ID: 1008908312

View in Genome Browser
Species Human (GRCh38)
Location 6:56705306-56705328
Sequence GTGCCATGGGTGAAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008908312 Original CRISPR GTGCCATGGGTGAAGTAGGT GGG (reversed) Intronic
900614739 1:3560468-3560490 GTGCCAGGGGTGAGGAAGGAGGG - Intronic
901644424 1:10708978-10709000 GGGCCATGGGTGAGGGAGGGAGG + Intronic
903990023 1:27260779-27260801 CTGGAATGGGTGAAGTGGGTGGG - Intronic
907307406 1:53521011-53521033 GTGCCATCTGTGAACTAGATGGG + Intronic
908250301 1:62260539-62260561 GTGTCTTGGCTGAAGGAGGTGGG - Intronic
908589563 1:65615283-65615305 CTGCCATAGGTGAAGTTGATTGG + Intronic
916175918 1:162038159-162038181 GAGCCAGGGGAGAAGTAGGGTGG + Intergenic
921501925 1:215915085-215915107 GTCCTAGGTGTGAAGTAGGTGGG + Intronic
924747585 1:246851257-246851279 GTGACATTGCTGAAGTAGATGGG - Exonic
1063886712 10:10587312-10587334 GTGAAATGAGTGAAGCAGGTTGG - Intergenic
1064262023 10:13793614-13793636 GTGCCATGGCTGGAGTGGGGAGG + Intronic
1068076122 10:52257030-52257052 GTGCCATGGGTTAAGAAGGCTGG - Intronic
1072302369 10:94073661-94073683 CTGCCATGGGTGCAGTGGGCTGG - Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1075154325 10:119961849-119961871 CTGCCCTGGGTGAACTAGGTGGG + Intergenic
1078454882 11:11467286-11467308 GAGCCATGGGTGACCTAGGTTGG - Intronic
1079162581 11:18008758-18008780 GTGGCATGGGTGCAGGAGGAGGG - Intronic
1079279321 11:19073444-19073466 GGGCTCTGGGTGAGGTAGGTGGG - Intergenic
1082034711 11:47635536-47635558 GTGACAAGGGTGAGGTATGTTGG - Exonic
1096578641 12:52570292-52570314 TAGCCATGGGTGAATTTGGTGGG - Intronic
1096591638 12:52663926-52663948 GTAATTTGGGTGAAGTAGGTGGG - Intergenic
1097468242 12:59954134-59954156 GTGCCATGGGGGAAGGGGGGAGG + Intergenic
1103731354 12:123029863-123029885 GAGCCATGGGTGAGGGAGGGAGG + Intronic
1104812216 12:131626240-131626262 GGGCCGTGGGTGAAGTTGGGGGG - Intergenic
1106795081 13:33197112-33197134 GTGCCATGTGTGAAAAAGGCTGG - Intronic
1109310524 13:60687345-60687367 GTGCCATGGGGGCAGTATGGGGG + Intergenic
1109859694 13:68180466-68180488 CAGCCATGGCTGAAGTAGTTGGG + Intergenic
1112456353 13:99566920-99566942 GCGCCATGGGTGGAGGGGGTGGG - Intergenic
1113147145 13:107220036-107220058 GTGACATTGGTAAAGTAGGGTGG - Intronic
1122093394 14:99354370-99354392 GTGCCCTAGGTGGAGTAGGAGGG - Intergenic
1122921124 14:104880617-104880639 GTGCAATGGGTGAGGAATGTGGG - Intronic
1122939041 14:104973074-104973096 GTGCCAGGGGTCCGGTAGGTGGG - Intronic
1126634558 15:50768035-50768057 GTGCCAAAGGCGAAGTAGGTGGG + Intergenic
1127087437 15:55437617-55437639 GTACCCTGGATGATGTAGGTGGG + Intronic
1130888801 15:88115834-88115856 GCCCCATGGGTTAAGTTGGTGGG - Intronic
1135395819 16:22131011-22131033 GTGTCTTGGCTGAAGTATGTTGG + Intronic
1137671349 16:50281469-50281491 GTGGCATGGGTGAGGGAGGAGGG - Intronic
1139251611 16:65501900-65501922 GTGTCATGGTTGAAGGTGGTTGG - Intergenic
1139341876 16:66272735-66272757 GTGTCATGGGTGAAAGGGGTAGG - Intergenic
1149353377 17:55814491-55814513 GTGCCAAGGCTGAACAAGGTCGG + Intronic
1150524943 17:65912603-65912625 CTGCCATGGCTGAAGTAGCATGG + Intronic
1151354313 17:73549547-73549569 ATGCTATGGGGGAAGTAGATGGG + Intronic
1151677474 17:75606036-75606058 GAGCCAGGGCTGAAGTGGGTGGG + Intergenic
1152596773 17:81241674-81241696 GCGCCATCGGTGAAGTACCTGGG - Intergenic
1152687237 17:81700657-81700679 GTGCCATGGGAGAAGGGGCTGGG - Intronic
1152757158 17:82091816-82091838 GTGCCATGGCAGAATTAGGTTGG - Intronic
1157676109 18:49569769-49569791 GTGCTGTGGGTGAAGTGGGGTGG + Intronic
1159895119 18:73989116-73989138 GTGCCCTGGTTGGAGTTGGTTGG - Intergenic
1162800095 19:13105399-13105421 GTGCGAGGGGAGGAGTAGGTGGG + Intronic
1164635082 19:29785957-29785979 GTGCCATGGGTGTGGGAGGCTGG + Intergenic
1164668410 19:30058645-30058667 GTGCCCTGGGTGAAGCAGGGAGG + Intergenic
1164685538 19:30164168-30164190 GTGCCCTTGGGGAAGTAGATAGG - Intergenic
1166963739 19:46515305-46515327 CTGCCATGGGTGAAATGGGTGGG - Intronic
1168721637 19:58557822-58557844 GTCAAACGGGTGAAGTAGGTTGG - Intronic
924988822 2:294107-294129 GTGCCATCTGTGAGGAAGGTGGG - Intergenic
925872583 2:8284052-8284074 GGACTCTGGGTGAAGTAGGTGGG - Intergenic
929190382 2:39134316-39134338 TTGTAATGGGTGATGTAGGTAGG - Intergenic
929897777 2:45976554-45976576 CTGCAATGGGAGCAGTAGGTGGG - Exonic
930109190 2:47664146-47664168 GTGACATGGCAGAAGCAGGTTGG + Intergenic
931153516 2:59601477-59601499 GGGCCTTTGGTGAAGTGGGTGGG - Intergenic
931704760 2:64938098-64938120 AGGCCATGGGTGAAGTGGGCGGG + Intergenic
937701656 2:124869000-124869022 TAGCCATGGGTGAAGTAAGGAGG + Intronic
938553177 2:132399468-132399490 GTGCCATGCATGAAGTTTGTTGG + Intergenic
938964679 2:136377766-136377788 GTCCCATGGGAGCAGTAGGAGGG - Intergenic
939529503 2:143339614-143339636 ATGACATGGGAGAAATAGGTAGG - Intronic
940846329 2:158646340-158646362 TTGCCATAAGTAAAGTAGGTTGG + Intronic
941118658 2:161502932-161502954 GTGACATTGCTGAAGTAGATGGG - Intronic
944530903 2:200667286-200667308 TTTCCATGAGTGAAGTCGGTGGG + Intronic
944618338 2:201485125-201485147 GTGCCATGAGGGAAGGAAGTAGG - Intergenic
945761126 2:213916655-213916677 GTGTCATGGGGGGAGCAGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948857126 2:240735396-240735418 CTGCCATGGGTGACGTAGGAGGG - Intronic
1172647210 20:36478188-36478210 CTGCCATGGGTCCAGTAGGAGGG - Intronic
1174487244 20:50869248-50869270 GTGCCCTGGGGGATGAAGGTGGG + Intronic
1174677923 20:52376164-52376186 GTGCTGGGGGTGAAGTGGGTTGG - Intergenic
1180880871 22:19202626-19202648 GTGCCATGGATGACGGAAGTAGG - Intronic
1183266935 22:36833631-36833653 CTGCCAGGGGTGAAGTTGGAGGG + Intergenic
1183501131 22:38180097-38180119 GTGTGCTGGGGGAAGTAGGTAGG - Intronic
1185199727 22:49494265-49494287 GTGCCATGGGAGAGGCAGGTAGG + Intronic
949711469 3:6875742-6875764 ATGCCAGGGGTGAAGTAGGGTGG + Intronic
949859592 3:8493330-8493352 GTGGCAGGGGTGAAGTAGCTTGG - Intergenic
950200119 3:11036690-11036712 GTGGCAGGGGTGCAGGAGGTGGG + Intronic
951922360 3:27870466-27870488 GTGCAATGTGTAAAGTAGCTTGG + Intergenic
952939729 3:38433203-38433225 GTACCATGGCTGAAGCAGCTGGG + Intergenic
954873855 3:53787768-53787790 GTGCCGTGGATGAAGGAGGCAGG + Intronic
960360737 3:116707783-116707805 GTGCCATGCGTGAATGAGGTAGG - Intronic
967582947 3:191180771-191180793 GTGCCATTGATGTAGTAGGGTGG + Intergenic
967846712 3:194049247-194049269 GTGACATGCGTGAAGAAGCTTGG - Intergenic
968655057 4:1774862-1774884 GTGCCTTGGGTGACCTACGTTGG - Intergenic
977725346 4:100290247-100290269 GTTCCATGGGTGAAAAAGATTGG + Intergenic
988820856 5:34883444-34883466 CTTCCCTGGATGAAGTAGGTTGG - Intronic
993650139 5:90510054-90510076 CTGCCATGGGGGTAGTAGGGTGG + Intronic
993701241 5:91121392-91121414 GTGCCAGGGGTGCAGTGGCTAGG + Intronic
998016543 5:138736627-138736649 GTGCCTTGGGAGATGGAGGTGGG + Intronic
999207729 5:149862092-149862114 GAGCCATGGGTGAAGAGGGATGG + Intronic
1001988768 5:176098383-176098405 CTGGCATGTGTGAAGAAGGTTGG - Intronic
1002228100 5:177739753-177739775 CTGGCATGTGTGAAGAAGGTTGG + Intronic
1003978100 6:11363284-11363306 TTGCATTGGGAGAAGTAGGTGGG + Intronic
1004899355 6:20180157-20180179 ATGTCATGGGTGCAGTAGGCTGG - Intronic
1006381399 6:33699858-33699880 GAGCCAGGGATGAAGTAGGCAGG - Intronic
1008265170 6:49416209-49416231 GTCCTATGGATGAAGAAGGTGGG + Intergenic
1008816942 6:55579397-55579419 ATGCCAGGTGAGAAGTAGGTGGG - Intergenic
1008908312 6:56705306-56705328 GTGCCATGGGTGAAGTAGGTGGG - Intronic
1009804829 6:68590004-68590026 GGGCCAAGGGTGAAATAGTTTGG - Intergenic
1011979322 6:93352785-93352807 GTGACATGGATGAAGTGGGTGGG + Intronic
1013115785 6:107102787-107102809 GTGCCTGGTGTGAAGTTGGTGGG - Intronic
1017280733 6:152621682-152621704 GCGCGATGGATGAAATAGGTTGG + Intronic
1019149147 6:169992881-169992903 GGGCCATGGGCCAAGCAGGTGGG + Intergenic
1020280501 7:6647766-6647788 GTGCCATGGGTGGTGTGTGTGGG + Intronic
1021662339 7:22932323-22932345 GAGCCATGGATGCAGTAGATGGG + Intergenic
1022299094 7:29085942-29085964 TTACCATGGGTGCACTAGGTAGG - Intronic
1023488995 7:40717446-40717468 GTGCCCTGGGGGAAATGGGTGGG - Intronic
1025147353 7:56516312-56516334 ATGCCCTGGGAGAAGTAGGTGGG + Intergenic
1025715985 7:63956060-63956082 GTGCCTTGGCTGATGTAGGAAGG - Intergenic
1026319022 7:69252798-69252820 GTGCCCTGGCAGAAGTAGGCGGG - Intergenic
1027331034 7:77093342-77093364 GTGGCTTGGGTGAAGTAGGTTGG - Intergenic
1029160599 7:98548953-98548975 AAGCCATGGGTGAGGGAGGTGGG + Intergenic
1029784740 7:102777986-102778008 GTGGCTTGGGTGAAGTAGGTTGG + Intronic
1032191532 7:129768704-129768726 GTGCCATGGGAGAAGGACCTTGG - Intergenic
1033849409 7:145477317-145477339 GTGCCATGAAAGAAATAGGTTGG + Intergenic
1036433698 8:8713389-8713411 TAGCCAGGGGTGAAGGAGGTTGG - Intergenic
1043543364 8:81288142-81288164 GGGTCATGGGTGAAGTGAGTTGG + Intergenic
1045204490 8:100023887-100023909 GTTCCTTGGGTGAAGTGGGAGGG + Intronic
1046218791 8:111185209-111185231 GTGCCACGCCTCAAGTAGGTGGG - Intergenic
1047928456 8:129703195-129703217 GGGCCAAGGGTGGAGTAGGAGGG - Intergenic
1057228354 9:93304254-93304276 GTGCCATGGCTGGAGTGGGGAGG + Intronic
1057505410 9:95629525-95629547 CTGCCATGGGTGAAGAAGGAGGG - Intergenic
1059429426 9:114241101-114241123 GTGCGCTGGATGAAGTGGGTTGG + Intronic
1059659813 9:116389761-116389783 GTGCCAGGGGTGATGTGGGTTGG - Intronic
1060248122 9:121963567-121963589 TTGCCGTGGGTGGAGTAGATGGG - Intronic
1061751568 9:132781350-132781372 GTGCCATGGGTTTATGAGGTAGG + Intronic
1186158595 X:6752082-6752104 GTCCCCTGGGTGTAGCAGGTGGG - Intergenic
1186695300 X:12023933-12023955 GTGGCAGTGGTGAAGAAGGTAGG + Intergenic
1187478079 X:19629422-19629444 GTGCTAGGGATGAAGTGGGTAGG + Intronic
1197902956 X:131393119-131393141 GGGCAATGGGTGAGGGAGGTGGG - Intronic