGGGAGGAGGATTAGGGGGCAGG + Intronic
902607618 1:17577525-17577547 AAGGATGTGGACAAGGGAGTGGG - Intronic
902804170 1:18850554-18850576 GAGGATGAGGATCAGGATGGCGG + Intronic
902809572 1:18880458-18880480 GGGGATGTGGAGAAGGGGGCAGG - Intronic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
903447798 1:23433420-23433442 GAGGATGAGGAAGAGAAGGTGGG - Exonic
903499589 1:23793938-23793960 GAGGATGTGGAGGAGGGGCTGGG - Intronic
903542928 1:24107060-24107082 GAGGCGGCGGGTAAGGGGGTGGG - Exonic
903760310 1:25693282-25693304 GAGGAGGAGGAAGTGGGGGTTGG + Intronic
903769745 1:25756414-25756436 GAGGGTGAGCATGTGGGGGTGGG + Intronic
903883018 1:26524860-26524882 CAGGATGAGGGTCAGGGGATGGG - Intergenic
904007953 1:27373667-27373689 GAGGATTAGGAGAAGGGCCTGGG - Intronic
904007974 1:27373739-27373761 GAGGATTAGGAGAAGGGCCTGGG - Intronic
904079105 1:27860948-27860970 GAGGTCGGGGATAAGGGGTTGGG - Intergenic
904224562 1:29005228-29005250 GAGCAGGAGGAAGAGGGGGTGGG + Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905866859 1:41381469-41381491 GAGGATGAGGTAAGGGGGTTGGG - Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906439399 1:45827932-45827954 GAGGCTGAGGAGAAGCGGGGAGG - Intronic
906677223 1:47701908-47701930 GAGGCTGGGGATCAGGGAGTAGG - Intergenic
906807713 1:48795392-48795414 GGGGTTGAGGAAAAGGGGGAGGG - Intronic
907805157 1:57811391-57811413 GAGGAAGAGGAGATGGGCGTAGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908474130 1:64471391-64471413 GAGGACGCGGTCAAGGGGGTGGG - Intronic
908692583 1:66799439-66799461 GAGGGTGAGGGTGAGGGGGATGG + Intronic
910604069 1:89064175-89064197 GGAGAGGAGGATAAGGGGCTGGG + Intronic
910636011 1:89408737-89408759 GAGGAGGAGGAGAAGGGGCTGGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911015393 1:93326453-93326475 GAGAATGAGGATGAGGGAGGAGG + Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911711957 1:101083925-101083947 GAGGAGGGGGTTAAGTGGGTTGG + Intergenic
912010916 1:104961201-104961223 GAGGATGTTGATAATGGGGAAGG + Intergenic
912502358 1:110130626-110130648 GAAGATGAGGAAATGGGGGTGGG + Intergenic
912562107 1:110558339-110558361 GAGGCTGAGGACAAGGGCGAAGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
913458208 1:119055721-119055743 GAGGAGGAGGAGAAGAGGGAGGG + Intronic
914058050 1:144183173-144183195 GAGGAGGAGGAGGAGGGGGAAGG - Intergenic
914979257 1:152398416-152398438 GGGGATGAGGGTGAGGGTGTGGG - Intergenic
915149208 1:153816366-153816388 GAGCAGGAGGTTTAGGGGGTGGG + Exonic
915313876 1:155017497-155017519 GGGGAGGAGGAGAAGAGGGTAGG - Exonic
915524690 1:156468400-156468422 GAGGATGAGAATATGGGGGATGG + Intronic
915916756 1:159945200-159945222 GAGGATGGGGAGAAGTGGCTGGG - Intronic
916683947 1:167127757-167127779 GAAGATGAGGATGATGGTGTGGG + Exonic
917013994 1:170508771-170508793 GGGGAGAAGGGTAAGGGGGTGGG - Intergenic
917476518 1:175373790-175373812 AAGGCTGGGGATAAGGGGGCTGG - Intronic
918625949 1:186656164-186656186 GAGCATGAGGCAAAGAGGGTTGG - Intergenic
919331597 1:196179262-196179284 GAGGATGAGGAGTAAGGGGAAGG - Intergenic
919910160 1:202106314-202106336 GAGCAGGAGGATCGGGGGGTGGG + Intergenic
920035250 1:203061090-203061112 GAGGATGAGGGGAAGGCTGTGGG + Intronic
920388849 1:205586349-205586371 GAGGATGACGAGGAAGGGGTGGG + Intronic
920460571 1:206136454-206136476 AAGGGTGAGGCTAAGGGGGAAGG + Intergenic
921220242 1:212968591-212968613 GAGGAGGATGACAAGAGGGTTGG - Intronic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922122969 1:222692183-222692205 GAGGATGCGGAGAAGGGGAGAGG + Intronic
922241005 1:223755524-223755546 GAGGATGAGGACGAGGAGGATGG + Exonic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923482455 1:234397473-234397495 GAGGATGGGGAAGAGGGGGAGGG + Intronic
923534429 1:234838174-234838196 GAGGAGGAGGAGGAGGGGGGCGG + Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924226307 1:241924571-241924593 GAGGAAGAGGAAGGGGGGGTTGG - Intergenic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
1062957454 10:1549689-1549711 GAGGATGGGGACAATGGGTTTGG - Intronic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063499020 10:6536595-6536617 GAGGAAGAGGAGAAGGGGAGCGG - Intronic
1064142364 10:12801144-12801166 GAAGAGGGGGATAAGGGTGTGGG + Intronic
1064243255 10:13649434-13649456 GAGGATCTGGATGATGGGGTGGG + Intronic
1064707916 10:18091764-18091786 GAGGATGATGAAAAGGGGAATGG + Intergenic
1065689546 10:28319171-28319193 GAGGAAGAGGGTGAAGGGGTAGG + Intronic
1066995051 10:42555544-42555566 GACCCTGAGGATTAGGGGGTTGG + Intergenic
1067731095 10:48812029-48812051 GTGGTTGAGGATGAGGGGCTGGG - Intronic
1068509258 10:57943196-57943218 GAGGAACAGGACTAGGGGGTGGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068878384 10:62022354-62022376 CAGGAGGAAGATAAGGGGGAAGG + Intronic
1068912891 10:62397512-62397534 GAAGATCAGGATCAGGGGGATGG + Intronic
1068932956 10:62610422-62610444 GAGGAGGAGGAGAAGGGGCTGGG - Intronic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1069276408 10:66596150-66596172 TAGGAACAGGGTAAGGGGGTAGG + Intronic
1069312275 10:67052655-67052677 GAGGATGAGGAGAAAGGAGGAGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1070412871 10:76160085-76160107 GGGGATGTTGATAAGGGGGGAGG + Intronic
1070506555 10:77118468-77118490 GAGGATGAGGTTAAGAGGGTAGG - Intronic
1070577388 10:77689517-77689539 GATGATGATGATAGGGGGTTTGG - Intergenic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1071067757 10:81656445-81656467 GAGGCTGGGGATATGGGGATGGG + Intergenic
1071400084 10:85260359-85260381 GAGTGGGAGGATAAGGGGGATGG + Intergenic
1071472358 10:85992600-85992622 GAGGATGAGGAGAGGTGGGGGGG + Intronic
1071495858 10:86167276-86167298 GAGGATGAGCATCAGGGAGAAGG + Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072801180 10:98393417-98393439 GAGAATGGGGAAAAGGTGGTGGG - Intronic
1072807126 10:98430622-98430644 GAGGATGAGGGCAAGCAGGTCGG + Exonic
1073043305 10:100621774-100621796 GCGGAGGAGGGGAAGGGGGTGGG + Intergenic
1073096585 10:100983832-100983854 GAGGGTGATGATGAGGGGGCTGG + Exonic
1074217726 10:111403897-111403919 GAGGAAGAGAAAGAGGGGGTGGG - Intergenic
1074359339 10:112812701-112812723 GAGGAAGAGTAGAAGGGGATGGG - Intronic
1074597188 10:114878376-114878398 GAGGCTGAGGATAAGAGGAGTGG + Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075161664 10:120029648-120029670 GAGGAGGAGGGGAAGGGGGAAGG + Intergenic
1075513514 10:123091507-123091529 TAGGATGAAGATAAGGGAATTGG - Intergenic
1076082092 10:127591443-127591465 GAGGATGTTGATAATGGGGAGGG + Intergenic
1077299942 11:1842209-1842231 GAGCAGGAGGATCTGGGGGTGGG - Intergenic
1077822685 11:5765241-5765263 GATGATCAGGATAAGGATGTTGG - Intronic
1078134170 11:8638565-8638587 GAGGAGGAGGATAGGGTGGGGGG - Intronic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1079091554 11:17484211-17484233 GGGGATTAGGATTCGGGGGTGGG - Intergenic
1079112763 11:17614148-17614170 GAGGATGCCCATATGGGGGTGGG - Intronic
1079324313 11:19478382-19478404 GAGGATGAGGTGAGGGGAGTTGG + Intronic
1079661394 11:23041315-23041337 GAGGATGAGGAAGTGGGGCTTGG - Intergenic
1080176166 11:29365399-29365421 GAGATGGAGGATAATGGGGTGGG - Intergenic
1080649216 11:34209583-34209605 GAGGATGGGGGTGAGGGGGAGGG + Intronic
1081536407 11:43999707-43999729 GAGAATGAATATCAGGGGGTGGG + Intergenic
1081581404 11:44354809-44354831 AAAGATGAGGATACGGGGGTGGG - Intergenic
1081599557 11:44483900-44483922 AGGGATGAGGATGAAGGGGTGGG - Intergenic
1081613391 11:44576840-44576862 GAGGATGAGGATGACAGGGCAGG + Intronic
1081732255 11:45379883-45379905 GAGGAGGAGGATAAGGATGCAGG - Intergenic
1081758389 11:45560479-45560501 GGGGATGGCGATGAGGGGGTGGG - Intergenic
1082762064 11:57136792-57136814 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1082795698 11:57376554-57376576 GAGGATGGGGACAGGGGTGTGGG - Intergenic
1082995201 11:59248691-59248713 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083002104 11:59301981-59302003 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083540167 11:63506805-63506827 GAGGATGAGGGTGTGGGGGTAGG + Intronic
1083571962 11:63765836-63765858 GAGGAGGAGGAGGAGGGGGCCGG - Exonic
1083823897 11:65187562-65187584 GAGGATGAGGGTATGGGAGGCGG + Intronic
1083831802 11:65238270-65238292 GAGGATGAGGGTATGGGAGGCGG + Intergenic
1083843484 11:65317397-65317419 GAGGGTGGGGGTGAGGGGGTTGG - Intronic
1084145211 11:67261606-67261628 GAGGATGAGGATGAGGGCGAGGG + Intergenic
1084596151 11:70118184-70118206 GAGGAGGGGGAAGAGGGGGTAGG - Intronic
1084760680 11:71268741-71268763 GAGGAGGAGGAGAAGGGAGGAGG + Intergenic
1086032342 11:82375347-82375369 GTGGATGAAGATATGGGGGAAGG - Intergenic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1088216954 11:107521521-107521543 TAGGATGAGAGTAAGGGAGTAGG - Intronic
1088649401 11:111944133-111944155 GAAGATGAGGAGATGAGGGTGGG - Intronic
1088720750 11:112589974-112589996 GACCATGAGGTGAAGGGGGTGGG + Intergenic
1089239965 11:117069118-117069140 GAGAAAGAAGATAAAGGGGTAGG + Intronic
1090733867 11:129594408-129594430 GGGCATGAAGAGAAGGGGGTTGG + Intergenic
1090762922 11:129853076-129853098 GAGGATGAAGATAAGCCAGTGGG - Intronic
1090919192 11:131193229-131193251 GAGAATGAGGGCAAGCGGGTTGG - Intergenic
1091740250 12:2956125-2956147 GAGGAGGAGAGTAAGGGTGTGGG - Intergenic
1092061948 12:5558160-5558182 CAGGAGGAAGATAAGGGGGACGG - Intronic
1092489136 12:8929381-8929403 CAGGCTGTGGATAAGGAGGTAGG - Intronic
1092867756 12:12778991-12779013 AAGGATGAGGCTTAAGGGGTAGG - Intronic
1093187977 12:16043366-16043388 GAAGAAGAGGACAAGGTGGTGGG - Intergenic
1093660543 12:21751452-21751474 GATGATGGGGATGAGGGTGTTGG + Intronic
1094484750 12:30915552-30915574 GAGGCTGGGGATTAGGGGTTGGG + Intergenic
1095162496 12:38934279-38934301 GAGGGGGAAGATAAGGGGTTAGG + Intergenic
1095514505 12:42991114-42991136 GAGTATCAGCATAAGGAGGTGGG - Intergenic
1096200229 12:49676152-49676174 GAGGAGGAGGAGAAGAGGTTGGG - Intronic
1096339379 12:50784531-50784553 GAGGATGAGGCAGAGAGGGTTGG + Intronic
1096522846 12:52193813-52193835 GAGGAGGAGGCTCAGGGGGCTGG + Intergenic
1097139414 12:56887354-56887376 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
1097697800 12:62791272-62791294 GAGGATGAGGAGGAGGGGCACGG + Intronic
1097941793 12:65316937-65316959 GAGGATGAGAAGATGGGGGTAGG + Intronic
1098009373 12:66034130-66034152 GAGGAGGAGGATACGGGGAGGGG + Intergenic
1098029120 12:66236220-66236242 GAGGATGAGGATGTGGATGTGGG + Intronic
1098728457 12:74000045-74000067 AAGGATGAGGATGGGGGAGTTGG + Intergenic
1099151879 12:79124617-79124639 GAGGATGATGATAATGGCGATGG - Intronic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102130868 12:110527863-110527885 AAGGATGAGGGCATGGGGGTGGG + Intronic
1102230253 12:111257261-111257283 GAGGAAGAGGAAAAGGGAGGAGG - Intronic
1102408798 12:112698918-112698940 GAGGAGGAGGAGAAGGGCGGGGG - Intronic
1102808101 12:115799714-115799736 GAGGAAGAGGAGGAGGGGGAGGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102982550 12:117253613-117253635 GAGCAAGGGGATAAGGGGGTCGG - Intronic
1103188530 12:118981405-118981427 GAGCCTGAGGAGGAGGGGGTTGG + Intergenic
1103265470 12:119626509-119626531 GAGGAGGAGGAGAAGGGAGAAGG + Intronic
1103411675 12:120716636-120716658 GAGGATGAGGAGGAGGGAGGTGG + Exonic
1103659275 12:122500707-122500729 GAGGAGGACGAAAATGGGGTCGG - Intergenic
1104264227 12:127216123-127216145 GATGATGATTATAAGGGGATAGG - Intergenic
1104316236 12:127704425-127704447 GAGGAAGAGGAGAAGGAGATTGG + Intergenic
1104956021 12:132466204-132466226 GAGGAAGAGGAGGAGGGGGACGG - Intergenic
1105596320 13:21842686-21842708 AAGGAAGAGGATAAGTGGTTGGG + Intergenic
1105675417 13:22666309-22666331 GAGGAGGAGGAAGAGGAGGTTGG - Intergenic
1106110255 13:26771001-26771023 AAGGATGTGGATAATGGGGGAGG + Intergenic
1106382544 13:29254132-29254154 CATGATGAGGATGAGAGGGTTGG + Intronic
1106413358 13:29526038-29526060 GAGGATGAGGCCAAGGGAGGAGG + Intronic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1107675994 13:42797225-42797247 AAGGGTGAGGATTAAGGGGTAGG + Intergenic
1107907393 13:45073936-45073958 GAGCAGGAGGAAAAGGGGGCGGG + Intergenic
1108207479 13:48105505-48105527 GAGGATGAGGAGACTGGAGTAGG + Intergenic
1108750102 13:53439832-53439854 GGGGAGGGGGATAAGGGGGGAGG - Intergenic
1108827507 13:54432575-54432597 CAGGATGTGGATAAGGGGAGGGG + Intergenic
1108929331 13:55795960-55795982 GAGGGTGGGGGTTAGGGGGTTGG - Intergenic
1109183882 13:59246818-59246840 GAGGATTAGGAGAAGAGGTTAGG + Intergenic
1109390940 13:61691918-61691940 GAGGATGTGGGTGAGGGTGTTGG + Intergenic
1109721801 13:66284505-66284527 GAGGATGAGGGCAGGGGGATAGG + Intergenic
1109840049 13:67908477-67908499 GATGATGAGGATAAAGAGGATGG + Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111691095 13:91564180-91564202 GAAGATGATGGTAAGGGGGCAGG - Intronic
1112877484 13:104062465-104062487 GTGGAAGAGGATGAGGGAGTAGG - Intergenic
1112908398 13:104452420-104452442 GAGGATGAGGAAAAGAGAATAGG + Intergenic
1112918767 13:104583797-104583819 GAGGATGAAGAGAAGTGAGTGGG + Intergenic
1113909687 13:113836269-113836291 GAGGAGGGGGAGAAGGGGGAGGG + Intronic
1114233103 14:20801555-20801577 GAGGATGAGGTTGAGGGAGGTGG + Exonic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115123457 14:29965410-29965432 GAGGAGGAAGACAACGGGGTTGG - Intronic
1117215323 14:53545601-53545623 GAAGATTAGGAAAAGGAGGTGGG + Intergenic
1118082245 14:62374244-62374266 GGAGATGAGGAGATGGGGGTTGG - Intergenic
1118139551 14:63064927-63064949 AAGGATTTGGATAAGGGTGTGGG + Intronic
1118153840 14:63218959-63218981 GAGGAAGAGTAGAAGAGGGTTGG + Intronic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118459559 14:65976053-65976075 GGGGAAGAGGAGAAGGGGGAAGG + Intronic
1118727192 14:68637473-68637495 GAGGATGAGAACAAGCTGGTAGG + Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1119123022 14:72097573-72097595 GAAGAGGAGGAGAAGGGGGCGGG + Intronic
1119218469 14:72887388-72887410 GAGGCTGAGGACCAGGTGGTGGG - Intronic
1119456988 14:74764096-74764118 GAGGATGAGTAAGAAGGGGTGGG - Exonic
1119576073 14:75723415-75723437 GAAGATGGGGATGAGGGGTTGGG + Intronic
1119618626 14:76114942-76114964 GAGGAAGAGGACAAGGGGAATGG + Intergenic
1119738539 14:76999354-76999376 GAGGAAGAGGATGAGGGTGGGGG - Intergenic
1119812191 14:77531475-77531497 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1119932012 14:78556907-78556929 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1119976403 14:79029094-79029116 GAGAATGAAAAGAAGGGGGTTGG + Intronic
1120057952 14:79947620-79947642 AAGCATGAGGATAAAGGGGCTGG - Intergenic
1120106424 14:80500772-80500794 TGGGGTGAGGAGAAGGGGGTGGG - Intronic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1121170975 14:91854403-91854425 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1121277333 14:92677271-92677293 GTGGCTGAGGCTAAGTGGGTGGG - Intronic
1121448916 14:93995675-93995697 GAGGATGATGAAAAGGGGTTGGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122113401 14:99516347-99516369 GAGGCTGAGGATCAGGGGCCAGG - Intronic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122414688 14:101543229-101543251 GACGAGGAGGAGATGGGGGTGGG + Intergenic
1122782668 14:104150200-104150222 GAGGAGGAGGAGGAGGGGGTGGG - Intronic
1123808835 15:23903069-23903091 GTGGAGGGGGATAAGGGGGGTGG - Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124356030 15:28995343-28995365 GAGGGTGTGCATATGGGGGTGGG - Intronic
1124432275 15:29617916-29617938 GAGGATGAGGAAAAGGGCTGTGG - Intergenic
1124816784 15:33001703-33001725 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125720693 15:41843803-41843825 GAGGATGAGGTTTGGGGGCTGGG + Exonic
1126411655 15:48378173-48378195 GATCAGGAGGATAAGGGGGAGGG + Intergenic
1127007663 15:54588630-54588652 GAGGAAGAGGGGAAGGGGGTAGG - Intronic
1127469836 15:59281004-59281026 GAGGATGAGGACAAGGGTCCTGG + Intronic
1127549822 15:60025906-60025928 AAGGGTGAGTATGAGGGGGTGGG + Intronic
1127972753 15:63974447-63974469 GAAGGTGAGGATAGGGGGTTGGG + Intronic
1128355610 15:66924365-66924387 GAGGATGGGGAAGAGGGGATGGG - Intergenic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1129109161 15:73327738-73327760 GAGGATGAGCATAGGGGTGGTGG - Intronic
1129300342 15:74621747-74621769 GAGGAGGAGGAGGAGGGAGTCGG + Intronic
1129406399 15:75321835-75321857 GAGGATGAGGATGAAGGAGGAGG - Intergenic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129706340 15:77796667-77796689 GAGGGTGAGTAGATGGGGGTTGG - Intronic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130298661 15:82664376-82664398 GAGGATGAGGAGAAAGGGAGAGG - Exonic
1130558482 15:84940534-84940556 GAGGAAGAGGATGAGGGGGAAGG - Intronic
1130744357 15:86635256-86635278 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1131111171 15:89766216-89766238 GAGAATGTGGAAAAGGGGGAAGG - Intronic
1131413220 15:92228594-92228616 GAAGAAAAGGATGAGGGGGTTGG + Intergenic
1131834094 15:96373047-96373069 GAGGAGGTGGAAATGGGGGTGGG + Intergenic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1132838012 16:1964444-1964466 AAGGCCGAGGATAAGGAGGTAGG - Exonic
1133159492 16:3900959-3900981 GAGGGTGAGGATAAGGGTAGGGG + Intergenic
1133392763 16:5422801-5422823 GAGGAGGAGGAGGAGGGAGTGGG + Intergenic
1134111026 16:11515735-11515757 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134111037 16:11515773-11515795 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134440210 16:14294958-14294980 GGGGCTGAGGATGAGGGGGCTGG + Intergenic
1134743176 16:16566498-16566520 GAGGAGGAGGAGAAGTGGGGGGG - Intergenic
1134924384 16:18145962-18145984 GAGGAGGAGGAGAAGTGGGGGGG + Intergenic
1135164714 16:20128925-20128947 GAGGGTGGGGACAAGTGGGTAGG + Intergenic
1135806501 16:25547498-25547520 GTGGAGGAGGATAAGAGGGAAGG - Intergenic
1136347731 16:29687053-29687075 GGGGATGAGGATAAGGGAAGGGG - Intronic
1136610566 16:31362779-31362801 GAGGATGAGGGTAGGGGAGGTGG + Intronic
1137253932 16:46759925-46759947 GAGCATGTGGAAAAGGGGCTGGG - Intronic
1137540932 16:49361141-49361163 GAGGAAAAGGCTAAGGGGTTGGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1139424947 16:66873756-66873778 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139424957 16:66873781-66873803 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139558893 16:67729388-67729410 GAGGACGAGGATGAGGAGCTGGG + Exonic
1140256266 16:73338923-73338945 GAGGAAGAGAGCAAGGGGGTAGG - Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141703586 16:85653211-85653233 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1141703595 16:85653230-85653252 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
1141703606 16:85653255-85653277 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703617 16:85653283-85653305 TAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703625 16:85653302-85653324 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141840448 16:86570988-86571010 GAGGAGGAAGTTAAGGAGGTAGG + Intergenic
1142137840 16:88459767-88459789 GAGGAGGAGGGGAAGGGGGAGGG - Intronic
1142467169 17:142662-142684 TAGGATCAGGATTAGGGGTTAGG - Intergenic
1142863423 17:2776843-2776865 GAGGAGGAGGAGGAGGGGGCTGG + Intergenic
1143193777 17:5059798-5059820 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143533732 17:7523139-7523161 CAGGAAGCAGATAAGGGGGTGGG - Intergenic
1143749120 17:9015583-9015605 GAGGACGAGGATACAGGGGAGGG - Intergenic
1144058365 17:11560421-11560443 GAAGGTGAGGCTAAGAGGGTTGG + Exonic
1144074005 17:11700861-11700883 GAGTAGCAGGTTAAGGGGGTGGG - Intronic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144746806 17:17621454-17621476 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1144748488 17:17632059-17632081 GAGGAAGAGGAGAAGAGGGCTGG + Intergenic
1144768763 17:17747370-17747392 GAGGATGTGGAAGATGGGGTGGG + Intronic
1144821091 17:18075236-18075258 GAGGATGAGGATAGGGGGAGAGG + Intergenic
1145751751 17:27360099-27360121 GGGGAAGAGGATGAGGGTGTCGG + Intergenic
1146458570 17:33025796-33025818 GAGGATGAGAAGAAAGGGGCTGG - Intronic
1146499433 17:33351859-33351881 GGGGATGAGGATGGGGGAGTCGG + Intronic
1146504406 17:33392558-33392580 GATGATTAGGATAAGGGGCCGGG - Intronic
1146519872 17:33518026-33518048 GAGGATGATGATCAGAGGCTGGG - Intronic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147121752 17:38339201-38339223 GAGCAGGAGGAATAGGGGGTGGG + Intronic
1147132585 17:38418128-38418150 GAGGATGAGGGAGAGGGGGTGGG - Intergenic
1147178559 17:38671548-38671570 GAGGAGGAGGAAGAAGGGGTGGG - Intergenic
1147662615 17:42125101-42125123 GATGATGAGTATTTGGGGGTGGG - Intronic
1147909551 17:43847345-43847367 GAGGCTGAGGATAGGTGGGGTGG - Intronic
1148179647 17:45595043-45595065 GAGGAAGAGGAGAAAGGGGAAGG + Intergenic
1148269257 17:46250858-46250880 GAGGAAGAGGAGAAAGGGGAAGG - Intergenic
1148353901 17:46961996-46962018 TAAAATGAGGATAAGGGAGTGGG + Intronic
1148612090 17:48971409-48971431 GAGGCTGCAGAGAAGGGGGTGGG - Intergenic
1148700996 17:49586895-49586917 GAGGAAGAGGATGGGTGGGTGGG - Intergenic
1148748298 17:49930679-49930701 GAGGAGGAGGAAAAGTGGGAAGG - Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149512695 17:57256448-57256470 GAGGAGGAGGAGATGGGGGTGGG + Intronic
1150225787 17:63523776-63523798 GAGGACGCGGATGAGGGGGCAGG - Intronic
1151157201 17:72133563-72133585 GAGGATGAGGCTAACCGGGGAGG + Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151816113 17:76472167-76472189 GAGGCTGAGGGGCAGGGGGTCGG + Intronic
1152267627 17:79305503-79305525 GAGGAGGCGGACAAGGGGGCAGG - Intronic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1152315948 17:79580270-79580292 GAGGAGGAGGATGGGGGGGGAGG - Intergenic
1152365038 17:79850661-79850683 GATGAAGAGGAAAAGGGGCTGGG - Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152818556 17:82423848-82423870 GGGGAGGAGAATAAGGGGGAAGG + Intronic
1152952433 17:83247150-83247172 GAGGGTGAGGGTTAGGGGTTAGG + Intergenic
1153059907 18:984260-984282 GCGGCTGATGATAAAGGGGTGGG - Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153987180 18:10362851-10362873 GAGGAAGAGAACAAGGGGGAAGG - Intergenic
1154031353 18:10756625-10756647 GAGGATGAGGAGGAGGGGTGGGG + Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155222922 18:23701713-23701735 GAGGATGAAGAGAAGCGGGTAGG + Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156525449 18:37763465-37763487 GATGATGAGGATAATAGGGTTGG + Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157426978 18:47592477-47592499 GAGGATGAGGAGGAGTGGGGAGG - Intergenic
1157592702 18:48845130-48845152 AAGGAAGAGAAGAAGGGGGTTGG + Intronic
1157648522 18:49303044-49303066 GTGGATGAGGATGAAGGAGTGGG - Intronic
1157648726 18:49304913-49304935 CAGGATGAGACTAAGGGGCTGGG - Intronic
1158089398 18:53693005-53693027 GAGGATGAGGATGAGGGTGAGGG + Intergenic
1158195397 18:54879936-54879958 GAGGATCAGGAAAAGTGGGAAGG - Intronic
1158388403 18:57021128-57021150 GAGCCTGAGAATAAGGTGGTGGG + Intronic
1158525502 18:58209343-58209365 GAGGAGGAGGAGGAGGGGGCAGG - Intronic
1158883092 18:61799775-61799797 GAGGCTGAGGAAAAGGCAGTTGG - Intergenic
1159093159 18:63871827-63871849 GAGGCTGAGGAGTAGGGGTTTGG + Intronic
1159923379 18:74246702-74246724 GAGGATGGGGAGATGGGGGTGGG - Intergenic
1160063421 18:75552064-75552086 GTGGTGGAGGAGAAGGGGGTGGG + Intergenic
1160074182 18:75656261-75656283 GAGGAAGAGGAAATGGAGGTGGG - Intergenic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1161042434 19:2117203-2117225 AAGGGTAAGGATACGGGGGTGGG - Exonic
1161101559 19:2424402-2424424 GAGGATGGGGAGATGGGGGGTGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161607356 19:5222449-5222471 GAGGAGGAGGAAGAGGGGGGAGG + Intronic
1161663369 19:5560619-5560641 GAGGACGAGGATCTGGGGGTGGG - Intergenic
1162748234 19:12811507-12811529 GAGGAGGAGGCTAAGGTGGGTGG + Intronic
1163104115 19:15113805-15113827 GAGGACGAGGACGAGGAGGTCGG + Exonic
1163281953 19:16323876-16323898 GAGGTTGGGGAGGAGGGGGTGGG + Intergenic
1163690906 19:18737760-18737782 GAGGAGGAGGAAAAGGGAGGAGG - Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1164591901 19:29512022-29512044 GAGGATGAGGATGAAGGAGAGGG + Intergenic
1164592311 19:29513550-29513572 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164592326 19:29513599-29513621 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164756183 19:30691430-30691452 GGGGCTGAGGGTGAGGGGGTGGG + Intronic
1164868667 19:31625731-31625753 GAGGAAGAGGAAAAGGAGGAGGG - Intergenic
1164868703 19:31625866-31625888 GAGGAAGAAGAAAAGGGGGATGG - Intergenic
1164885449 19:31774734-31774756 GAGGATAACGATGAGAGGGTCGG - Intergenic
1165379001 19:35464556-35464578 GAGCAAAAGGAAAAGGGGGTGGG + Intergenic
1165387318 19:35518183-35518205 GAAGATGAGGCTTTGGGGGTGGG + Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1165786024 19:38462495-38462517 GGGGATGAGGAAAGCGGGGTCGG - Intronic
1166273516 19:41734209-41734231 GAGGATGAGGTTAAATGAGTTGG - Intronic
1166303422 19:41924514-41924536 GAGAATGAGGATAAAGGTGAGGG - Intronic
1166322449 19:42027013-42027035 GGGGATGAGGCTGTGGGGGTTGG - Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166386241 19:42383165-42383187 GAGGAAGAGGCTAATGGGGTAGG + Intergenic
1166700219 19:44878041-44878063 GAGGAGGAGGAGGAGGGGGGTGG - Intronic
1166944691 19:46389839-46389861 GGGGATGGGGAAAAGAGGGTGGG - Intronic
1167130489 19:47582171-47582193 GAGGAAGAGGAGGAGGGGGGAGG - Intergenic
1167325455 19:48821758-48821780 GAGGATGATGATAAGGATGACGG + Intronic
1167409313 19:49335682-49335704 GGAGATGCGGATACGGGGGTGGG - Intronic
1167566519 19:50260993-50261015 GATGATGAGGAAGCGGGGGTGGG - Intronic
1167833908 19:52050538-52050560 GAAGCTGAGGATATGGGGATAGG + Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
1168417373 19:56177122-56177144 GAGGAGGAGGACCAGGGGGACGG - Exonic
924958213 2:10441-10463 GAGGGTGAGGGTGAGGGGTTAGG - Intergenic
925496212 2:4452461-4452483 GAGGAGGAGGGGAAGGGGGAAGG - Intergenic
926127175 2:10278748-10278770 GAGGAAGAGGAGAAGGGAATTGG + Intergenic
926298027 2:11582418-11582440 GAGGATGGGGCCATGGGGGTGGG - Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927016557 2:18969437-18969459 GAGGCTGAGGATAAATGGGTTGG + Intergenic
927021526 2:19021931-19021953 GAGGATGATGAAAGGTGGGTAGG - Intergenic
927220634 2:20705297-20705319 GAGTTTGAGGATAAGGAGATGGG - Intronic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
929024010 2:37581763-37581785 GAGAGAGAGGATGAGGGGGTGGG + Intergenic
929118533 2:38465164-38465186 TAGGATAAAGATAAGGGGCTGGG - Intergenic
930066556 2:47332303-47332325 GAGGGTGAGGAGTAGGAGGTGGG + Intergenic
930087456 2:47507889-47507911 GAGGGTGAGGATATGTGGGGTGG + Intronic
930691773 2:54372308-54372330 GAAGATGAGGCTAAGGAGGAAGG - Intronic
930847261 2:55919210-55919232 GAGGATGAGGTTACAGAGGTAGG + Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931433995 2:62231631-62231653 GAGGAGGAGGATAAGGCAGAGGG - Intergenic
931511761 2:63004875-63004897 CAGAATGTGGGTAAGGGGGTGGG - Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
931902759 2:66807550-66807572 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
931978656 2:67670594-67670616 AAGGATGGGGATAAGGGAGGGGG + Intergenic
932146000 2:69317810-69317832 AAGGAAGAGGAAAATGGGGTGGG + Intergenic
932746794 2:74340550-74340572 GAGGATGAGATAAATGGGGTGGG + Intronic
932764107 2:74459324-74459346 GGGGATGGGGGTAGGGGGGTTGG + Intronic
932786491 2:74609210-74609232 GAGGCTGAGGATAGGGGGGAAGG - Intronic
932805165 2:74777259-74777281 GAGGAGGAGGACAAGAGGGAAGG + Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933213446 2:79597955-79597977 GTGCTTGAGGTTAAGGGGGTGGG - Intronic
933242355 2:79936445-79936467 CAAGAGGAGGAAAAGGGGGTCGG - Intronic
933448752 2:82418087-82418109 GAGGAGGAAGATGAGGGGTTGGG + Intergenic
933770119 2:85738373-85738395 GAGGATGAGGACAAGCGAGGGGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653221 2:96104131-96104153 AAGGAGGAGGAGGAGGGGGTAGG - Intergenic
935531667 2:104240368-104240390 GAGGATGAGGAGGAGGGAGGAGG + Intergenic
935599378 2:104907088-104907110 TAGGATGACGATGAGGGGCTGGG - Intergenic
936379407 2:111970745-111970767 GAGGAGGAGGAGAAGGGAGGAGG - Intronic
936379425 2:111970796-111970818 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
937217704 2:120323308-120323330 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
938237443 2:129717591-129717613 AAGGATAGGGATAATGGGGTGGG + Intergenic
938443414 2:131355910-131355932 GAGGAGGAGGAGAAGGGGAAGGG - Intergenic
939997830 2:148936951-148936973 GAGGAGGAGGAAAAGGGAGCAGG - Intronic
940216135 2:151305402-151305424 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
941515522 2:166471130-166471152 GAGGATGAGGATGAGGATGATGG + Intronic
941591132 2:167422067-167422089 GAGGAGGAGGATGAGGGAGAGGG + Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941721488 2:168817404-168817426 GAGGAGGAGGTTAAGTGGGCAGG + Intronic
941878241 2:170456445-170456467 GAGGATTAAGAGATGGGGGTTGG + Intronic
943540083 2:189202763-189202785 AAGGATGAGGATAAGAGGGCAGG + Intergenic
943614808 2:190081189-190081211 GAGGATGGGGGGATGGGGGTTGG - Intronic
943889074 2:193262624-193262646 GAAAATGAGGATAAGAGGGGTGG + Intergenic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944927425 2:204479488-204479510 GAAGGTGAGGATGGGGGGGTGGG - Intergenic
946062586 2:216956824-216956846 GGGTAGGAGGAAAAGGGGGTTGG + Intergenic
946429787 2:219619172-219619194 GAAGATGAGGATGAGGAGGAAGG + Intergenic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
946745137 2:222838060-222838082 GAGGTAGAGGACAAGGGAGTGGG - Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
947383090 2:229563922-229563944 GAGGATGATGATAATGGTGATGG - Intronic
947608601 2:231507547-231507569 GAGGAAGAGGAGGAGGGGGAAGG - Intergenic
947796466 2:232896754-232896776 GAGGGTGAGGTTAGGGGCGTGGG + Intronic
948135741 2:235634946-235634968 GAGGCTGAGGGTGAGGAGGTGGG - Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1168898677 20:1341737-1341759 GAGCAAGAGGAGAAGGGGATGGG - Intronic
1169002510 20:2178137-2178159 GACGATGAGTACCAGGGGGTAGG + Intergenic
1169074121 20:2751034-2751056 AAGGAGGAGGAGAAGGGCGTGGG + Intronic
1169346934 20:4836074-4836096 GAGGAAGAGGTTAAGGTTGTTGG - Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169757390 20:9057919-9057941 GAGGAAAAGGAGAAGGGCGTGGG + Intergenic
1170564844 20:17593098-17593120 GGAGATGAGGATAAGGGAGAAGG - Intronic
1170683456 20:18547499-18547521 GAGGATGAGAAGAAGGGGTGGGG - Intronic
1171773317 20:29343922-29343944 GAGGATGAGAGAAAGGGGGGGGG + Intergenic
1172217244 20:33244670-33244692 AAGGATGTGGACAAGGGCGTAGG + Intergenic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1173068449 20:39737231-39737253 GAGGATGGGGTGCAGGGGGTGGG - Intergenic
1173352143 20:42254996-42255018 GAGGGTCAGGGTGAGGGGGTGGG - Intronic
1173417105 20:42866439-42866461 GGGGAGGAGGAAAAGGGGGTTGG - Intronic
1173534246 20:43797083-43797105 GAGTATGAGGGTAAGAGAGTTGG - Intergenic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174740599 20:53010070-53010092 GAGGATGAGGAGAAAATGGTAGG - Intronic
1174783969 20:53415453-53415475 GAGGAAGAGGAAGAAGGGGTGGG - Intronic
1175539320 20:59738318-59738340 AAGGATGATAATAAGGGGGAGGG + Intronic
1175627524 20:60501275-60501297 TAGGATGAGGTTATGGGGATGGG + Intergenic
1175627614 20:60501598-60501620 TAGGATGAGGTTATGGGGATGGG + Intergenic
1175891585 20:62318245-62318267 GAGGAAGAGGAGGAGGGGGAGGG + Intronic
1175959361 20:62627393-62627415 GAGGGTGATGATGATGGGGTTGG - Intergenic
1175962767 20:62645493-62645515 GAGGATGAGGGTGAGGGTGCGGG - Intronic
1176017995 20:62946736-62946758 GAGGATGAAGATAAGTTGGAGGG + Exonic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176278376 20:64287008-64287030 GAGGGTGAGGGTTAGGGGTTAGG + Intronic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1177177128 21:17712299-17712321 GAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1178014991 21:28334913-28334935 GTGGCTGAGGATGAGGGGCTGGG + Intergenic
1179276689 21:39898260-39898282 GTGGATGTGGATGAGGGGGCCGG + Intronic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179464606 21:41563241-41563263 GAGGATGAAGAACAGGAGGTGGG - Intergenic
1180264313 21:46699859-46699881 GAGGGTGAGGGTTAGGGGTTAGG + Intergenic
1180619049 22:17147896-17147918 GAGGACCAGGATGAGGGCGTAGG - Intronic
1181287062 22:21760072-21760094 GAGGATGAGGAGATGGGCGTGGG + Exonic
1181348768 22:22240421-22240443 GAGGAGGAAGAGGAGGGGGTTGG + Intergenic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182862318 22:33570748-33570770 GAGGAGGAGGAAAAGTGCGTGGG + Intronic
1183273217 22:36874872-36874894 GAGGAAGAGGATGAGGGGTGAGG - Intronic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183600176 22:38835487-38835509 GAGGATGAGGAAGAGGGAGCAGG + Intronic
1183661303 22:39223121-39223143 GAGGATGAGGAAAGGTGCGTGGG - Intergenic
1184215689 22:43065773-43065795 GGGGATGCTGATAAGGGGGGAGG + Intronic
1184292421 22:43505024-43505046 GAAGATGATGATAAGGGTGTTGG + Intronic
1184470257 22:44692148-44692170 GAGGAGGAGGAGACGGGTGTGGG - Intronic
1184803565 22:46777086-46777108 GAGGATGTGGAGACGTGGGTGGG + Intronic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949768190 3:7550266-7550288 GAGGAGGGGGAGGAGGGGGTTGG - Intronic
950135002 3:10574871-10574893 GAGGAGGGGGATATGAGGGTGGG + Intronic
950227936 3:11251123-11251145 GAGGGGGAAGATAAGGGGTTAGG + Intronic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950942555 3:16908221-16908243 CAGGATGGGGATAAGTGGATAGG - Intronic
951711210 3:25586176-25586198 GAACATGAGGAGAAGAGGGTGGG - Intronic
952883480 3:37999199-37999221 CAGGATGAGGAAAGGGGCGTGGG + Intronic
953502549 3:43451617-43451639 AAGGGTGGGGATTAGGGGGTGGG + Intronic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954681854 3:52350206-52350228 GAGGCTGAGGGTAAGGTAGTTGG + Intronic
955087823 3:55720098-55720120 GAGGAGGAGGAGGAGGGGGATGG - Intronic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
956482660 3:69688603-69688625 GAGGAGGAGGAAGAGGGGGAGGG - Intergenic
956787948 3:72658008-72658030 GAATCTGAGGATAAGTGGGTGGG - Intergenic
958115517 3:89211694-89211716 GAGGAAGAGGAAGAGGGGGAGGG - Intronic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958603050 3:96323635-96323657 GAGGAGGAGGAGAAGGCGGGGGG + Intergenic
959181092 3:102981006-102981028 GAGGATGTGGAGAAAGGGGAAGG + Intergenic
959617452 3:108364134-108364156 GAGGATGAGGGTAAAGGGGAGGG - Intronic
960043564 3:113174604-113174626 GAGGATGAGAAGAAGGGGAAGGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960717365 3:120590029-120590051 GAGGATGTCGATAACGGGGGAGG + Intergenic
960815604 3:121668770-121668792 ACGGAGGAGGAAAAGGGGGTTGG - Intronic
960899661 3:122542219-122542241 GAGGAGGAGAAGAAAGGGGTAGG - Intronic
961487512 3:127227270-127227292 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
961803843 3:129474528-129474550 GAGGATGAGGGGATGGGGATTGG + Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
963690046 3:148488033-148488055 GAGGAAGAGGATAAGATGGGGGG + Intergenic
963836831 3:150066696-150066718 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
963942174 3:151106110-151106132 GAGGCTGAGGGTAAGGGGATTGG - Intronic
964441722 3:156718178-156718200 GAGGAGGAGGAAGGGGGGGTTGG + Intergenic
964525964 3:157615577-157615599 GATGATGAGGAGAAGGATGTTGG + Intronic
964568139 3:158080881-158080903 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
964849254 3:161077341-161077363 GGGGACAAGGATAGGGGGGTGGG + Exonic
964874284 3:161348175-161348197 GAGGCTGAGGCCAAGGGGGAAGG + Intronic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965459144 3:168940051-168940073 AAGGCTGGGGATAAGCGGGTAGG - Intergenic
965710503 3:171552217-171552239 GAAGATGTGGATAAGGGGGTGGG - Intergenic
965764838 3:172119483-172119505 GAGGATTGGGATAAGTGGGCAGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967882965 3:194314564-194314586 GGGAATGGGGATAAGGGGATGGG + Intergenic
967993423 3:195148926-195148948 GGGGAAGAGGAAAAGTGGGTGGG + Intronic
968255244 3:197263826-197263848 GATGATGGGGATAAAGTGGTAGG - Intronic
968359896 3:198139565-198139587 GACGAGGAGGACAAGGGGGAGGG + Intergenic
968641018 4:1714871-1714893 GAGGAGGAGGAGGAGGGGTTGGG - Intergenic
968889216 4:3359020-3359042 GAGGAGGAGGAAGAGGGGGAGGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970025106 4:11615697-11615719 GAGGATCTGGATTAGGGGGCAGG - Intergenic
971525021 4:27605818-27605840 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
972032382 4:34477783-34477805 GAGGAGGAGGAGGAGGGGGTGGG - Intergenic
972591545 4:40492825-40492847 GAGGATGGGAATCAGGGGGCTGG + Intronic
972840200 4:42921870-42921892 GAGGATGAGGAAAAGGAAGGTGG - Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973930115 4:55783622-55783644 GAGGATGCTGATGATGGGGTAGG - Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974924117 4:68276714-68276736 GAGCATGAGGATAAGAATGTAGG - Intergenic
975109502 4:70607960-70607982 GAAGGTGAAGAGAAGGGGGTAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977094487 4:92722436-92722458 GAGAATGAGGAAAAGGGGAACGG + Intronic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
977990980 4:103442304-103442326 GGGGAAGAGGAGAAGGGGGAAGG - Intergenic
978702311 4:111662595-111662617 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980912560 4:139006885-139006907 AAGGAGGAGGATGGGGGGGTGGG - Intergenic
980981428 4:139657582-139657604 GAGGAGGAGGAGAAGGGAGGGGG + Intergenic
981330981 4:143510071-143510093 AAGGAGGAGGGTAAGGGGTTTGG - Intergenic
982265405 4:153534331-153534353 GAGGATGAGGATTGTGGTGTGGG + Intronic
983061614 4:163166994-163167016 GAAAATCAGGATTAGGGGGTCGG + Intergenic
983091237 4:163505122-163505144 GGGCATGAGGATCAGGAGGTGGG + Intronic
984387084 4:179074456-179074478 GAGGATTAGAAAAAGGGGGGGGG + Intergenic
984868765 4:184309005-184309027 GAAGAGGAGGAAGAGGGGGTTGG + Intergenic
985128384 4:186717855-186717877 GTGGATGAGGAGAAAGTGGTTGG - Intronic
985190666 4:187369328-187369350 GAGGGTAAGGAAAAGGGGGTGGG + Intergenic
985263302 4:188135315-188135337 GAGGAGGAGGAGGTGGGGGTGGG - Intergenic
985464672 4:190182830-190182852 GAGGATGAGGGTTAGGGTGAGGG + Intronic
985627643 5:998184-998206 GAGAAAGAGGAAAAGGGGGACGG + Intergenic
985961657 5:3307278-3307300 GAGGAGGGGGAGAAGGGGTTTGG + Intergenic
985988772 5:3538476-3538498 GGGGATGAGGATGCAGGGGTGGG - Intergenic
986477222 5:8147522-8147544 GAGGATGAGAATAGGGTGGGTGG + Intergenic
986932409 5:12842571-12842593 GTGGATGAGGTTAAGGGTGGTGG + Intergenic
986953349 5:13119304-13119326 GAGGAGGAGGAAGAGGAGGTAGG + Intergenic
987195533 5:15522229-15522251 GAGGATAAGGAAAAGGGAGAAGG - Intronic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
988497760 5:31759138-31759160 GAGGAGGTGGAGGAGGGGGTGGG - Intronic
988615595 5:32771650-32771672 GAGGAGGACGAGAAGGGGATGGG + Intronic
988685952 5:33525820-33525842 GAGAAAGAGGGTAAGTGGGTGGG - Exonic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989114887 5:37942793-37942815 GATGATGAAAATAAGGGGGAGGG - Intergenic
989692360 5:44159299-44159321 CAGGAGGAAGATAAGGGGGAGGG + Intergenic
990984706 5:61630806-61630828 AACAATGAGGATAAGGGAGTGGG - Intergenic
991952685 5:71962080-71962102 GAGGATGAGGCAAAGAGGATGGG + Intergenic
992202614 5:74399233-74399255 GAGGAAGAGGACATGGGTGTTGG - Intergenic
992462641 5:76976113-76976135 GAGGGTGAGGATGGGTGGGTAGG - Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993119058 5:83753414-83753436 GAGGGTGAGGAGAAGCAGGTTGG + Intergenic
993302917 5:86235591-86235613 GAGGATGAGGAAAAGGATGGGGG + Intergenic
993505105 5:88699706-88699728 GAGGATGAGGAGAAAGGAGAAGG - Intergenic
993622556 5:90186160-90186182 GAGGAGGAGGAGAGGGGGGAAGG - Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
993858103 5:93100216-93100238 GAGGAGGAGGGTTATGGGGTTGG - Intergenic
994541298 5:101101643-101101665 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
994850269 5:105046311-105046333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
995435950 5:112135491-112135513 GAGCATGAAGATGAGGAGGTGGG - Intergenic
996015643 5:118531295-118531317 GAGGATGAGGTAGATGGGGTAGG - Intergenic
996084505 5:119290782-119290804 GAGGTTGAGGGAAAGGGTGTTGG + Intronic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996457789 5:123704498-123704520 GAGGATGAGGCTGAGGCGGGAGG - Intergenic
996493608 5:124128142-124128164 GAGCTTGAGGATACTGGGGTAGG + Intergenic
998468370 5:142363972-142363994 GAGGAAAAGGATAAAGGGGTGGG + Intergenic
998497502 5:142603399-142603421 GAGGAAGAGGATGTGGGGGAGGG - Intronic
998595906 5:143530232-143530254 AAGGATGAGGATAGGGTGGATGG - Intergenic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999144971 5:149386410-149386432 GAGGATGAGGATAGAGGCCTTGG - Intronic
999751622 5:154631919-154631941 GAGGAGGAGGAGAAGGTGATGGG + Intergenic
1000065190 5:157688140-157688162 GAGGATGGGGATATTGTGGTTGG + Intergenic
1000105373 5:158054106-158054128 GAAGATGAGGCAAGGGGGGTTGG - Intergenic
1001066336 5:168537764-168537786 GAGGGTGAGGAGGAAGGGGTAGG + Intergenic
1001690858 5:173631469-173631491 GGAGATGAGGAGGAGGGGGTAGG - Intergenic
1001690873 5:173631512-173631534 GGAGATGAGGAGGAGGGGGTAGG - Intergenic
1001706056 5:173741782-173741804 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1001737792 5:174021029-174021051 GAGGAGGAGGAGAAGGGGAAGGG + Intergenic
1002335168 5:178472360-178472382 GAGCAGGTGGATAAGGGTGTGGG + Intronic
1002376360 5:178791936-178791958 GATGATGATGATAAGGGGTGGGG + Intergenic
1002451425 5:179321170-179321192 GAGGATGAGGATCCGGGAGATGG - Intronic
1002972786 6:2041576-2041598 GAGGGTGAGGATCAGGGATTAGG - Intronic
1003409169 6:5848177-5848199 GAGTATGAGGATGAGGGAGAGGG - Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003928973 6:10904896-10904918 GAGGCTGAGGCTAAGGTGGGCGG + Intronic
1004119672 6:12808828-12808850 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1005402534 6:25449377-25449399 GAGGAGGAGGATGGGGGGTTGGG + Intronic
1005871018 6:29974633-29974655 GAGGCTGAGGATGAAGGAGTGGG + Intergenic
1006058904 6:31404822-31404844 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006071388 6:31499707-31499729 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006084276 6:31585427-31585449 GAGGATGGGGAGAAGGGTGGGGG + Intergenic
1006146199 6:31961270-31961292 GAGGATGAGAATGAGGCAGTGGG + Exonic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1006632846 6:35441679-35441701 GAGGAGGAGGGAAAGGGGGCGGG + Intergenic
1006741352 6:36311300-36311322 CAGACTGAGGATAAGGGTGTGGG + Intergenic
1006997737 6:38277934-38277956 GAGGGTCATGGTAAGGGGGTTGG - Intronic
1007705160 6:43786537-43786559 GAGGAAGAGGGAAAGGGGGCGGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008383431 6:50859583-50859605 GAGGAGGAGGATGAGGTGGGGGG - Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1011154384 6:84313803-84313825 GAAGAGGAGGAGAAGGGGATGGG - Intergenic
1011626970 6:89290742-89290764 GAGGAGGAGGATGAGGGGAATGG + Intronic
1011640346 6:89411914-89411936 GAGGAGGAGGATGAGCTGGTGGG - Exonic
1011665177 6:89626460-89626482 GAGGAAGAGGTTAAGGGAGTGGG + Intronic
1012583893 6:100899335-100899357 TAGGAGGAAGATAAGGGGGAGGG + Intergenic
1013280767 6:108634738-108634760 GATGATGAGTACATGGGGGTGGG + Intronic
1013291510 6:108723130-108723152 GAGGATGAAGATAAAGTGGTAGG - Intergenic
1013383046 6:109596423-109596445 TAGGATGAGGATGAGGAGTTTGG - Intronic
1014079792 6:117272571-117272593 GTGGATGAGGACATGGGGGAAGG + Exonic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1014701042 6:124688410-124688432 GAGGATGCTGATAATGGGGGAGG - Intronic
1015218512 6:130777814-130777836 GAGGAGGAGAATATAGGGGTTGG + Intergenic
1015323153 6:131898559-131898581 GAGCAAGAGCATAAGGGGATGGG + Intergenic
1015960428 6:138643317-138643339 GAGGATGTGGATAAAGGAGGAGG - Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016904309 6:149133750-149133772 GAGGATGAGGATGAGGATGGTGG - Intergenic
1017041836 6:150314319-150314341 GAGGAAGAGGAAAAGGAGGAGGG + Intergenic
1017192208 6:151666690-151666712 GAGGAGGAGGAGGAGGGGGATGG - Intronic
1017437439 6:154429707-154429729 GAGGAGGAGGAGACGGGGGAGGG - Intronic
1017637428 6:156456324-156456346 GAGGAAGGGGAGAAGGGGGAGGG - Intergenic
1017777006 6:157688392-157688414 GAGGAGGAAGACAAGGGGGATGG + Intergenic
1017788340 6:157774426-157774448 GAGGTTGAAGATAAGGAGGGGGG + Intronic
1018220202 6:161570495-161570517 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1018368323 6:163144951-163144973 GGGGATGGGGAAAAGAGGGTGGG - Intronic
1018429746 6:163713528-163713550 GAGAATGAGGAGGAGAGGGTTGG - Intergenic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019251586 7:16653-16675 GAGGATGAGGATGAGGGTTAGGG - Intergenic
1019260092 7:77084-77106 GACGAGGAGGACAAGGGGGAGGG - Intergenic
1019332387 7:466806-466828 GAGGATGAGGGTAAGGGATGAGG - Intergenic
1019517498 7:1446370-1446392 GAGGAGGAAGAGAAGGGGGGAGG + Intronic
1019788809 7:2997086-2997108 GGGGATGAGGATCTTGGGGTGGG - Intronic
1019878184 7:3834539-3834561 GATGATTAGGAAAAGGGGGTTGG + Intronic
1019924062 7:4180846-4180868 GGGGATGGGGATGTGGGGGTGGG - Intronic
1020410714 7:7888870-7888892 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020808829 7:12826311-12826333 GAGGAAGAGGATGAGGGGGAAGG - Intergenic
1020834778 7:13135364-13135386 GAGGATGATGAAAAGGGGTATGG + Intergenic
1020847626 7:13306924-13306946 GGGGATGGGGAGAAGGGGGAGGG + Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021580246 7:22144570-22144592 AGGGATGAGGCTCAGGGGGTGGG + Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023528711 7:41131437-41131459 GGGGAAGAGGCTAAGGGGCTGGG + Intergenic
1023998774 7:45177762-45177784 GAGGATGCGGAATGGGGGGTAGG - Intronic
1024104352 7:46067066-46067088 GAGGAGGAGGAAAAGGAGATGGG - Intergenic
1024599020 7:50963311-50963333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1026334635 7:69383258-69383280 AATAATGAGGATAAGGGGGAAGG - Intergenic
1026638635 7:72105772-72105794 GAGGAGGAGGAGGAGGGGGGAGG + Intronic
1026672658 7:72403311-72403333 GAGAATGAGAAAAAGGGGGACGG - Exonic
1027814708 7:82953701-82953723 GAGGAGGAGGAGGAGGGGGAGGG + Exonic
1027906909 7:84196463-84196485 GAGAATGGGGAAAAGGGAGTAGG + Intronic
1028006397 7:85574673-85574695 GAGGAGGAGGAGGAGTGGGTGGG + Intergenic
1028086096 7:86639639-86639661 GAGGATGAGGATGAGGAAGCCGG - Intergenic
1028433527 7:90775652-90775674 GAGGAGGAGGAGAAAGGGGGAGG - Intronic
1028492026 7:91423293-91423315 GAGGATCAGGCTAAGTGGGAGGG + Intergenic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1028925989 7:96357581-96357603 GAGCATGAGGATAATGGGTGAGG - Intergenic
1029086922 7:98019042-98019064 GAGCCTGGGGATAAGGGGGATGG - Intergenic
1029110442 7:98211078-98211100 GAGGATGGGGAGAAGCGTGTGGG + Intergenic
1029493176 7:100883357-100883379 GAGTATGAGGAAAAGGGGAAAGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1030415004 7:109231884-109231906 GAGGGTGTGGATGAAGGGGTGGG - Intergenic
1030781442 7:113605504-113605526 GAGGAGGAAGATAAGGAGTTTGG + Intergenic
1030781863 7:113610711-113610733 GAGGAGGAGGGGAAGGGGGGAGG + Intergenic
1030985463 7:116237189-116237211 GAGGAGGAGGCTAAGTGGGCAGG - Intronic
1031017558 7:116592497-116592519 GAGGAGGGAGATAAGGGGATGGG + Intergenic
1031538624 7:122965406-122965428 GAGGAAGAGGAAAAGAGAGTGGG + Intergenic
1031765737 7:125774666-125774688 GAGGATGAGTAAATGGAGGTAGG - Intergenic
1032329270 7:130962540-130962562 CAGGAGGAAGATAAGGGGGAAGG - Intergenic
1032867167 7:135937768-135937790 GAGGAGGAGGAATTGGGGGTTGG - Intronic
1033633361 7:143183846-143183868 CAGTTTGAGGAAAAGGGGGTAGG - Exonic
1033648258 7:143321428-143321450 GAGGATGAGGACTAGTGGGAAGG - Exonic
1034070057 7:148175842-148175864 GAGGAGGATGATAAGGAGGATGG - Intronic
1034438738 7:151076104-151076126 GAGGATGAGGATGAAGGGGAAGG - Exonic
1035385073 7:158466283-158466305 GAAGATGTGGATGAGAGGGTAGG - Intronic
1035893951 8:3376001-3376023 GTGGATGAGGATAAAGAAGTTGG - Intronic
1036064819 8:5368096-5368118 GAAGATGTTGATAATGGGGTAGG + Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1037691225 8:21183234-21183256 GAGGAGGAGGAAAAGGGGAAGGG - Intergenic
1037987595 8:23299523-23299545 GGGGATGCGGATACAGGGGTGGG - Intronic
1038554366 8:28495928-28495950 GTGGATGAGGGAAAAGGGGTAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038713688 8:29972745-29972767 GATGTTGAGGATGGGGGGGTAGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1040079752 8:43274856-43274878 GAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1041180531 8:55243120-55243142 GAGGATGTTGATAAGTGGGGAGG - Intronic
1041746166 8:61211386-61211408 GAGGAGGAGGTAAAGGGGGAAGG - Intronic
1042591815 8:70403841-70403863 GAGGAGGAGGAGGAGGGAGTTGG - Intergenic
1042914356 8:73860623-73860645 GAGGATGAGGCTAAGGTTGGTGG + Intronic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1044193116 8:89342917-89342939 GAGGATGAGGAAGAGTGGGGAGG - Intergenic
1044354020 8:91199321-91199343 GAGAATGAGCTTAAGTGGGTAGG + Intronic
1044395891 8:91711392-91711414 GAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1045295457 8:100868531-100868553 GAGGATGAGGAGAAGAAAGTGGG - Intergenic
1046331934 8:112728599-112728621 GAGGAGGAGAAGAAGGGGCTTGG - Intronic
1046859916 8:119079096-119079118 AAGGAAGAGGACAAGGGGGAAGG - Intronic
1047109492 8:121773363-121773385 GAGGATAATGATAAGGAGATTGG + Intergenic
1047192988 8:122695470-122695492 GAGCAGGAGGATGAGGGGGGAGG + Intergenic
1047437134 8:124844031-124844053 GAGGAAGAGGCCAAGTGGGTGGG - Intergenic
1048375275 8:133817733-133817755 GAGGATGAGGCCAAGGGGGAGGG - Intergenic
1048516580 8:135116818-135116840 GAGGAGGAGGAGAGGGGGGAGGG - Intergenic
1048656320 8:136541158-136541180 GAAGAAGAGGAAAAGGGAGTGGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049052046 8:140205917-140205939 AAGACTGAGGATGAGGGGGTGGG - Intronic
1049609048 8:143544382-143544404 GAGGAGGAGGATGAGGAGGGAGG - Intergenic
1049632394 8:143665695-143665717 AAGGATGAGGACAAGGGGGATGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050366483 9:4878102-4878124 GAGGCTGATGAAAAGGGTGTAGG - Intronic
1050744193 9:8857928-8857950 GAGGAGGAGGAAAAGGGGGTAGG - Intronic
1051919004 9:22241831-22241853 GAAGATGAGGATGAGGAAGTGGG - Intergenic
1052139486 9:24961409-24961431 GAGGATGTTGATAACGGGGGAGG + Intergenic
1052585413 9:30422521-30422543 GAGGAGGAGGGTAAAGGGGAGGG + Intergenic
1052786334 9:32831682-32831704 GAGGAGGAGGCTGAGGGGGCAGG + Intergenic
1053071782 9:35106192-35106214 GAGGATGAGGATTTGGGGGCGGG - Intronic
1053336001 9:37271942-37271964 GAGGACAAGGGTAAGTGGGTAGG + Intronic
1053441613 9:38120939-38120961 GAGGAGGAGGAGAAGGTGGGAGG + Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1055427779 9:76213889-76213911 GAGGATGTGGTTAAGTGGGCAGG - Intronic
1056396376 9:86185206-86185228 GAGTATGGGGAGAAGGGGCTGGG + Intergenic
1056581467 9:87890111-87890133 GAGGCTGAGGACAAGGGGACAGG + Intergenic
1056909385 9:90684409-90684431 GAGGATGAGGCTTATGGGGCAGG - Intergenic
1057181525 9:93033294-93033316 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181534 9:93033317-93033339 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181543 9:93033340-93033362 GAGGAAGAGGAGAAGGGGACGGG - Intronic
1057498432 9:95578243-95578265 GAGGATGAGGGTAAGGGTGCTGG - Intergenic
1057739776 9:97701201-97701223 GAGGACCAGGATAAGGGGGTGGG - Intergenic
1058444581 9:105043437-105043459 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1058623788 9:106913125-106913147 GATGATGAGGAAAAGGAGGATGG + Intronic
1059373530 9:113863119-113863141 GGAGATGAGGATAAGGGGAGGGG + Intergenic
1059410614 9:114130009-114130031 GAGGGAGAGGAAAAGGTGGTGGG + Intergenic
1059449195 9:114359708-114359730 GAGGAGGAGGAAGAGGGGGGAGG - Exonic
1059691312 9:116687902-116687924 GAGGGTGAGATTGAGGGGGTGGG + Intronic
1060269061 9:122128408-122128430 GAGGAGGAGGATGCCGGGGTGGG - Intergenic
1060343626 9:122798241-122798263 GAGGATCAGGATGATTGGGTAGG - Intergenic
1061255604 9:129453219-129453241 GGGGATGAGGAGATGGGGGATGG + Intergenic
1061255685 9:129453432-129453454 GGGGATGAGGAGATGGGGATGGG + Intergenic
1061446061 9:130638824-130638846 GAGGCTGGGGACAAGGAGGTGGG - Intergenic
1061655924 9:132090054-132090076 GAGGATGAGGTTAAGGGTGGTGG - Intergenic
1062388995 9:136326758-136326780 GAGGAGGAGGAGGAGGCGGTAGG + Intergenic
1062744599 9:138203385-138203407 GACGAGGAGGACAAGGGGGAGGG + Intergenic
1185499133 X:584281-584303 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185499161 X:584381-584403 GAGGAGGAGGGGAAGGGGGAGGG + Intergenic
1185520711 X:736491-736513 GGGGATGAGGAGATGGGGGCAGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1187385374 X:18843774-18843796 AAGGATGAGTATAATAGGGTTGG + Intergenic
1188285710 X:28323345-28323367 GAGGAAGGGGAGATGGGGGTGGG - Intergenic
1188400055 X:29733047-29733069 GAGGAAGAGGATGAGAGGGGAGG + Intronic
1189129770 X:38485560-38485582 GAGGGTGGGGAGAGGGGGGTGGG + Intronic
1189672500 X:43425905-43425927 GAGGAATAAGATAAGGGGGAGGG - Intergenic
1190063368 X:47224543-47224565 GAGGAACTGGAAAAGGGGGTTGG + Intronic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190250268 X:48718189-48718211 GAGGAGGAAGAAAGGGGGGTGGG - Intergenic
1191676268 X:63795244-63795266 GAGGATGAGGAAGAGAGGGAGGG + Intergenic
1192819981 X:74635310-74635332 GGGGATGTGGAGATGGGGGTTGG - Intergenic
1193913563 X:87336542-87336564 GAGGATGAGGTATAAGGGGTCGG + Intergenic
1194008306 X:88525274-88525296 GAGGTTGAGGAAAAGTGGATGGG + Intergenic
1194012544 X:88580848-88580870 GAGGGAGAGGGTAAGGGGGCTGG + Intergenic
1194598604 X:95891224-95891246 GAGAGTGAGGATAAGAGGGAAGG - Intergenic
1195751006 X:108161981-108162003 GAGGATGAGAAGAAGGGAGGAGG - Intronic
1196050003 X:111294689-111294711 GAGGGAGAGGGCAAGGGGGTGGG + Exonic
1197146305 X:123176375-123176397 GAGGAGGGGGATAAGGGGAGAGG - Intergenic
1197257194 X:124275839-124275861 GGGGATGAAGATAAAGGGGGAGG + Intronic
1197275089 X:124468525-124468547 GAGGATAGGGATAAGGAGATGGG - Intronic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1198727031 X:139689120-139689142 GGGGATGAGGAGAAGGGGAGAGG - Intronic
1199088090 X:143652623-143652645 GAGGATGTTGATAAAGGGGAAGG - Intergenic
1199498839 X:148486676-148486698 GAGGATGTTGATAATGGGGAAGG + Intergenic
1199506112 X:148563186-148563208 GAGGATGAGGTTAGGGATGTAGG + Intronic
1199599802 X:149535214-149535236 GAGGAAAAGGAGGAGGGGGTGGG - Intergenic
1199650838 X:149945038-149945060 GAGGAAAAGGAGGAGGGGGTTGG + Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201632222 Y:16081379-16081401 GGGGATGAGGATAAGAGTTTTGG - Intergenic
1201684832 Y:16689209-16689231 TAGGGTGAGGGGAAGGGGGTGGG + Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1201855268 Y:18534432-18534454 GAGGGTTAGGATAAGGGGTTAGG + Intergenic
1201878054 Y:18785953-18785975 GAGGGTTAGGATAAGGGGTTAGG - Intronic