ID: 1008909009

View in Genome Browser
Species Human (GRCh38)
Location 6:56713194-56713216
Sequence GTCTGAAGACCCTGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008909006_1008909009 -9 Left 1008909006 6:56713180-56713202 CCAGGTAAAAGGCAGTCTGAAGA 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1008909009 6:56713194-56713216 GTCTGAAGACCCTGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008909009 Original CRISPR GTCTGAAGACCCTGGGCAGC TGG Intronic
No off target data available for this crispr