ID: 1008909832

View in Genome Browser
Species Human (GRCh38)
Location 6:56720945-56720967
Sequence GGCTGCCCCGTCTGGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1756
Summary {0: 1, 1: 16, 2: 111, 3: 340, 4: 1288}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008909832_1008909851 15 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909851 6:56720983-56721005 CCGCCACCTTCCAGACGGGGCGG 0: 1
1: 1
2: 156
3: 915
4: 3310
1008909832_1008909854 22 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909854 6:56720990-56721012 CTTCCAGACGGGGCGGCTGCCGG No data
1008909832_1008909845 11 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909845 6:56720979-56721001 CCCCCCGCCACCTTCCAGACGGG No data
1008909832_1008909843 10 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909843 6:56720978-56721000 GCCCCCCGCCACCTTCCAGACGG 0: 1
1: 0
2: 4
3: 45
4: 453
1008909832_1008909855 23 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909855 6:56720991-56721013 TTCCAGACGGGGCGGCTGCCGGG No data
1008909832_1008909847 12 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909847 6:56720980-56721002 CCCCCGCCACCTTCCAGACGGGG No data
1008909832_1008909860 29 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909860 6:56720997-56721019 ACGGGGCGGCTGCCGGGCGGGGG 0: 439
1: 1062
2: 1168
3: 2456
4: 6882
1008909832_1008909859 28 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909859 6:56720996-56721018 GACGGGGCGGCTGCCGGGCGGGG 0: 21
1: 65
2: 114
3: 194
4: 4600
1008909832_1008909857 26 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909857 6:56720994-56721016 CAGACGGGGCGGCTGCCGGGCGG 0: 457
1: 1190
2: 1792
3: 1014
4: 638
1008909832_1008909858 27 Left 1008909832 6:56720945-56720967 CCCACCCCCCAGACGGGGCAGCC 0: 1
1: 16
2: 111
3: 340
4: 1288
Right 1008909858 6:56720995-56721017 AGACGGGGCGGCTGCCGGGCGGG 0: 14
1: 47
2: 109
3: 660
4: 3904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008909832 Original CRISPR GGCTGCCCCGTCTGGGGGGT GGG (reversed) Intronic
900412745 1:2520344-2520366 GGCGGCACCTTCTGGGGGCTTGG - Exonic
900462184 1:2807026-2807048 GGCCGCCCCTCCTGCGGGGTGGG + Intergenic
900467137 1:2831303-2831325 AGCAGCCCCGTGAGGGGGGTGGG - Intergenic
900485136 1:2919183-2919205 GGCTGCCCCGCCTGCGTGATGGG - Intergenic
900569058 1:3349467-3349489 GGCTGCGCCGACTGGGTGCTGGG - Intronic
901030710 1:6305388-6305410 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
901066644 1:6497462-6497484 GGCGGCCCCGCCTCGGGGGCGGG + Intronic
901146300 1:7067091-7067113 GGGTGCCCCGTGTGGGGACTGGG - Intronic
901341321 1:8501141-8501163 AGCTGCCCCGTCCGGGAGGGGGG + Intronic
901849882 1:12008476-12008498 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
901970361 1:12903012-12903034 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
902014804 1:13298757-13298779 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
902610897 1:17596622-17596644 GGCTGCACCATGTGGGTGGTCGG - Intronic
902963279 1:19979649-19979671 AGCTGCTCCCTCTGGGAGGTTGG + Exonic
903081720 1:20816393-20816415 GGCCGCCCCGTCCGGGAGGTGGG + Intronic
903184339 1:21620712-21620734 GGCTGGCCCGGCTCGGGGCTGGG + Intronic
903485761 1:23688604-23688626 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
903634345 1:24800418-24800440 AGCTGCCCCGTCTGGGAGGGAGG + Intronic
903921380 1:26803522-26803544 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
904115988 1:28162375-28162397 AGCTGCTCTGTCTGGGGAGTAGG - Intronic
904760987 1:32804423-32804445 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
904785287 1:32977969-32977991 GGCTGCCCTGACTGGAGTGTTGG + Intergenic
904838772 1:33356884-33356906 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
904857271 1:33509238-33509260 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
904930354 1:34082355-34082377 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
904930371 1:34082395-34082417 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
904930418 1:34082512-34082534 GGCCGCCACGTCTGGGGGGTGGG + Intronic
905040034 1:34948153-34948175 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
905192158 1:36243887-36243909 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
905315699 1:37080837-37080859 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
905427404 1:37896447-37896469 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
905673471 1:39808338-39808360 AGCTGCCCCGTCCAGGAGGTGGG + Intergenic
905673488 1:39808378-39808400 CACTGCCCCGTCTGGGAGGTGGG + Intergenic
905680904 1:39869950-39869972 GGCTGCCCCGTCTGGGAGGTGGG + Intronic
906308842 1:44738737-44738759 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
906308861 1:44738778-44738800 CGCCGCCCTGTCTGGGAGGTGGG + Intergenic
906355937 1:45106159-45106181 GGCCGCCCCGTCGGGGAAGTGGG + Intronic
906356000 1:45106340-45106362 GGCTGCCCCGTCTGGGATGTGGG + Intronic
906356034 1:45106451-45106473 GGCCGCCCTGTCTGGGAAGTGGG + Intronic
906399991 1:45497733-45497755 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
906740193 1:48174545-48174567 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
906761724 1:48383095-48383117 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
906761936 1:48383646-48383668 CGCAGCCCTGTCTGGGAGGTGGG - Intronic
907202887 1:52742958-52742980 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
907402581 1:54233690-54233712 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
907402604 1:54233739-54233761 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
908370320 1:63473546-63473568 AGCTGCCCCATCTGGGAGGGGGG + Intronic
908468003 1:64415394-64415416 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
909893334 1:81035407-81035429 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
909893355 1:81035449-81035471 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
910406878 1:86899603-86899625 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
910412637 1:86963753-86963775 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
910412713 1:86963905-86963927 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
910807279 1:91201258-91201280 GGCTGTCCTGTCTGGGGAGGAGG + Intergenic
910815673 1:91288968-91288990 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
910815691 1:91289010-91289032 AGCTGCCCCATCCGGGAGGTGGG - Intronic
910891586 1:92025948-92025970 AGCTGCCCCGTCAGGGAGGGAGG - Intergenic
911486650 1:98512777-98512799 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
911533945 1:99078554-99078576 AGCCGCCCCGTCCGGGAGGTCGG - Intergenic
911598631 1:99823813-99823835 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
911634022 1:100213521-100213543 GGCTGTCCCGTCTGCAGGGTCGG + Intronic
912355801 1:109053493-109053515 AGCTGCCCCGTCCAGGAGGTGGG + Intergenic
912751805 1:112293611-112293633 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
912844016 1:113063568-113063590 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
912966644 1:114242470-114242492 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912966658 1:114242507-114242529 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912966674 1:114242547-114242569 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912966688 1:114242584-114242606 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912990272 1:114479839-114479861 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
913078244 1:115359789-115359811 AGCCGCCCCATCTGGGAGGTGGG - Intergenic
913078323 1:115360053-115360075 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
913078408 1:115360333-115360355 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
913293931 1:117300770-117300792 CGCCGCCCCATCTGGGAGGTGGG - Intergenic
913580708 1:120224393-120224415 GTCTGCCCCTACTGGGGGGGGGG + Intergenic
914231053 1:145764823-145764845 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
914374630 1:147062130-147062152 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
914468185 1:147949810-147949832 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
914787992 1:150851130-150851152 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
914788051 1:150851261-150851283 CGCCGCCCCGTCCGGGAGGTGGG + Intronic
914893756 1:151651243-151651265 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
914908959 1:151769297-151769319 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
914908978 1:151769339-151769361 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
914919818 1:151839202-151839224 GGCGGCGCAGTCTGGGGGGCTGG + Exonic
914953941 1:152144868-152144890 AGCCGCCCCGTCCGGGAGGTTGG - Intergenic
914965762 1:152256227-152256249 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
914987304 1:152471997-152472019 AGCTGCCCCATCTGGGAGGTGGG - Intergenic
915112824 1:153575322-153575344 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
915113943 1:153583248-153583270 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
915725057 1:158011522-158011544 GGCTGCCCTGTGGGAGGGGTTGG + Intronic
915861578 1:159449961-159449983 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
916037381 1:160933473-160933495 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
916037401 1:160933515-160933537 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
916050054 1:161029726-161029748 AGCCGCCCCGTCTGGGAAGTGGG + Intronic
916050092 1:161029808-161029830 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
916087398 1:161281433-161281455 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
916087439 1:161281525-161281547 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
916087459 1:161281571-161281593 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
916104959 1:161423477-161423499 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
916320331 1:163498433-163498455 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
916320397 1:163498662-163498684 GGCTGCCCCATCTGGGAGGTAGG - Intergenic
916320419 1:163498733-163498755 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
916320460 1:163498883-163498905 GACCGCCCCATCTGGGAGGTGGG - Intergenic
916320528 1:163499110-163499132 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
916320540 1:163499147-163499169 GGCCACCCCGTCTGGGAGGTGGG - Intergenic
916671965 1:167029778-167029800 AGCCACCCCGTCTGGGAGGTCGG + Intergenic
916759829 1:167806318-167806340 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
916759852 1:167806395-167806417 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
916799986 1:168207758-168207780 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
916864160 1:168837522-168837544 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
917304722 1:173613624-173613646 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
917304742 1:173613670-173613692 CGCCGCCCCGTCCGGGAGGTTGG + Intronic
917375588 1:174349113-174349135 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
917375863 1:174349745-174349767 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
917582796 1:176395962-176395984 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
917582843 1:176396089-176396111 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
917583114 1:176396744-176396766 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
917859987 1:179135752-179135774 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
918022724 1:180710881-180710903 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
918172496 1:182011032-182011054 AGCTGCCCCGTCCAGGAGGTGGG + Intergenic
918228618 1:182509503-182509525 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
918701708 1:187616093-187616115 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
918701720 1:187616130-187616152 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
918701827 1:187616511-187616533 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
918701840 1:187616548-187616570 GGCCGCCCTGTCTGGGAAGTGGG + Intergenic
918701883 1:187616698-187616720 GGCAGCCCTGTCTGGGAAGTGGG + Intergenic
918701936 1:187616885-187616907 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
918701960 1:187616959-187616981 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
918812463 1:189139764-189139786 TGCCGCCCCGTCTGGGAGGTGGG - Intergenic
918812479 1:189139805-189139827 AGCTGCCCCATCCGGGAGGTGGG - Intergenic
918818839 1:189225893-189225915 GGCTGCCCCGTCTGAGAAGTGGG + Intergenic
918818854 1:189225933-189225955 AGCCGCCCCGTCCGGGAGGTTGG + Intergenic
918818875 1:189225975-189225997 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
918818890 1:189226011-189226033 GGCCGCCCGGTCTGGGAAGTGGG + Intergenic
919520759 1:198584189-198584211 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
919520771 1:198584226-198584248 GGCCGCTCCGTCTGGGAGGTGGG - Intergenic
919520785 1:198584263-198584285 GGCCGCTCCGTCTGGGAGGTGGG - Intergenic
919918551 1:202154106-202154128 AGCTGCCCTGTGTGTGGGGTGGG + Intronic
919959386 1:202451763-202451785 AGCCGCCCCGTCCGGGAGGTCGG - Intronic
919959406 1:202451810-202451832 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
919995011 1:202740371-202740393 GGCTGCCCTGTCCGGGAGGGAGG - Intronic
920065503 1:203266721-203266743 GGCCGCCCCGTCTGGGGGGTGGG - Intronic
920065521 1:203266758-203266780 AGCCGCCCCATCTGGGAGGTGGG - Intronic
920143862 1:203841746-203841768 CACTGCCCCGTCTGGGAGGTGGG - Intronic
920152225 1:203919335-203919357 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
920451592 1:206064365-206064387 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
920451701 1:206064629-206064651 GGCCGCCCCGTCCCGGGGGGAGG + Intronic
920676499 1:208041981-208042003 GGGTGCCCCTTCTGGGGAGTGGG + Intronic
920795049 1:209129506-209129528 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
920872485 1:209805883-209805905 GGCTCCCCCGTGGGTGGGGTAGG - Intronic
921043856 1:211460219-211460241 GGCTGCCCAGTCTGGAAGGTGGG + Intergenic
921043898 1:211460375-211460397 CGCCGCCCCGTCTGGGATGTGGG + Intergenic
921142351 1:212320587-212320609 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
921192822 1:212725077-212725099 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
921192842 1:212725122-212725144 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
921192860 1:212725162-212725184 CGCTGCCCTGTCTGGGAGGTGGG + Intergenic
921198106 1:212779208-212779230 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
921237755 1:213151006-213151028 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
921238092 1:213151793-213151815 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
921414271 1:214869822-214869844 AGCTGCCCCATCTGGGAGGGAGG - Intergenic
922102717 1:222488372-222488394 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
922632915 1:227133189-227133211 GGCTGCCCCGTCTGGGAGGGAGG + Intronic
922644911 1:227276427-227276449 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
923589869 1:235309200-235309222 GGCCGCCCCGTCTGAGAAGTGGG + Intronic
923862606 1:237906486-237906508 GGCTGCACTGCCTGAGGGGTGGG - Intergenic
924824156 1:247522185-247522207 AGCCGCCCTGTCTGGGAGGTGGG + Intronic
924824214 1:247522317-247522339 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
924943724 1:248830379-248830401 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1062763960 10:47557-47579 GGCTGCCCCGGCTGGTCAGTGGG + Exonic
1063438843 10:6055796-6055818 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1063776711 10:9273249-9273271 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1063776744 10:9273326-9273348 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1063822643 10:9855556-9855578 GGCAGCCCCGACTGGGAGGTGGG - Intergenic
1063822676 10:9855633-9855655 GGCCGCCCGGTCTGGGAAGTGGG - Intergenic
1063822692 10:9855670-9855692 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1064109073 10:12522929-12522951 AGCCGCCCCGTCTGGGAGGCAGG - Intronic
1065055482 10:21837986-21838008 AGCCGCCCCGGCTGGGAGGTGGG + Intronic
1065055498 10:21838026-21838048 CGCTGCCCCGTCCGGGAGGTGGG + Intronic
1065738085 10:28772021-28772043 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1066086792 10:31979239-31979261 CACTGCCCCGTCTGCGAGGTGGG - Intergenic
1066140458 10:32500157-32500179 AGCCGCCCCGTCTGGGAAGTGGG - Intronic
1066140473 10:32500194-32500216 GGCCGCCCCATCCGGGAGGTGGG - Intronic
1066325373 10:34353110-34353132 AGCCGCCCCGTCTGGGAAGTGGG + Intronic
1067024006 10:42827640-42827662 GGCTGATCCCTCTGGGGGATGGG + Intronic
1067086542 10:43243333-43243355 GGCCGCCCCATCTGGGAAGTGGG + Intronic
1067086603 10:43243518-43243540 GGCCGCCCCGCCTGGGAAGTGGG + Intronic
1067098247 10:43316343-43316365 GGCTTCCCCTGGTGGGGGGTGGG - Intergenic
1067100359 10:43329898-43329920 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
1067100395 10:43330006-43330028 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1067117379 10:43446270-43446292 AGCCACCCCGTCTGGGAGGTGGG - Intronic
1067117397 10:43446310-43446332 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1067391152 10:45865380-45865402 TGCCGCCCCGTCTGGGCGGTGGG - Intergenic
1067391193 10:45865470-45865492 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1067391214 10:45865513-45865535 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1067872065 10:49970598-49970620 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1067872087 10:49970641-49970663 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1067872127 10:49970731-49970753 TGCCGCCCCGTCTGGGAGGTGGG + Intronic
1068005952 10:51392871-51392893 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1068536269 10:58244093-58244115 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
1068536352 10:58244349-58244371 GGCCGCCCCCTCTGGGAAGTGGG + Intronic
1068673267 10:59744468-59744490 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1068673287 10:59744509-59744531 TGCCACCCCGTCTGGGAGGTGGG + Intergenic
1068783317 10:60944244-60944266 GGCTGCCCCGCCTGGGAGCGGGG - Exonic
1069365719 10:67691864-67691886 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1069645407 10:69992972-69992994 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1069645472 10:69993179-69993201 CGCAGCCCTGTCTGGGAGGTGGG - Intergenic
1069674641 10:70238897-70238919 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1069674724 10:70239201-70239223 AGCTGCCCCATCTGGGAAGTGGG - Intergenic
1069674789 10:70239428-70239450 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1069674872 10:70239734-70239756 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1069698920 10:70407742-70407764 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1069741297 10:70687699-70687721 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1069799826 10:71075217-71075239 AGCTGCACCCTCTGGGAGGTGGG - Intergenic
1069928869 10:71869477-71869499 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1069928990 10:71869750-71869772 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1069929993 10:71875788-71875810 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1069930017 10:71875837-71875859 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1070135529 10:73689961-73689983 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1070138335 10:73715571-73715593 GGCTGCCCCGTCTGGGATGTGGG - Intergenic
1070367360 10:75750308-75750330 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1070807442 10:79279029-79279051 CGCCGCCCCGTCTGGGACGTGGG - Intronic
1070807461 10:79279070-79279092 AGCTGCCCCGTCCTGGAGGTGGG - Intronic
1070807479 10:79279112-79279134 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1070807498 10:79279154-79279176 AGCTGCCCCGTCCGGGAGGTCGG - Intronic
1071311341 10:84347370-84347392 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1071476803 10:86032265-86032287 GGCCACCCCGTCTGGGAGGTGGG + Intronic
1071509169 10:86250581-86250603 AGCTGCCCAGTCTGGGAGGTGGG + Intronic
1071509186 10:86250623-86250645 AGCTGCCCTGTCTGGGAGGTGGG + Intronic
1071509221 10:86250706-86250728 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
1071509252 10:86250783-86250805 CGCCACCCCGTCTGGGAGGTGGG + Intronic
1072013351 10:91323228-91323250 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1072149690 10:92674702-92674724 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1072149741 10:92674800-92674822 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1072256994 10:93630343-93630365 GGCTGGCCCTTCTGGTGGGCTGG - Intronic
1072480849 10:95809351-95809373 GGCCGCCCCGTCTTGGGGGTGGG - Intronic
1072480866 10:95809388-95809410 GGCCTCCCCGTCTGGGGGGTGGG - Intronic
1072480883 10:95809425-95809447 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480899 10:95809462-95809484 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480914 10:95809499-95809521 ATCTGCCCCGTCTGGGAGGTGGG - Intronic
1072480945 10:95809580-95809602 ATCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480958 10:95809620-95809642 ATCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480972 10:95809660-95809682 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1072480987 10:95809700-95809722 GGCCACCCCGTCTGGGGGGTGGG - Intronic
1072481004 10:95809740-95809762 AGCCGCCCCATCTGGGAGGTGGG - Intronic
1072481017 10:95809777-95809799 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
1072481029 10:95809814-95809836 CGCTGCCCCGTCTGGGAAGTGGG - Intronic
1072772505 10:98153014-98153036 CGCCGCCCCGTCCGGGAGGTGGG + Intronic
1073159666 10:101380543-101380565 CGCTGCCCTGTCTGGGAAGTGGG - Intronic
1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG + Intronic
1074152031 10:110767176-110767198 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1075013857 10:118895826-118895848 CGCTGCCCCGTCCGGGAGGTAGG + Intergenic
1075050904 10:119182174-119182196 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1075108487 10:119559510-119559532 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1075108507 10:119559552-119559574 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1075137143 10:119795141-119795163 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1075243397 10:120798707-120798729 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1075243419 10:120798751-120798773 AGCCGCCCCGTCTGGGAGGTTGG + Intergenic
1075614699 10:123882818-123882840 GGCTGCCCAGGCTGTGGAGTTGG - Intronic
1075892935 10:125970217-125970239 GGCCGCCCCCTCTGGGGGGTGGG - Intronic
1075892967 10:125970293-125970315 CGCCGCCCCGTCTGGGAGGCAGG - Intronic
1076063204 10:127429199-127429221 GGTCACCCCGTCTAGGGGGTGGG + Intronic
1076351160 10:129816096-129816118 GGCTGGCCCGGCAGGAGGGTGGG - Intergenic
1076381333 10:130026383-130026405 TGCTGACCAGTGTGGGGGGTGGG + Intergenic
1076628221 10:131834657-131834679 GACTGTCCAGTCTGTGGGGTGGG - Intergenic
1076821782 10:132943243-132943265 AGCAGCCCCGGCTGGGAGGTGGG - Intergenic
1076887112 10:133267978-133268000 GGCTGGCCCGGGTGGGTGGTGGG + Exonic
1076911571 10:133392682-133392704 GGCTGCCCCCTCTGGGTGTGAGG + Intronic
1077018422 11:407000-407022 GGCGGGACCGTCAGGGGGGTGGG + Intronic
1077040149 11:517340-517362 GGCCGCCCGGTCTGGGAAGTGGG + Intergenic
1077040160 11:517374-517396 AGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1077040208 11:517525-517547 GACTGCCCCGTCTGGGAAGTGGG + Intergenic
1077344583 11:2040335-2040357 GGCTGCCCCCTTGGGGGGCTGGG - Intergenic
1077685090 11:4283455-4283477 GGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1077690098 11:4334474-4334496 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1077839709 11:5961112-5961134 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1078122447 11:8523640-8523662 AGCTGCCCAGTCCGGGAGGTGGG + Intronic
1078122480 11:8523721-8523743 CACCGCCCCGTCTGGGAGGTGGG + Intronic
1078905736 11:15686392-15686414 AGCCGCCCCGTCTGAGAGGTGGG - Intergenic
1078905753 11:15686434-15686456 TGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1079479240 11:20863283-20863305 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1080098171 11:28430701-28430723 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1080538432 11:33243933-33243955 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1080538452 11:33243979-33244001 AGCCGCCCTGTCTGGGAGGTGGG + Intergenic
1080860247 11:36145132-36145154 AGCTGCCCCATCTGGGAGGGAGG + Intronic
1080860270 11:36145181-36145203 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1080860347 11:36145358-36145380 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1081288936 11:41304549-41304571 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1081288960 11:41304598-41304620 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1081289028 11:41304745-41304767 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1081808482 11:45902523-45902545 TGCTGCCCCGCCTGGGGGTCGGG + Exonic
1081950212 11:47038165-47038187 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1081950338 11:47038467-47038489 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1082065102 11:47893056-47893078 AGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1082065129 11:47893136-47893158 AGCCGCCCCGTCCGGGAGGTTGG + Intergenic
1082065150 11:47893178-47893200 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1082166325 11:48955428-48955450 CACCGCCCCGTCTGGGAGGTGGG - Intergenic
1082166345 11:48955468-48955490 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1082245010 11:49911686-49911708 CACTGCCCTGTCTGGGAGGTGGG - Intergenic
1082706241 11:56497364-56497386 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1082706263 11:56497410-56497432 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1082870962 11:57943783-57943805 CACTGCCCCATCTGGGAGGTGGG - Intergenic
1083079146 11:60073111-60073133 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1083120827 11:60510448-60510470 AGCTGCCCCATCTGGGAGGTGGG + Intergenic
1083120864 11:60510531-60510553 AGCCGCCCTGTCTGGGAGGTGGG + Intergenic
1083120881 11:60510572-60510594 CGCCGCCCCATCTGGGAGGTTGG + Intergenic
1083130814 11:60622441-60622463 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1083130919 11:60622695-60622717 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1083131071 11:60623047-60623069 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1083208234 11:61166399-61166421 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1083739663 11:64701978-64702000 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1083865545 11:65451373-65451395 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1083865593 11:65451472-65451494 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1083865666 11:65451648-65451670 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1083890282 11:65592456-65592478 GGCCGCCCCGCCCGTGGGGTCGG - Exonic
1083917959 11:65762783-65762805 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1084003540 11:66311813-66311835 GGCTGTCCCGTGGGGGGAGTCGG + Intergenic
1084645820 11:70457036-70457058 GGCCGCCCCGTCTGGGAAATGGG - Intergenic
1084745496 11:71167427-71167449 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1084745644 11:71167808-71167830 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1084839302 11:71831658-71831680 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1084904865 11:72337895-72337917 GGCTTCCCTGTCTGGGGGCCAGG + Intronic
1084924667 11:72502379-72502401 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1085097823 11:73775226-73775248 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1085097845 11:73775272-73775294 AGCTGCCCCGTCAGGGAGGGAGG + Intergenic
1085097866 11:73775318-73775340 AGCTGCCCCGTCAGGGAGGGAGG + Intergenic
1085097886 11:73775364-73775386 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1085116447 11:73936228-73936250 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1085116565 11:73936502-73936524 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1085116617 11:73936629-73936651 AGCTGCCCCATCTGGGAGGGAGG - Intergenic
1085159672 11:74328533-74328555 TGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1085288347 11:75378955-75378977 TGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1085360092 11:75877970-75877992 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1085513113 11:77098290-77098312 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1085563274 11:77490433-77490455 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1085609473 11:77933795-77933817 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1085716691 11:78879385-78879407 AGCCGCCCTGTCTGGGAGGTGGG + Intronic
1085716704 11:78879422-78879444 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1085716745 11:78879576-78879598 GGCCGCCCTGTCTGGGATGTGGG + Intronic
1085716758 11:78879613-78879635 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1085791353 11:79500100-79500122 GGCCGCCCCGTCCAGGAGGTAGG + Intergenic
1085791392 11:79500182-79500204 CGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1086366191 11:86111003-86111025 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1087214790 11:95482709-95482731 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1088116309 11:106317610-106317632 CGCGACCCCGTCTGGGAGGTGGG - Intergenic
1088658896 11:112027004-112027026 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1089148513 11:116347316-116347338 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
1089520382 11:119059207-119059229 CGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1089533986 11:119149600-119149622 GGCTGCCCGCTCTAGGAGGTCGG - Intronic
1089585550 11:119507855-119507877 AGCCGCCCCGTCCGGGAGGTAGG - Intergenic
1090075707 11:123578868-123578890 GGCTGCGCTGACTGGGGGGCAGG + Intronic
1090181575 11:124704634-124704656 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1090181597 11:124704682-124704704 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1090400113 11:126443563-126443585 GGCTGCCACGACTCTGGGGTGGG + Intronic
1090430954 11:126646114-126646136 TGCTGACCTGTTTGGGGGGTGGG - Intronic
1090669014 11:128933214-128933236 GGCTGCCCCGTCCATGGGGTAGG - Intergenic
1090686738 11:129129437-129129459 CACTGCCCCGTCTGGGAGGTGGG + Intronic
1202827569 11_KI270721v1_random:95524-95546 GGCTGCCCCCTTGGGGGGCTGGG - Intergenic
1092331288 12:7589867-7589889 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1092591111 12:9953334-9953356 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1093431676 12:19092184-19092206 GTCCGCCCCATCTGGGAGGTGGG + Intergenic
1093528776 12:20136138-20136160 GGATGCCCCAGCTGGGGGGATGG - Intergenic
1093932398 12:24967255-24967277 AGCTGTCCCGTCTGCAGGGTCGG - Intergenic
1095103125 12:38203259-38203281 GGCTGCCCCGGCTGGTCAGTGGG - Intergenic
1095113812 12:38330331-38330353 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1095281047 12:40353052-40353074 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
1095452743 12:42350000-42350022 GGCCACCCCCTCTGGGGGGTGGG - Intronic
1095452760 12:42350037-42350059 AGCCGCCCTGTCTGGGAGGTGGG - Intronic
1095452779 12:42350077-42350099 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1095452798 12:42350117-42350139 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1095774905 12:46000426-46000448 AGGTGCCCCGTCTGGGAAGTGGG + Intergenic
1096041355 12:48520398-48520420 CACTGCCCCGTCCGGGAGGTGGG - Intronic
1096041372 12:48520442-48520464 AGCTGCCCCGTCAGGGAGGGAGG - Intronic
1096041393 12:48520489-48520511 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1096225070 12:49861249-49861271 GGCCGCCCCTACTGGGAGGTGGG + Intergenic
1096241292 12:49961673-49961695 GGCTGCCCCGGCCGGGGGGCGGG + Intergenic
1096708378 12:53437692-53437714 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1096965159 12:55620432-55620454 GGCAGCACCTTCTGGGTGGTGGG + Intergenic
1096968627 12:55648308-55648330 CGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1096968646 12:55648349-55648371 AGCCGCCCCGTCGGGGAGGTGGG - Intergenic
1097089419 12:56494054-56494076 GGCCGCCCTGTCTGGGAAGTGGG - Intergenic
1097089431 12:56494091-56494113 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1097089458 12:56494181-56494203 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1097089470 12:56494218-56494240 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1097089503 12:56494343-56494365 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1097089516 12:56494380-56494402 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1097089554 12:56494507-56494529 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1097089566 12:56494544-56494566 GGCCTCCCCGTCTGGGAAGTGGG - Intergenic
1097110060 12:56651772-56651794 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1097138534 12:56879538-56879560 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1097138549 12:56879578-56879600 AGCTGCCCCGTCTGGGAGGTTGG + Intergenic
1097138569 12:56879620-56879642 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
1097149209 12:56963876-56963898 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1097254736 12:57665000-57665022 GGCCGCCCTGTCTGGGAAGTGGG + Intergenic
1097254836 12:57665386-57665408 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
1097254848 12:57665423-57665445 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
1097626757 12:62010685-62010707 AGCTGCCCCGTCTGGGAAGTGGG + Intronic
1097626862 12:62010988-62011010 GGCCACCCCGTCTGGGAAGTGGG + Intronic
1097626878 12:62011025-62011047 GGCCACCCCATCTGGGAGGTGGG + Intronic
1097626892 12:62011062-62011084 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1098019224 12:66135411-66135433 AGCTGCCCCGTCTGGGAGGGAGG + Intronic
1098333056 12:69374971-69374993 CGCCGCCCTGTCTGGGAGGTGGG - Intronic
1098333075 12:69375011-69375033 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1098370857 12:69759576-69759598 CGCCGCCCCGTCCGGGAGGTCGG - Intronic
1098370895 12:69759663-69759685 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1098375201 12:69807370-69807392 GGCCGCCCCGTCAGGGAGGTGGG - Intronic
1098379414 12:69853178-69853200 AGCTGCCCCGTCCGGGAGATGGG - Intronic
1098412581 12:70201816-70201838 CGCAGCCCTGTCTGGGAGGTGGG + Intergenic
1098412795 12:70202365-70202387 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1098773855 12:74588121-74588143 CGCCGCCCCATCTGGGAGGTGGG - Intergenic
1100048279 12:90411339-90411361 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1100582418 12:95948336-95948358 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1100582496 12:95948515-95948537 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1101393433 12:104323592-104323614 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1101853154 12:108420656-108420678 CATTGCCCCGTCTGGGAGGTGGG + Intergenic
1102174879 12:110867588-110867610 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1102186260 12:110950831-110950853 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1102186312 12:110950958-110950980 AGCCGCCCCGTCTGGGAGGCAGG - Intergenic
1102268354 12:111507562-111507584 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1102293969 12:111723333-111723355 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1102323366 12:111957515-111957537 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1102323386 12:111957557-111957579 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1102323406 12:111957599-111957621 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1102323437 12:111957676-111957698 CGCCGTCCCGTCTGGGAGGTGGG + Intronic
1102578556 12:113872456-113872478 GGCCGCCCCTACTGGGAGGTGGG + Intronic
1102656252 12:114484850-114484872 GGCAGCCCCGTCTGGGGGGTGGG - Intergenic
1102656272 12:114484887-114484909 GGCCGCCCTGTCTGGGATGTGGG - Intergenic
1103123173 12:118397860-118397882 GGCTGCCAAGACTGGGGAGTGGG - Intronic
1103350095 12:120278143-120278165 GGCTGCCCCATCAGGGAGGTGGG - Intergenic
1103350109 12:120278180-120278202 GGACACCCCGTCTGGGAGGTGGG - Intergenic
1103350137 12:120278256-120278278 GGCTCCCCCGTCTGGGAGGTGGG - Intergenic
1103350162 12:120278327-120278349 GGCCGCCCCGTCTGTGAAGTGGG - Intergenic
1103457383 12:121076928-121076950 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1103457407 12:121076977-121076999 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1103776839 12:123372217-123372239 CGCCGCCCCGTCTGGGAGGCGGG + Intergenic
1103872505 12:124101788-124101810 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1104712564 12:130996670-130996692 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1104712788 12:130997190-130997212 AGCTGCCCCGTCCGGGGGGGGGG - Intronic
1105248517 13:18674059-18674081 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1105267622 13:18836554-18836576 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1105267792 13:18837198-18837220 GGCTGCCCTGTCTTGGAAGTGGG - Intergenic
1105267813 13:18837272-18837294 GGCCGCCCCGTCTGGGATGTGGG - Intergenic
1105927453 13:25019964-25019986 GGCTGCCCCGTCTGGGATGTGGG - Intergenic
1105980372 13:25512697-25512719 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1106481619 13:30141199-30141221 GGGTGCTGCGTCTGGAGGGTGGG - Intergenic
1106559987 13:30839311-30839333 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1106747031 13:32716994-32717016 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1106747570 13:32721234-32721256 AGCCACCCCGTCTGGGAGGTGGG - Intronic
1106747589 13:32721274-32721296 AGCCACCCCGTCTGGGAGGTGGG - Intronic
1106747608 13:32721314-32721336 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1106747625 13:32721354-32721376 AGCCACCCCGTCTGGGAGGTGGG - Intronic
1106885629 13:34181515-34181537 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1107042842 13:35967229-35967251 CGCCGCCCCGTCTGGGAGGTTGG + Intronic
1107165838 13:37280418-37280440 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1107251089 13:38363924-38363946 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107251109 13:38363965-38363987 CGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1107562737 13:41572199-41572221 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1107644059 13:42476327-42476349 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107644074 13:42476364-42476386 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107644089 13:42476401-42476423 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107737543 13:43415851-43415873 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
1107737555 13:43415888-43415910 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
1107737586 13:43415999-43416021 GGCTGCCCCGTCTGGGAGATGGG - Intronic
1107737620 13:43416112-43416134 GGCCACCCCGTCTGGGAAGTGGG - Intronic
1107737660 13:43416262-43416284 GGCCGCCCCGTCTGGGAGATGGG - Intronic
1107737672 13:43416299-43416321 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
1108059169 13:46515569-46515591 AGCTGCCCCGTCCGGGAGGGCGG - Intergenic
1108259704 13:48644371-48644393 GGCTGACCCTTCTGGGTGTTAGG - Intergenic
1108608785 13:52064379-52064401 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1108608833 13:52064474-52064496 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1108685894 13:52818237-52818259 AGCCGCCTCGTCTGGGAGGTGGG + Intergenic
1110506672 13:76295222-76295244 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1110922206 13:81102362-81102384 AGCTGCCCCATCTGGGAGGGAGG + Intergenic
1111230580 13:85340716-85340738 AGCCGCCCCGTCAGGGAGGTAGG - Intergenic
1111418233 13:87976428-87976450 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1111830632 13:93324736-93324758 GGCTGTCTCATATGGGGGGTTGG + Intronic
1112055993 13:95690803-95690825 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1112077193 13:95928219-95928241 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1113573987 13:111381877-111381899 GGCTGTGCTGACTGGGGGGTGGG + Intergenic
1113737428 13:112689041-112689063 CGCTGCCCCGTCTGGGTCTTAGG - Intergenic
1114137319 14:19866676-19866698 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1114165358 14:20213123-20213145 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1114336669 14:21697938-21697960 AGCTGCCCCGTCAGGGAGGTGGG + Intergenic
1114427861 14:22637659-22637681 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1114507993 14:23232666-23232688 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1114508039 14:23232761-23232783 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1114568251 14:23647896-23647918 GGCTGCCCACTCTGGAAGGTGGG + Intergenic
1114594245 14:23898288-23898310 GGGCGCCACGTCTGGGGGGTGGG - Intergenic
1114594260 14:23898312-23898334 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1114594278 14:23898352-23898374 GGCTGCCCCATCTGGGAGGTGGG - Intergenic
1114659441 14:24335123-24335145 GGCTGTCCCGTCGGGGAAGTGGG - Intronic
1115259395 14:31437226-31437248 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1115324841 14:32127766-32127788 AGCCGCCCTGTCTCGGGGGTGGG - Intronic
1115324856 14:32127799-32127821 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1115493889 14:33984382-33984404 AGCTGCCCCGTCTGGGAGGTCGG - Intronic
1115622272 14:35152523-35152545 CGCTGCCCCATCCGGGAGGTGGG - Intronic
1115847493 14:37555332-37555354 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1115847541 14:37555430-37555452 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1116005197 14:39285344-39285366 CGCCGCCCCGTCCGGGAGGTGGG - Intronic
1116191571 14:41673634-41673656 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1116409155 14:44601591-44601613 AGCCGCCCCGTCCGGGAGGTAGG + Intergenic
1116409175 14:44601635-44601657 CGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1116502075 14:45635009-45635031 GGCTGCCCCGTCTGGGAAGCGGG + Intergenic
1116502137 14:45635196-45635218 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1116502148 14:45635233-45635255 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
1116502227 14:45635493-45635515 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1116502236 14:45635529-45635551 GGACGCCCCGTCTGGGAAGTGGG + Intergenic
1116502264 14:45635605-45635627 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502278 14:45635642-45635664 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502292 14:45635679-45635701 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502306 14:45635716-45635738 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502320 14:45635753-45635775 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502334 14:45635790-45635812 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502348 14:45635827-45635849 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116841272 14:49821612-49821634 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1116959617 14:50956497-50956519 CGACGCCCCGTCTGGGAGGTGGG - Intergenic
1116959634 14:50956537-50956559 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1117010626 14:51467558-51467580 AGCCGCCCCGTCCGGGAGGTTGG - Intergenic
1117277185 14:54203726-54203748 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1117458339 14:55920050-55920072 GGCCGCCATGTCTAGGGGGTGGG - Intergenic
1117596866 14:57333779-57333801 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1117597032 14:57334149-57334171 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1117849372 14:59951770-59951792 GTGTGCCCCTGCTGGGGGGTAGG + Intronic
1118148700 14:63165897-63165919 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1118209211 14:63751012-63751034 CGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1118423598 14:65633918-65633940 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1118428512 14:65692468-65692490 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1118430691 14:65716909-65716931 GGCCGCCCCATCTGGGAAGTGGG - Intronic
1118430704 14:65716946-65716968 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
1118430739 14:65717057-65717079 GGCCGCCCCATCTGGGAAGTGGG - Intronic
1118430897 14:65717621-65717643 GGCTGCCCCGTCTGGGAAGTGGG - Intronic
1118517445 14:66545298-66545320 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1118517644 14:66545748-66545770 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1118955590 14:70477697-70477719 AGCTGCCCCATCTGGGAGGTGGG + Intergenic
1118955609 14:70477739-70477761 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1118958182 14:70502041-70502063 GTCTGCCCCTACTGGGGGGGTGG - Intergenic
1119051777 14:71377126-71377148 GGCCGCCCCATCTGGGGGGTGGG - Intronic
1119051793 14:71377163-71377185 CGCCGCCCCATCTGGGAGGTGGG - Intronic
1119051834 14:71377245-71377267 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
1119254248 14:73184066-73184088 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1119721963 14:76898005-76898027 CACTGCCCCGTCTGGGAGGTGGG - Intergenic
1119722026 14:76898139-76898161 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1119835767 14:77747728-77747750 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1120087146 14:80286927-80286949 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1120087168 14:80286975-80286997 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1120087186 14:80287020-80287042 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1120170525 14:81244480-81244502 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1120406509 14:84099470-84099492 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1120505744 14:85352629-85352651 AGCTGCCCCATCTGGGAGGTGGG - Intergenic
1120505763 14:85352674-85352696 AGCTGCCCCGTCAGGGAGGGAGG - Intergenic
1120926698 14:89804168-89804190 TGCTTCCACGTTTGGGGGGTAGG - Intronic
1121580459 14:95026001-95026023 GGCTACCCCGTCTGGGGAAGAGG + Intergenic
1121681333 14:95795064-95795086 GGCTGCTCCTCCTGGGGAGTGGG + Intergenic
1122892641 14:104739973-104739995 GGCTGGCTCGTCCGGGGGTTGGG - Intronic
1122901582 14:104784353-104784375 GGCTGCCCTCGGTGGGGGGTAGG + Intronic
1202848124 14_GL000009v2_random:200161-200183 GGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1124132554 15:27003866-27003888 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1125031752 15:35081914-35081936 GGCCGCCCTGTCTGGGAAGTGGG + Intergenic
1125031874 15:35082330-35082352 GGCTGTCCCATCTGGGAAGTGGG + Intergenic
1125031918 15:35082477-35082499 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1125031951 15:35082585-35082607 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1125031975 15:35082661-35082683 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
1125031990 15:35082698-35082720 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1125200968 15:37100555-37100577 GACAGCCCCGGCTGGGGGGGTGG + Intronic
1125740752 15:41962696-41962718 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
1125817791 15:42601457-42601479 CGCCGCCCCGTCTGGGAGGTTGG - Intronic
1125817832 15:42601540-42601562 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1125817853 15:42601583-42601605 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1125861699 15:43005492-43005514 AGCCGCTCCGTCTGGGAGGTGGG + Intronic
1125999255 15:44194571-44194593 GGCCGCCCCGTCGGGGGCGCAGG - Intronic
1126210694 15:46098029-46098051 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1126516982 15:49549974-49549996 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1126573225 15:50172990-50173012 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1126573276 15:50173097-50173119 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
1126751871 15:51885844-51885866 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
1126751886 15:51885881-51885903 AGCCACCCCGTCTGGGAGGTGGG - Intronic
1126816468 15:52459760-52459782 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
1127088408 15:55445756-55445778 GGCCACCCCGTCTGGGAAGTGGG - Intronic
1127088755 15:55446975-55446997 AGCTGCCCCGTCTGGGAAGTGGG - Intronic
1127154180 15:56110067-56110089 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1127154383 15:56110518-56110540 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1127154564 15:56110950-56110972 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1127824203 15:62689895-62689917 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1128089980 15:64912623-64912645 GGCTGCACCGTCTGGGAGAGGGG + Intronic
1128489705 15:68134582-68134604 AGCCGCCCCGTCTGGGGGGTGGG - Intronic
1128489870 15:68134934-68134956 GGCCGCCCCGTCCGGGGGGTGGG - Intronic
1128490074 15:68135380-68135402 AGCCGCCCCGTCTGGGAGGGCGG - Intronic
1128490107 15:68135458-68135480 AGCCGCCCCGTCCGGGGGGTGGG - Intronic
1128521116 15:68375493-68375515 GGCTGCCCTGGCTGGGGGTTGGG + Intronic
1128970527 15:72101665-72101687 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1129341299 15:74888442-74888464 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1129405371 15:75313526-75313548 GGCTGCCCCATGTGGGTGTTAGG + Intergenic
1129431731 15:75504616-75504638 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1129479036 15:75808451-75808473 GGCTGCCCTACCTGGGGGTTAGG + Intergenic
1129812338 15:78520929-78520951 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1130428279 15:83822139-83822161 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1131001186 15:88941393-88941415 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1131108069 15:89747924-89747946 GGCTGCCCGGGATGGGGGTTGGG + Intergenic
1131127327 15:89868190-89868212 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1132499475 16:278949-278971 GGCTGCCCTGTCTGCAGGGGTGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132730398 16:1358149-1358171 GGCTGGCCTGGCTGGAGGGTAGG + Intronic
1132807019 16:1779551-1779573 GCCTGCCTTGTCTGTGGGGTGGG - Intronic
1132941110 16:2508774-2508796 GGCTGCCAGGTCTTGAGGGTAGG + Intronic
1132973715 16:2701334-2701356 AGCTGTCCCGGCTGTGGGGTGGG + Intronic
1133301605 16:4785997-4786019 AGCTGCAGCGTCTGGGGTGTGGG + Exonic
1133833876 16:9350299-9350321 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1133833912 16:9350407-9350429 AGCTGCCCTGTCTGGGAAGTGGG - Intergenic
1133833945 16:9350517-9350539 AGCTGCCCTGTCTGGGAAGTGGG - Intergenic
1134750102 16:16618985-16619007 AGCTGCCCCATCCGGGAGGTGGG - Intergenic
1135413065 16:22249641-22249663 TGCTGCCCAGGCTGGGGTGTAGG + Intronic
1135694273 16:24574077-24574099 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1135735848 16:24931245-24931267 GGCTGGCCCGTGTGCTGGGTGGG + Exonic
1136258833 16:29060261-29060283 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1136593689 16:31232646-31232668 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1136611526 16:31369302-31369324 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1136668613 16:31836655-31836677 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136881946 16:33907565-33907587 GGCACCCCCCTCTGGGGGGTCGG - Intergenic
1137244927 16:46694552-46694574 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1137284011 16:47000606-47000628 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1137388096 16:48059222-48059244 GGCCGCCCTGTCTGGGAGGTGGG - Intergenic
1137439000 16:48483027-48483049 CGCCGCCCCATCTGGGAGGTGGG - Intergenic
1137439019 16:48483067-48483089 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1137522986 16:49210346-49210368 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1137766173 16:50979355-50979377 GGATGTCCCGGCTGGGAGGTGGG + Intergenic
1137787723 16:51151803-51151825 AGCCGCCCCGGGTGGGGGGTGGG + Intergenic
1138037712 16:53625329-53625351 GGCTGCCCCATCTGGGTGGTGGG + Intronic
1138037746 16:53625411-53625433 GGCCGCCCCGTCTGGGGGGTGGG + Intronic
1138037767 16:53625456-53625478 AGCCGCCCCATCTGGGGGCTGGG + Intronic
1138037807 16:53625544-53625566 AGCCACCCCGTCTTGGGGGTGGG + Intronic
1138043541 16:53698518-53698540 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1138043635 16:53698742-53698764 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1138204416 16:55114472-55114494 GGCTGCACAGCCTGGTGGGTTGG - Intergenic
1138699267 16:58846140-58846162 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1139354581 16:66359995-66360017 GGCTGCACCATCTGTGGGGCAGG - Intergenic
1139885632 16:70205176-70205198 AGCTGCCCAGTCTGGGAGGGAGG + Intergenic
1140602948 16:76500150-76500172 TGCCACCCCGTCTGGGAGGTGGG - Intronic
1140994156 16:80243477-80243499 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1141618100 16:85221588-85221610 GGCAGCCCTGGCTGGGGAGTTGG - Intergenic
1142011820 16:87719072-87719094 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1142218525 16:88841619-88841641 GGCTCACCCGCCTGGGGAGTGGG + Intronic
1142287395 16:89177002-89177024 GGCTGCCCCGTCTCTGCGTTAGG + Intronic
1142332359 16:89462919-89462941 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1142440688 16:90095670-90095692 GGCTGCCCCGGCTGGTCAGTGGG - Intergenic
1203090065 16_KI270728v1_random:1207881-1207903 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1142718842 17:1763010-1763032 GGCTGCTGCTTCTGGGGTGTGGG + Intronic
1142789843 17:2255541-2255563 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1142789861 17:2255586-2255608 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1142913096 17:3112475-3112497 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1142939768 17:3371709-3371731 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1143585559 17:7848673-7848695 GGCTGGCCGGGCTGGGGGGTGGG - Exonic
1143884832 17:10057605-10057627 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1143884852 17:10057651-10057673 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1144541388 17:16145737-16145759 AGCCGCCCCATCCGGGGGGTGGG + Intronic
1144716918 17:17442428-17442450 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1144769584 17:17752283-17752305 GTCTGCCCGGGCTGGGGGCTGGG - Intronic
1145027082 17:19476054-19476076 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1145087159 17:19951298-19951320 CACTGCCCCGTCTGGGAGGTGGG + Intronic
1145927526 17:28659234-28659256 AGCCGCCCCGTCTGGGAAGTGGG - Intronic
1145927537 17:28659271-28659293 GGCTGCCCCGTCTGGGAAGTGGG - Intronic
1145927549 17:28659308-28659330 GGCCGCCCTGTCTGGGAAGTGGG - Intronic
1145927561 17:28659345-28659367 GGCTGCCCCGTCTGGGAAGTGGG - Intronic
1145982059 17:29018758-29018780 GGCTGCTCCGGGTGGGAGGTGGG + Intronic
1146155884 17:30523501-30523523 AGCTGCCCCGTCCGGGAGGGAGG + Exonic
1146215966 17:30979504-30979526 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1146339372 17:32006805-32006827 GGCTGCCACGCCTGGAGGGAGGG - Intergenic
1146361248 17:32179027-32179049 GGCCGCCCCGTCTGGGAAATGGG + Intronic
1146361259 17:32179064-32179086 GGCCGCCCCATCTGGGAAGTGGG + Intronic
1146361270 17:32179101-32179123 GGCTGCCCCGTCTGGGAAATGGG + Intronic
1146361305 17:32179215-32179237 GGCCGCCCCGTCTGGGAAATGGG + Intronic
1146361337 17:32179329-32179351 GGCTGCCCCATCTGGGAAGTGGG + Intronic
1146361348 17:32179366-32179388 GGCTGCCCCATCTGGGAAATGGG + Intronic
1146361445 17:32179706-32179728 GGCTGCCCCGTCTGGGAAGTGGG + Intronic
1146361467 17:32179780-32179802 GGCCACCCCGTCTGGGAAGTGGG + Intronic
1146361490 17:32179856-32179878 GGCTGCCCCATCTGGGAAATGGG + Intronic
1146444224 17:32922394-32922416 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1146695683 17:34907673-34907695 CGCTGCCCCATCCGGGAGGTGGG + Intergenic
1146731222 17:35195069-35195091 CGCTGCCCCGTCCGGGAGGTGGG - Intergenic
1146731243 17:35195115-35195137 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG + Intronic
1147444515 17:40466721-40466743 GGCTGCCCTGTCTGGGAGGATGG + Intergenic
1147974481 17:44238891-44238913 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1147998535 17:44374827-44374849 GGCTTCCCCGCCGGGGGTGTGGG - Intronic
1148155898 17:45425211-45425233 GGCTGCCCCACCTGGGGGTTGGG + Intronic
1148231039 17:45935205-45935227 GGCAGCCCCTACTGGGGGCTGGG + Intronic
1148245221 17:46025828-46025850 GGCTGGGCTGTCTGGGAGGTTGG - Exonic
1148422097 17:47556673-47556695 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1148632851 17:49125679-49125701 GGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1148636081 17:49150272-49150294 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1149592976 17:57846136-57846158 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1149593058 17:57846318-57846340 CACTGCCCCGTCCGGGAGGTGGG + Intronic
1149909092 17:60551900-60551922 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1149950169 17:60977031-60977053 CGCCACCCCGTCTGGGAGGTTGG - Intronic
1150061557 17:62073021-62073043 CGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1150214003 17:63456806-63456828 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1150214100 17:63457031-63457053 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1150221244 17:63497024-63497046 GGCTGCCCAGCCTGGGGAGGGGG - Intronic
1150387578 17:64773819-64773841 GGCTGCCCCAGCTGGAGGGTGGG + Intergenic
1150403004 17:64874499-64874521 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1150527435 17:65937769-65937791 AGCCGCCCCGTCTGGGAGGGGGG + Intronic
1150780274 17:68116250-68116272 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1150894571 17:69196114-69196136 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1151843771 17:76636673-76636695 CGCCGCCCCGTCTGGGAGGTCGG + Intronic
1151958618 17:77393212-77393234 TGCTGCCCGGTATGGGGGCTGGG - Intronic
1152696099 17:81797788-81797810 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1152696240 17:81798170-81798192 CGCAGCCCTGTCTGGGAGGTGGG - Intergenic
1152785473 17:82245785-82245807 CGCTGCCCAGTCTTGGGGGGAGG - Intronic
1152809986 17:82376817-82376839 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1152873875 17:82774641-82774663 CGCCGCTCCGTCTGGGAGGTGGG - Intronic
1152956867 18:47890-47912 GGCTGCCCCGGCTGGTCAGTGGG + Exonic
1153646873 18:7203738-7203760 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1153882107 18:9430502-9430524 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1154089639 18:11344842-11344864 AGCTGCCCCATCCGGGAGGTGGG + Intergenic
1154115268 18:11608778-11608800 GGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1154192646 18:12243408-12243430 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1154192658 18:12243445-12243467 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1154192678 18:12243516-12243538 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1154278503 18:12980579-12980601 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1154398147 18:14010599-14010621 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1154398292 18:14010951-14010973 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1154420257 18:14222974-14222996 GGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1154420461 18:14223732-14223754 GGCCGCCCCATCTGGGAAGTAGG + Intergenic
1154420514 18:14223920-14223942 GGCCGCCCCATCTGGGATGTGGG + Intergenic
1154420572 18:14224107-14224129 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
1154420618 18:14224257-14224279 GGCCGCCCCATCTGGGATGTGGG + Intergenic
1154420675 18:14224444-14224466 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
1154420697 18:14224518-14224540 AGCTGCCCCGCCTGGGAAGTGGG + Intergenic
1154420720 18:14224594-14224616 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
1154420760 18:14224744-14224766 GGCTGCCCCATCTGGGATGTGGG + Intergenic
1154420814 18:14224933-14224955 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
1154483087 18:14855878-14855900 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1154483447 18:14857277-14857299 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1154483867 18:14858897-14858919 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1154990244 18:21592661-21592683 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1155956487 18:31960415-31960437 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1156066392 18:33147957-33147979 CGCCGCCCCGTCCGGGAGGTGGG - Intronic
1156326254 18:36077627-36077649 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1157131478 18:45011695-45011717 GGCAGCCACGCCTGGGGAGTAGG - Intronic
1157455901 18:47828205-47828227 AGCCGCCCCGTCTGGGAGGGAGG + Exonic
1157455920 18:47828251-47828273 AGCCGCCCCGTCCGGGAGGTGGG + Exonic
1157455941 18:47828293-47828315 AGCTGCCCCGTTCGGGAGGTGGG + Exonic
1157705279 18:49800200-49800222 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1157799711 18:50609351-50609373 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1157857658 18:51117147-51117169 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1157857699 18:51117230-51117252 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1157857717 18:51117272-51117294 AGCTGCCCTGTCCGGGAGGTGGG - Intergenic
1158646942 18:59255825-59255847 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
1159614849 18:70569608-70569630 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1159614891 18:70569696-70569718 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1160034322 18:75286821-75286843 GGCAGCCGCGTGTGGGTGGTGGG - Exonic
1160228373 18:77028634-77028656 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1160465439 18:79072746-79072768 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1160796103 19:946111-946133 GGCTGGCCGGTCTGGGGGGCGGG + Intronic
1161311955 19:3599840-3599862 GGCTGCCCCTTCTGGTGAGTAGG - Exonic
1161382020 19:3970665-3970687 GGCGGCCCGTTTTGGGGGGTAGG - Intronic
1161395419 19:4042778-4042800 GGCTACCCCGCCTGGGGCCTCGG + Intergenic
1161630936 19:5355087-5355109 GGCGGCCCGGTCTGGGGGTGGGG - Intergenic
1161685839 19:5702228-5702250 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1161774766 19:6254260-6254282 GGCTGGCCCGTCTGAGGGCATGG + Intronic
1162098447 19:8324820-8324842 GTCTGCCCCGTCTGGGGAGTGGG + Exonic
1162255201 19:9483605-9483627 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1162255243 19:9483695-9483717 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
1162602036 19:11676815-11676837 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1162602076 19:11676911-11676933 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1162683314 19:12362649-12362671 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1163365456 19:16873525-16873547 GGGTGCCCAGCCTGGGGGGGGGG - Intronic
1163443060 19:17331271-17331293 TGCTGCCTGGGCTGGGGGGTGGG - Intronic
1163556909 19:17998333-17998355 GGCTGCCTGGTCTTGGGGGCCGG - Exonic
1163667954 19:18611887-18611909 TGCCGCCCCGTCTGCGGGGGCGG + Intronic
1163906419 19:20152624-20152646 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1163945222 19:20529824-20529846 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1163945443 19:20530323-20530345 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1163996100 19:21048775-21048797 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1164034761 19:21443626-21443648 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1164054038 19:21607110-21607132 AGCCGCCCCGTCTGGTAGGTGGG - Intergenic
1164065016 19:21708001-21708023 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1164065059 19:21708093-21708115 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1164081702 19:21865791-21865813 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1164105382 19:22105441-22105463 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1164105706 19:22106980-22107002 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1164168053 19:22700386-22700408 AGCTGCCCCATCCGGGAGGTGGG - Intergenic
1164168094 19:22700477-22700499 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1164168114 19:22700519-22700541 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1164168431 19:22702830-22702852 AGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1164168511 19:22703004-22703026 AGCTGCCCTGTCCGGGAGGTGGG - Intergenic
1164192181 19:22926349-22926371 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1164192254 19:22926525-22926547 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1164217196 19:23160838-23160860 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1164217248 19:23160957-23160979 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1164238953 19:23366257-23366279 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1164244699 19:23419459-23419481 AGCTGCCCCGTCCAGGAGGTGGG + Intergenic
1164264012 19:23595109-23595131 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1164659210 19:29948931-29948953 CGCGGTCCCGTCTGGGAGGTGGG - Intronic
1164659230 19:29948971-29948993 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1164659251 19:29949017-29949039 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1164659346 19:29949297-29949319 CGCCGCCCCGTCTGGGATGTGGG - Intronic
1164659376 19:29949413-29949435 GGCTGCCCAGTCTGGGAAGTGGG - Intronic
1165152056 19:33766724-33766746 GGCTGGCCCGACTGGGGGTGGGG - Intronic
1165215538 19:34269345-34269367 GGTTGACCCGTGTTGGGGGTGGG + Intronic
1166030097 19:40118744-40118766 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1166162842 19:40965976-40965998 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1166162970 19:40966278-40966300 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1166191839 19:41180810-41180832 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1166421322 19:42639396-42639418 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1166421387 19:42639539-42639561 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1166531990 19:43548176-43548198 CGCCGCCCCGTCCGGGAGGTGGG + Intronic
1166703436 19:44895280-44895302 GGCTACCCCGGCTGGGGGACAGG + Intronic
1166832725 19:45648243-45648265 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1167265117 19:48479243-48479265 AGCTGCCCCGCCTGGGTGGCCGG + Exonic
1167291050 19:48625384-48625406 CACTGCACCGTATGGGGGGTGGG + Intronic
1167907802 19:52676524-52676546 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1167913104 19:52720349-52720371 GGCCGCCCCGTCGGGGAGGTGGG - Intronic
1167913119 19:52720386-52720408 GGCCGCCCCATCTGGGAAGTGGG - Intronic
1167971077 19:53187890-53187912 CGCAGCCCTGTCTGGGAGGTGGG - Intronic
1168213474 19:54908580-54908602 CACTGCCCCGTCTGGGAGGTGGG - Intronic
1168213496 19:54908622-54908644 AGCCGCCCCGTCCGGGAGGTTGG - Intronic
925386969 2:3468667-3468689 GGCTGCCCCGCCGTGGGAGTGGG - Intronic
925407490 2:3615771-3615793 AGCCGCCCCATCTGGGAGGTGGG - Intronic
926252725 2:11165124-11165146 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
926574637 2:14566592-14566614 GGCTGGCCCTGCTGGGGGGCAGG - Intergenic
926674728 2:15611477-15611499 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
926674807 2:15611653-15611675 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
927591416 2:24360740-24360762 GGCTGCCAGGTCTGGGGCTTCGG - Intergenic
927776862 2:25910358-25910380 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
927833057 2:26370500-26370522 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
927833108 2:26370626-26370648 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
927877127 2:26665462-26665484 CACTGCCCCGTCTGGGAGGTGGG - Intergenic
927877147 2:26665506-26665528 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
928005466 2:27558211-27558233 CGCAGCCCTGTCTGGGAGGTGGG - Intronic
928541979 2:32293728-32293750 AGCCGCCCCGTCCGGGAGGTTGG - Intronic
928888911 2:36180366-36180388 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
929064969 2:37963909-37963931 CGCCGCCCCGTCCGGGAGGTGGG - Intronic
929066056 2:37977431-37977453 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
929066075 2:37977472-37977494 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
929447713 2:42014421-42014443 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
929447858 2:42014745-42014767 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
929577740 2:43063159-43063181 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
929650797 2:43677940-43677962 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
929690150 2:44067164-44067186 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
929690174 2:44067214-44067236 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
929690268 2:44067440-44067462 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
929739846 2:44588983-44589005 GGCTGCCCATTCTGGGAGGGAGG + Intronic
929739896 2:44589110-44589132 AGCCGCCCCGTCTGGGAGGGTGG + Intronic
930202047 2:48556582-48556604 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
930363609 2:50411675-50411697 AGCCGCCCTGTCTGGGAGGTGGG + Intronic
930590773 2:53323590-53323612 CGCTGCCCCGTCCGGGAGGTGGG - Intergenic
930665340 2:54095526-54095548 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
931479987 2:62630518-62630540 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
931480030 2:62630610-62630632 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
931515661 2:63049544-63049566 CGCTGCCCGGGCTGCGGGGTCGG - Intergenic
931655950 2:64511557-64511579 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
931752140 2:65339164-65339186 GGCCGCCCCTACTGGGAGGTGGG + Intronic
932410214 2:71542964-71542986 AGCTGCCCCGTCCGGGAGGTAGG - Intronic
932410254 2:71543052-71543074 AGCTGCCCAGTCCGGGAGGTGGG - Intronic
932621025 2:73265068-73265090 GGATGCCACATCTGGGGGGCAGG - Intronic
932719085 2:74124374-74124396 CACTGCCCCGTCTGGGAGGTGGG + Intergenic
933868426 2:86545404-86545426 GGCCACCCCGTCTGGGAAGTGGG - Intronic
933869012 2:86549170-86549192 GGCTGCCCAGTCTGGGAAGTGGG - Intronic
933869182 2:86549733-86549755 GGCCGCCCCGTCTGCGAAGTGGG - Intronic
934067219 2:88351065-88351087 GGCGGCGCCGGCTGGGGGATTGG + Intergenic
934128381 2:88920719-88920741 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
934128401 2:88920761-88920783 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
934128752 2:88926212-88926234 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
934522190 2:95026470-95026492 TTCTGCCCCGTGTGCGGGGTGGG + Intronic
934703501 2:96461728-96461750 AGCTGCCCCATCTGGGAGGGAGG + Intergenic
936504731 2:113096502-113096524 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
936546471 2:113395130-113395152 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
936546495 2:113395179-113395201 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
937947507 2:127353544-127353566 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
938105998 2:128530219-128530241 GGCAGCCCAGTGTGGGGAGTGGG + Intergenic
938253420 2:129833671-129833693 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
938534124 2:132221893-132221915 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
938720580 2:134063904-134063926 GGCTGCCCAGTCTGGAAAGTGGG + Intergenic
938828884 2:135033461-135033483 AGCCGCCCCGTCCGGGGGGTGGG - Intronic
938828937 2:135033587-135033609 AGCCGCCCCGTCTGGGAGGGCGG - Intronic
938836288 2:135106159-135106181 CGCCGCCCCGTCCGGGAGGTGGG + Intronic
938852466 2:135275216-135275238 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
939584618 2:143991409-143991431 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
939584721 2:143991663-143991685 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
939584766 2:143991760-143991782 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
940652306 2:156451531-156451553 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
940817224 2:158310515-158310537 GGCGGCCCCGTCTGGGGGGTGGG - Intronic
940817241 2:158310552-158310574 AGCCGCCCTGTCTGGGAGGTGGG - Intronic
941602839 2:167563242-167563264 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
941603080 2:167563833-167563855 GGCCGCCCCTGCTGGGAGGTGGG - Intergenic
941603116 2:167563917-167563939 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
941603138 2:167563964-167563986 GGCTGCCCCGTCCGGAAGGGAGG - Intergenic
941603261 2:167564366-167564388 GGCTGCCCAGTCTGGAGAGTGGG - Intergenic
941603285 2:167564442-167564464 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
941768862 2:169327289-169327311 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
941768933 2:169327462-169327484 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
941822310 2:169855940-169855962 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
941847913 2:170150257-170150279 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
942012231 2:171774881-171774903 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
942012250 2:171774926-171774948 CGCCGCCCCGTCCGGGAGGTGGG + Intergenic
942630652 2:177946761-177946783 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
943005853 2:182386821-182386843 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
943125742 2:183792241-183792263 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
943297092 2:186153973-186153995 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
943411903 2:187557136-187557158 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
943418385 2:187636964-187636986 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
943418411 2:187637040-187637062 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
943578139 2:189653881-189653903 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
943578156 2:189653918-189653940 GGCCGCCCTGTCTGGGAGGTGGG + Intergenic
943587713 2:189760348-189760370 AGCCGCCCCGTCTTAGGGGTGGG - Intronic
943587728 2:189760387-189760409 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
943648275 2:190430808-190430830 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
943739759 2:191397834-191397856 AGCCGCCCCGTCTGGGAGGGTGG - Intronic
943863191 2:192894180-192894202 CGCCACCCCGTCTGGGAGGTTGG + Intergenic
943863247 2:192894344-192894366 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
944060923 2:195568477-195568499 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
944570871 2:201042721-201042743 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
944570890 2:201042758-201042780 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
944570920 2:201042835-201042857 CGCCACCCCGTCTGGGAGGTGGG + Intronic
944733132 2:202535588-202535610 GGCTGCCCAGTCTGGAAAGTGGG - Intronic
944751491 2:202715125-202715147 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
944785677 2:203067063-203067085 GGCTGCCCTGTCTGGGAAGTGGG - Intronic
944815555 2:203372619-203372641 AGCTGCCCCGTCTGGGAGGGAGG - Intronic
945110619 2:206356912-206356934 GGCCGCCCCGTCCGGGAGGGAGG - Intergenic
945114919 2:206400878-206400900 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
945232927 2:207610483-207610505 CGCAGCCCTGTCTGGGAGGTGGG + Exonic
945306837 2:208266611-208266633 GGCTGCCTTGTCTGGCGAGTGGG + Intronic
945316613 2:208377509-208377531 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
945864770 2:215163325-215163347 AGCTGCCCCGTCCGGGAGGTGGG - Intergenic
946240117 2:218348900-218348922 AGCCGCCCCGTCCGGGAGGTTGG - Intergenic
946447308 2:219751121-219751143 GGCCGCCCCGTCCGGGAGGTGGG - Intergenic
946447320 2:219751145-219751167 AGCCGCCCCGTCAGGGAGGTGGG - Intergenic
947402390 2:229743037-229743059 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
947402458 2:229743183-229743205 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
947814150 2:233024597-233024619 AGCTGCCCCATCTGGTGGGAAGG - Intergenic
948210364 2:236188532-236188554 GGCTGCCAGGGCTGGGGGGAGGG + Intergenic
948589149 2:239038466-239038488 AGCCGCCCCATCTGGGAGGTGGG - Intergenic
948706448 2:239796019-239796041 AGCTGCCCCTTCCGGGAGGTGGG + Intronic
1169108750 20:3019039-3019061 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1169108801 20:3019166-3019188 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1169125620 20:3125070-3125092 GGCCGCCCCATCTGGGAAGTGGG + Intronic
1169125632 20:3125107-3125129 GGCCGCCCCGTCTGGAGGTGAGG + Intronic
1169441747 20:5639260-5639282 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1169788425 20:9385414-9385436 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1170202574 20:13760687-13760709 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1170664555 20:18375672-18375694 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1170664577 20:18375718-18375740 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1171463694 20:25312986-25313008 AGCCACCCCGTCTGGGAGGTGGG + Intronic
1172199644 20:33115813-33115835 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1172257980 20:33536312-33536334 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1172279345 20:33699385-33699407 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1172279419 20:33699535-33699557 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1172279865 20:33701185-33701207 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1172279994 20:33701620-33701642 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1172280020 20:33701670-33701692 GGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1172337918 20:34132650-34132672 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1172338113 20:34133108-34133130 GGCCGCCCCTGCTGGGAGGTGGG + Intergenic
1172349594 20:34230028-34230050 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1172359507 20:34302680-34302702 GGCTGCCCCTGCTGGAGGGGTGG + Intronic
1172402057 20:34659052-34659074 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1172575009 20:36001506-36001528 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1172735906 20:37126232-37126254 AGCTGCCCCGTCTGGGAGGGAGG + Intronic
1172739061 20:37151168-37151190 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1172819426 20:37718474-37718496 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1172910849 20:38407737-38407759 CGCCGCCCCGTCTGGATGGTAGG + Intergenic
1172918392 20:38461335-38461357 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1172923816 20:38511922-38511944 CGCCGCCCTGTCTGGGAGGTGGG - Intronic
1172923836 20:38511963-38511985 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1173192227 20:40885493-40885515 GGCTGGTCCTGCTGGGGGGTCGG - Intergenic
1174020568 20:47525775-47525797 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1175361168 20:58413787-58413809 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1175361239 20:58413963-58413985 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1175361400 20:58414335-58414357 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1175361417 20:58414375-58414397 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1175361432 20:58414415-58414437 GGCTGCCCCGTCTGAGGGGTGGG - Intronic
1175767171 20:61599560-61599582 GGCTGCCCCGCCTGGGAGGCTGG - Intronic
1176348338 21:5770773-5770795 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1176355152 21:5891357-5891379 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1176496489 21:7553682-7553704 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1176542659 21:8168843-8168865 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1176561610 21:8351888-8351910 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1176656675 21:9593749-9593771 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1176797107 21:13379149-13379171 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1176797516 21:13380699-13380721 AGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1176852776 21:13935397-13935419 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1176852889 21:13935814-13935836 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1176853006 21:13936226-13936248 AGCCGCCCCGTCTGGGATGTGGG - Intergenic
1176853065 21:13936454-13936476 GACCGCCCCGTCTGGGATGTGGG - Intergenic
1177178262 21:17720050-17720072 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1177788260 21:25695568-25695590 CGCCGCCCCGTCCGGGAGGTGGG - Intronic
1178873117 21:36392516-36392538 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1178873137 21:36392558-36392580 AGCTGCCCCGTCCAGGAGGTGGG - Intronic
1179195244 21:39157481-39157503 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1179646338 21:42778529-42778551 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1179646361 21:42778577-42778599 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1179657416 21:42853815-42853837 GGCTGCACCGTCTGGGGTGCTGG - Intronic
1179969349 21:44825288-44825310 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1180039596 21:45269013-45269035 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1180039647 21:45269140-45269162 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1180099308 21:45577036-45577058 GGCTGCCCTGTGTCAGGGGTGGG - Intergenic
1180861365 22:19084691-19084713 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1180861431 22:19084831-19084853 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1181273923 22:21676949-21676971 CGCCGCCCCGTCCGGGAGGTAGG - Intronic
1181512704 22:23395944-23395966 GGCTGCCCCCTGTGGGGTGCTGG + Intergenic
1181538608 22:23561119-23561141 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1181538674 22:23561266-23561288 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1181586090 22:23854501-23854523 CGCAGCCCTGTCTGGGAGGTGGG + Intergenic
1181586228 22:23854883-23854905 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1181657678 22:24316921-24316943 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1181657906 22:24317447-24317469 AGCCGCCCCGTCCGGGAGGTTGG - Intronic
1181982057 22:26773118-26773140 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1182331131 22:29552510-29552532 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1182331154 22:29552552-29552574 AGCCGCCCCGTCCGGGGGGGAGG + Intronic
1182398973 22:30059858-30059880 CGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1182563917 22:31183937-31183959 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1182563934 22:31183978-31184000 AGCTGCCCCGTCCGGGAGCTCGG - Intronic
1182563956 22:31184023-31184045 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1182616276 22:31591918-31591940 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1183841415 22:40501994-40502016 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1184145517 22:42607913-42607935 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1184201335 22:42971736-42971758 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1184201416 22:42971911-42971933 CGCCGCCCCGTCTGGAAGGTGGG + Intronic
1203247524 22_KI270733v1_random:85086-85108 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
949330479 3:2916793-2916815 GGCGGCCCCGTCTGGGAGGTGGG - Intronic
949841565 3:8325928-8325950 AGCTGCCCCGTCTGGTAGGGAGG + Intergenic
949841602 3:8326011-8326033 GGCCGCCCCGTCTGGGAGTGGGG + Intergenic
949853466 3:8440244-8440266 AGCCGCCCCCTCTGGGAGGTGGG + Intergenic
949853569 3:8440498-8440520 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
950007328 3:9699743-9699765 GGCAGCCATGTCAGGGGGGTGGG + Intronic
950123273 3:10495864-10495886 GGGTGCCCTGCCTGGGGGCTAGG - Intronic
950538394 3:13595001-13595023 GGCTGCCCCGGCTGGGTGTGTGG + Intronic
950742437 3:15062067-15062089 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
950742557 3:15062372-15062394 GGCCGCCCCGTCCGGGAGGGAGG + Intronic
950949071 3:16980107-16980129 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
951013260 3:17704613-17704635 AGCAGCCCCGTCCGGGAGGTTGG - Intronic
951264156 3:20547883-20547905 AGCCGCCCCGTCTGGGGGGTGGG - Intergenic
951264174 3:20547923-20547945 AGCCGCCCCATCTGGGAGGTGGG - Intergenic
951290371 3:20866751-20866773 AGCTGCCCCATCTGGGAGGTGGG - Intergenic
952892637 3:38053555-38053577 AGCTGCCCCGTCCGGGAGGTGGG + Intronic
952934874 3:38389541-38389563 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
953084863 3:39655928-39655950 TGCCGCCCCATCTGGGAGGTGGG + Intergenic
953084880 3:39655968-39655990 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
953084898 3:39656008-39656030 AGCTGCCCCGTCTGGGAGGTGGG + Intergenic
953084915 3:39656048-39656070 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
953307108 3:41841196-41841218 GGCCGCCCCGCCTGGGAGGTGGG + Intronic
953307133 3:41841272-41841294 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
953307178 3:41841419-41841441 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
953440130 3:42909657-42909679 CGCTGCCCCGTCTGGGAGGTGGG - Intronic
953652684 3:44821141-44821163 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
953855151 3:46494808-46494830 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
953855204 3:46494936-46494958 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
953922879 3:46964354-46964376 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
953959527 3:47256495-47256517 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
954162815 3:48734487-48734509 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
954291423 3:49652039-49652061 TGCTGCCCGGGCTGGGGGCTGGG - Exonic
954481221 3:50803665-50803687 AGCCGCCCCATCTGGGAGGTGGG - Intronic
954566915 3:51607698-51607720 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
954566977 3:51607852-51607874 CGCCGCCCCATCTGGGAGGTGGG - Intronic
954566998 3:51607893-51607915 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
954567040 3:51607977-51607999 AGCTGCCCCGCCCGGGAGGTGGG - Intronic
954704828 3:52473942-52473964 GGCTGGACCTTCTGTGGGGTAGG + Intronic
955060707 3:55489444-55489466 GCCTGCGCCCTCTGGGGTGTGGG - Intronic
955297610 3:57748060-57748082 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
955626832 3:60927669-60927691 CGCCACCCCGTCTGGGAGGTGGG + Intronic
955626847 3:60927709-60927731 AGCCGCCCCGTCTGTGAGGTGGG + Intronic
955670039 3:61393536-61393558 AGCCGCCCCATCTGGGTGGTGGG - Intergenic
956270519 3:67444311-67444333 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
956270669 3:67444664-67444686 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
956270796 3:67444971-67444993 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
957620327 3:82585093-82585115 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
957789312 3:84918921-84918943 CGCCGCCCCGTCCGGGAGGTAGG + Intergenic
958406447 3:93761927-93761949 GGCCACCCCATCTGGGAGGTGGG - Intergenic
958406663 3:93762711-93762733 GGCCGCCCTGTCTGGGAAGTGGG - Intergenic
958406743 3:93762968-93762990 AGCTGCCCCATCTGGGAAGTGGG - Intergenic
958406848 3:93763347-93763369 GGCCTCCCCGTCTGGGAGGTGGG - Intergenic
958407032 3:93763990-93764012 GGCTGTCCCGTCTGGGATGTGGG - Intergenic
958407141 3:93764357-93764379 GGATGCCCCATCTGGGAAGTGGG - Intergenic
958431402 3:94044455-94044477 GGCCACCCCGTCTGGGAAGTGGG + Intronic
958431496 3:94044798-94044820 GGCCGCGCCGTCTGGGAAGTGGG + Intronic
958808571 3:98837431-98837453 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
958957273 3:100477648-100477670 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
959054099 3:101551572-101551594 GGCCGCCCCATCTGGGACGTGGG + Intergenic
959054113 3:101551609-101551631 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
959054129 3:101551646-101551668 GGCCAACCCGTCTGGGAGGTGGG + Intergenic
959054146 3:101551685-101551707 GGCCGCCCTGTCTGGGAGGTGGG + Intergenic
959054159 3:101551722-101551744 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
959221921 3:103531553-103531575 AGCTGCCCCGTCTGGCAGGGAGG - Intergenic
959415314 3:106073976-106073998 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
959415411 3:106074199-106074221 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
959683803 3:109124258-109124280 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
960030030 3:113046556-113046578 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
960344899 3:116519361-116519383 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
960577564 3:119242853-119242875 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
960577581 3:119242893-119242915 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
960577599 3:119242932-119242954 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
960770739 3:121190688-121190710 AGCCGCCCCGTCAGGGAGGTGGG - Intronic
960770759 3:121190730-121190752 AGCTGCCCCATCCGGGAGGTGGG - Intronic
960780339 3:121313102-121313124 AGCCGCCCCGTCTGGGAGGGTGG - Intronic
960918840 3:122725358-122725380 CGCTGCCCCGTCTGGGAGGTGGG - Intronic
960918854 3:122725398-122725420 GGCCGCCCTGTCTGGGAGGTGGG - Intronic
961120409 3:124367474-124367496 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
961120689 3:124368103-124368125 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
961163765 3:124750273-124750295 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
961163819 3:124750401-124750423 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
961496226 3:127293834-127293856 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
961496243 3:127293874-127293896 AGCCGCCCTGTCTGGGAGGTGGG - Intergenic
961498108 3:127309059-127309081 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
961498129 3:127309100-127309122 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
961789076 3:129363420-129363442 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
962266131 3:133945555-133945577 AGCTGCCCTTTCTGGGTGGTTGG - Intronic
962688820 3:137872840-137872862 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
962761861 3:138521686-138521708 GGCCGCCCCGTCTCGGGGGGTGG + Intronic
963036089 3:141030440-141030462 CGCCGCCCCGTCCGGGAGGTGGG - Intergenic
963036108 3:141030486-141030508 AGCTGCCCCGTCAGGGAGGGAGG - Intergenic
963244496 3:143047186-143047208 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
963244520 3:143047235-143047257 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
963249042 3:143086689-143086711 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
963498449 3:146096857-146096879 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
963770174 3:149380322-149380344 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
963776359 3:149444964-149444986 CGCCGCCCCGTCCGGGAGGTGGG - Intergenic
964623753 3:158739573-158739595 GGCTGCCTCGTACTGGGGGTGGG + Intronic
964766050 3:160179021-160179043 GGCCGCCCCTACTGGGAGGTGGG + Intergenic
965136945 3:164784621-164784643 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
965136963 3:164784661-164784683 AGCTGCCCCATCTGGGAGGTGGG + Intergenic
965136979 3:164784698-164784720 AGCCACCCCGTGTGGGGGGTGGG + Intergenic
965650128 3:170923911-170923933 AGCAGCCCCGTCCGGGAGGTGGG + Intergenic
966015117 3:175131882-175131904 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
966015226 3:175132148-175132170 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
966015395 3:175132573-175132595 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
966015441 3:175132671-175132693 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
966015548 3:175133032-175133054 CGCCGCCCCGTCTGGGATGTGGG - Intronic
966015561 3:175133069-175133091 CGCCGCCCCGTCTGGGATGTGGG - Intronic
966206612 3:177412761-177412783 GGCCGCCCCTTCTGGGAAGTGGG - Intergenic
966206628 3:177412798-177412820 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
966351053 3:179032888-179032910 CGCTACACCGTCTGGGAGGTGGG + Intronic
966359815 3:179120544-179120566 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
966360137 3:179121270-179121292 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
966420112 3:179727986-179728008 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
966420158 3:179728085-179728107 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
966617206 3:181925939-181925961 AGCTGCCCCGTCCAGGAGGTGGG - Intergenic
967127215 3:186435390-186435412 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
967169360 3:186811643-186811665 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
968156573 3:196385772-196385794 AGCCGCCCCGTCTGGGAAGTGGG + Intronic
968175172 3:196543222-196543244 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
968357445 3:198120257-198120279 GGCTGCCCCGGCTGGTCAGTGGG - Intergenic
968555688 4:1245494-1245516 GGCTGCCCTGTCTGCGTGGCTGG - Intronic
968644289 4:1731235-1731257 GGCTGCCCCTGCTGATGGGTGGG - Exonic
968666971 4:1827883-1827905 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
968667316 4:1828647-1828669 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
968667372 4:1828774-1828796 AGCCGCCCCGTCCGGGGGGTGGG - Intronic
968852692 4:3094508-3094530 CGCCGCCCCGTCTGGGAGGTTGG - Intronic
968852774 4:3094675-3094697 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
969384721 4:6837099-6837121 CGCTGCCCCGTCTGGGAGGTGGG - Intronic
971234605 4:24829778-24829800 GGGTGCAGCGGCTGGGGGGTGGG - Intronic
971594761 4:28514787-28514809 AGCTGCCCCATCCGGGAGGTGGG - Intergenic
972270735 4:37509270-37509292 AGCCGCCCTGTCTGGGAGGTGGG - Intronic
972304794 4:37820692-37820714 TGCCGCCCCGTCCGGGAGGTGGG + Intergenic
972552546 4:40147505-40147527 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
972552610 4:40147645-40147667 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
972552632 4:40147692-40147714 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
972654127 4:41049351-41049373 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
972700638 4:41491145-41491167 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
972700663 4:41491221-41491243 GGCCGCCCCATCTGGGAAGTTGG - Intronic
972700683 4:41491297-41491319 GGCTGCCCCGTCTGGGAGGTGGG - Intronic
972700704 4:41491368-41491390 GGCTGCCCTGTCGGGGAAGTGGG - Intronic
972939823 4:44182191-44182213 GGCCGACCCGTCCGGGAGGTGGG + Intronic
973021188 4:45207551-45207573 GGCCACCCCATCTGGGAGGTGGG + Intergenic
973109218 4:46377834-46377856 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
973263460 4:48186834-48186856 CACTGCCCCGTCTGGGAGGTGGG + Intronic
973281260 4:48363455-48363477 AGCCGCCCCGTCCGGGAGGTAGG - Intronic
973664116 4:53139568-53139590 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
973664136 4:53139609-53139631 TGCTGCCCCGTCTGGGAGGTGGG + Intronic
973675173 4:53255981-53256003 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
974597894 4:64037442-64037464 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
974597912 4:64037482-64037504 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
974597930 4:64037519-64037541 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
974848788 4:67381465-67381487 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
974870566 4:67637157-67637179 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
974870648 4:67637338-67637360 AGCTGCCCCGTCCGGGAGGTGGG + Intronic
975063872 4:70037845-70037867 AGCCGCCCCATCTGGGAGGTGGG + Intergenic
975522692 4:75317780-75317802 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
975685781 4:76917328-76917350 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
975793621 4:77983807-77983829 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
975795911 4:78007157-78007179 AGCCGGCCCGTCTGGGAGGTGGG - Intergenic
975795932 4:78007197-78007219 GGCCGCCCCCTCTGGGAGGTGGG - Intergenic
976149485 4:82078010-82078032 GGCCACCCTGTCTGGGAGGTGGG + Intergenic
976976082 4:91167984-91168006 GGCTGCCCCATTTGGGAAGTGGG + Intronic
976976202 4:91168398-91168420 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
978014295 4:103723435-103723457 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
978224931 4:106321558-106321580 AGCGGCCCCGTCCGGGAGGTGGG + Intronic
978519784 4:109603748-109603770 AGCTGCCCCGTCTGGGAGGTGGG + Intronic
978519802 4:109603788-109603810 AGCCTCCCCGTCTGGGAGGTGGG + Intronic
978527204 4:109678731-109678753 GGCCGCCCCGTCTGGGATGTGGG - Intronic
978947562 4:114516756-114516778 AGCTGCCCCTTCTGGGAGGGAGG + Intergenic
979273730 4:118792251-118792273 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
979273751 4:118792293-118792315 AGCTGCCCCGTCCGGGAGGTGGG + Intronic
979702544 4:123685119-123685141 GGCTGCCCCATCTGGGAGGCGGG + Intergenic
979702558 4:123685159-123685181 AGCTGCCCCATCTGGGAGGCGGG + Intergenic
979941772 4:126771328-126771350 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
979941799 4:126771408-126771430 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
980056413 4:128083585-128083607 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
981993701 4:150954127-150954149 AGCCGCCCCGTCGGGGAGGTGGG + Intronic
981994909 4:150964148-150964170 AGCTGCCCCGTCTGGGAGGTGGG + Intronic
982053531 4:151526498-151526520 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
982182794 4:152765218-152765240 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
982182814 4:152765263-152765285 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
982615851 4:157636967-157636989 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
982723513 4:158882310-158882332 AGCTGCCCCATCTGGGAGGGAGG + Intronic
982820609 4:159939129-159939151 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
983613706 4:169679004-169679026 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
983613724 4:169679044-169679066 GGCCACCCAGTCTGGGAGGTGGG - Intronic
983628816 4:169828625-169828647 CACTGCCCCGTCTGGGAGGTGGG + Intergenic
983652319 4:170046736-170046758 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
983664404 4:170166226-170166248 AGCCGCCCTGTCTGGGAGGTGGG - Intergenic
983664423 4:170166267-170166289 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
983905969 4:173183704-173183726 CGCCGCCCCGTCTGGGAGGTGGG - Intronic
983905989 4:173183745-173183767 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
983906022 4:173183829-173183851 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
984037937 4:174692292-174692314 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
984533451 4:180944833-180944855 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
984803548 4:183735380-183735402 AGCTGCCCCGTCCGGGAGGGTGG - Intergenic
984813672 4:183818688-183818710 GGCTACCCCGTCCGGGAGGTGGG - Intergenic
984813704 4:183818775-183818797 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
985216412 4:187658267-187658289 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
985410576 4:189679495-189679517 GGCTGCCCCCTCTGGGCTGCTGG - Intergenic
985441095 4:189982993-189983015 GGCTGCCCCGGCTGGTCAGTGGG + Intergenic
985478670 5:93684-93706 TGCTGGCCTTTCTGGGGGGTGGG + Intergenic
985600671 5:828329-828351 AGCTGCCGCATCTGGGAGGTGGG - Intronic
985670989 5:1206630-1206652 GGGTGCCCAGCCTGGGGGGCGGG + Intronic
986437764 5:7751422-7751444 GGATGTCCCATCTGGGGGCTGGG - Intronic
987061316 5:14246701-14246723 GGCTTCTCCATCTGGGGGCTAGG + Intronic
988064632 5:26218689-26218711 AGCTGCACAGCCTGGGGGGTGGG - Intergenic
988264419 5:28929516-28929538 GGCCACCCCGTCTGGGATGTGGG - Intergenic
988532886 5:32041046-32041068 AGCCGCCCCGTCTGGGAAGTGGG + Intronic
988532910 5:32041120-32041142 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
988532923 5:32041157-32041179 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
988532937 5:32041194-32041216 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
989068112 5:37483693-37483715 CACCGCCCCGTCTGGGAGGTGGG - Intronic
989071838 5:37519481-37519503 GGCCGCCCAGTCTGGGATGTAGG - Intronic
989372354 5:40722840-40722862 AGCTGCCCCGTCCGGGAGGTGGG + Intronic
989379741 5:40800621-40800643 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
989379843 5:40800874-40800896 AGCCGCCCCGTCTGGGAGGGTGG + Intergenic
989379943 5:40801128-40801150 AGCCGCCCCGTCTGGGAGGGTGG + Intergenic
989574777 5:42979539-42979561 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
989574796 5:42979580-42979602 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
989640416 5:43578254-43578276 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
989655784 5:43745878-43745900 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
989655805 5:43745920-43745942 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
989655821 5:43745961-43745983 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
989655907 5:43746205-43746227 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
989663456 5:43824556-43824578 AGCTGCCCCATCTGGGAGGTGGG - Intergenic
989828915 5:45890833-45890855 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
989977931 5:50608105-50608127 GGCCACCCCGTCTGGGAAGTGGG + Intergenic
989977966 5:50608213-50608235 GGCCACCCAGTCTGGGAGGTGGG + Intergenic
989991801 5:50774945-50774967 GGCCGCCCCGTCTGGGAAGTGGG - Intronic
990293915 5:54381547-54381569 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
990293950 5:54381634-54381656 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
990426918 5:55696536-55696558 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
990501071 5:56397846-56397868 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
990709080 5:58563177-58563199 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
990709161 5:58563479-58563501 GGCCACCCCGTCTGGGATGTGGG - Intergenic
990709249 5:58563782-58563804 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
990709283 5:58563897-58563919 AGCCGCCCCATCTGGGAGGTGGG - Intergenic
991073615 5:62513324-62513346 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
991373289 5:65940441-65940463 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
991373317 5:65940493-65940515 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
991375061 5:65957807-65957829 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
991723540 5:69515420-69515442 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
991910017 5:71551829-71551851 GGCTGCCCCTACTGGGAAGTGGG - Intronic
991935177 5:71793954-71793976 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
991935190 5:71793994-71794016 CGCCGCCCTGTCTGGGAGGTGGG - Intergenic
991935233 5:71794115-71794137 CGCCGCCCCGTCTGGGAGGTGGG - Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
992289858 5:75270919-75270941 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
992391716 5:76336279-76336301 GGCCGCCCCGTCTGAGAGGTGGG - Intronic
992463631 5:76984760-76984782 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
992852479 5:80824405-80824427 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
992914280 5:81432782-81432804 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
992964124 5:81983474-81983496 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
993162708 5:84312249-84312271 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
993496679 5:88616166-88616188 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
993657808 5:90595801-90595823 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
993723346 5:91343034-91343056 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
993934721 5:93986264-93986286 AGCCGCCCCATCTGGGAGGTGGG + Intronic
993934739 5:93986304-93986326 AGCCGCCCCATCTGGGAGGTGGG + Intronic
993934772 5:93986384-93986406 AGCTGCCCCCTCTGGGAGGTGGG + Intronic
993934790 5:93986421-93986443 GGCTGCCCCATCTGGGGGGTGGG + Intronic
994178077 5:96733942-96733964 GGCTGGCCTGTCTAGGGGGTGGG + Intronic
994614688 5:102089543-102089565 TGCTGCCACTGCTGGGGGGTAGG + Intergenic
994907495 5:105859569-105859591 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
995161759 5:108992516-108992538 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
995772804 5:115690597-115690619 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
996054140 5:118965245-118965267 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
996069918 5:119122149-119122171 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
996386240 5:122913310-122913332 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
997433497 5:133857844-133857866 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
997874745 5:137537764-137537786 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
997874873 5:137538070-137538092 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
997874892 5:137538119-137538141 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
998025217 5:138810932-138810954 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
998067595 5:139171053-139171075 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
998239187 5:140427159-140427181 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
998239413 5:140427659-140427681 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
999532558 5:152479830-152479852 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
999532623 5:152479960-152479982 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
999604044 5:153296664-153296686 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
999979086 5:156940755-156940777 GGCTGCCCCATCTGGGAGGTAGG + Intronic
1000032995 5:157419841-157419863 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1000033039 5:157419936-157419958 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1000033086 5:157420032-157420054 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1000103313 5:158036958-158036980 CACTGCCCCGTCTGGGAGGTGGG - Intergenic
1000159310 5:158582962-158582984 AGCAGCCCCGTCTGGGAGGGTGG + Intergenic
1000630179 5:163583649-163583671 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1001394054 5:171403875-171403897 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1002057957 5:176609703-176609725 GGCTGACCTGGCTGTGGGGTCGG - Intronic
1002205482 5:177560108-177560130 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1002920044 6:1561653-1561675 GGCAGCTCCGCCTGGGGGCTTGG - Intergenic
1003319284 6:5037651-5037673 GGCCGCCCCGTCCGGGAGGGAGG - Intergenic
1004874489 6:19939818-19939840 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1005158995 6:22837109-22837131 AGCTGCCCCGTCCGGGAGGGGGG + Intergenic
1005352477 6:24949822-24949844 GGCTGCCCCTTCCAGGTGGTGGG - Intronic
1005414460 6:25586145-25586167 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1005624909 6:27653707-27653729 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1005624949 6:27653791-27653813 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1005644328 6:27826782-27826804 GGCCGCCCCGTCCGGGGGGGAGG - Intergenic
1005710914 6:28502399-28502421 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1005710947 6:28502478-28502500 AGCTGCCCGGTCTGGGAAGTGGG + Intergenic
1005710962 6:28502518-28502540 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1006039799 6:31244232-31244254 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1006064682 6:31454741-31454763 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1006064936 6:31455348-31455370 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1006148937 6:31976050-31976072 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1006209694 6:32384826-32384848 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1006225395 6:32532389-32532411 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1006231973 6:32595055-32595077 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1006232309 6:32595787-32595809 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1006232362 6:32595916-32595938 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1006326522 6:33357997-33358019 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1006346269 6:33485699-33485721 AGCCGCCCCGTCCGGGGGGGGGG - Intergenic
1006346296 6:33485748-33485770 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1006351675 6:33525498-33525520 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1006492572 6:34398250-34398272 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1006492702 6:34398528-34398550 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1006546746 6:34786842-34786864 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1006546768 6:34786891-34786913 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1006717850 6:36131410-36131432 GGCTGCCCCGGGGAGGGGGTGGG + Intronic
1006826882 6:36941836-36941858 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1007403167 6:41616417-41616439 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1007544949 6:42686670-42686692 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1007544967 6:42686712-42686734 AGCTGCCCCGTCCGGGAGGTGGG - Intronic
1007651494 6:43425310-43425332 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
1007651512 6:43425352-43425374 AGCTGCCCCGTCCAGGAGGTGGG + Intergenic
1008106283 6:47443946-47443968 CGCTGCCCCGTCCAGGAGGTGGG - Intergenic
1008553710 6:52656024-52656046 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1008624618 6:53305117-53305139 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1008909832 6:56720945-56720967 GGCTGCCCCGTCTGGGGGGTGGG - Intronic
1008909887 6:56721070-56721092 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1008909905 6:56721111-56721133 AGCTGCCCTGTCTGGGAGGTGGG - Intronic
1008909925 6:56721154-56721176 AGCCGCCCCATCTGGGAGGTGGG - Intronic
1008909943 6:56721196-56721218 AGCTGCCCCATCTGGGAGGTGGG - Intronic
1008965526 6:57310729-57310751 GGCCACCCCGTCTGGGAAGTGGG - Intergenic
1009392864 6:63164367-63164389 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1009392887 6:63164443-63164465 GGCCGCCCCATCTGGGATGTGGG + Intergenic
1009392910 6:63164517-63164539 GGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1009392925 6:63164554-63164576 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1009622623 6:66096738-66096760 CGCTGCCCCGTCCGGGAGGTTGG - Intergenic
1009868943 6:69432547-69432569 GGCCACCCCATCTGGGAGGTGGG - Intergenic
1009868977 6:69432655-69432677 GGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1009869033 6:69432841-69432863 AGCTGCCCCGTCTGGGAAGTGGG - Intergenic
1009869067 6:69432956-69432978 GCCTGCCCCATCTGGGAGGTGGG - Intergenic
1009869110 6:69433105-69433127 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1009913719 6:69966173-69966195 AGCTGCCCCGTGCGGGAGGTGGG + Intronic
1010264372 6:73851068-73851090 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1010272023 6:73925890-73925912 CGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1010300605 6:74255116-74255138 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1010319393 6:74488885-74488907 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1010400539 6:75441848-75441870 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1011148574 6:84244674-84244696 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1011148597 6:84244722-84244744 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1011297285 6:85838840-85838862 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1011297372 6:85839036-85839058 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1012479306 6:99650123-99650145 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1013204688 6:107934823-107934845 AGCTGCCCCGTCTGGGAGGGAGG + Intronic
1013204710 6:107934872-107934894 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1013204805 6:107935095-107935117 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1013204828 6:107935144-107935166 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1013530716 6:111017274-111017296 CGCCGCCCCGTCCGGGAGGTTGG - Intronic
1013955585 6:115836552-115836574 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1014463622 6:121729630-121729652 GGCAGCCCTGTCTGGGAAGTGGG - Intergenic
1014800388 6:125771049-125771071 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1015220941 6:130802662-130802684 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1016479869 6:144470293-144470315 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1016973458 6:149786175-149786197 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1017063460 6:150507581-150507603 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1017063481 6:150507623-150507645 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1017073885 6:150600255-150600277 GGGCGCCGCGTCTCGGGGGTCGG + Intronic
1017819747 6:158040810-158040832 GGCTGCTCAGTCTGGGGTCTAGG + Intronic
1017843922 6:158240660-158240682 AGCTGCCCCGTCTGGGAGGGAGG - Intronic
1017851384 6:158308770-158308792 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1017855680 6:158348971-158348993 GGCTGCCCCATCTGGGAAATGGG - Intronic
1017982014 6:159407684-159407706 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1019128341 6:169856656-169856678 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1019324580 7:431959-431981 GGCTGCCCAGTCTGGGGAAGCGG - Intergenic
1019439595 7:1039212-1039234 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1019446698 7:1074951-1074973 GGCTGCCCCGTGTGGTGAGCGGG + Intronic
1019459158 7:1147272-1147294 CGCAGCCCTGTCTGGGAGGTGGG - Intergenic
1019981406 7:4624253-4624275 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1020157311 7:5736925-5736947 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1020219363 7:6223149-6223171 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1020284634 7:6670962-6670984 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1020284728 7:6671188-6671210 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1020325906 7:6975098-6975120 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1020325958 7:6975225-6975247 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1020616346 7:10465619-10465641 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1021647469 7:22801199-22801221 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1021672207 7:23045936-23045958 AGCCGCCCCGTCTGGGAGGAAGG - Intergenic
1021672281 7:23046114-23046136 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1022005480 7:26262277-26262299 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1022318138 7:29263951-29263973 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1022318193 7:29264060-29264082 CGCCGCCCCGTCCGGGAGGTGGG + Intronic
1022318222 7:29264137-29264159 CGCCACCCCGTCTGGGAGGTGGG + Intronic
1022700365 7:32754055-32754077 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1023954004 7:44871126-44871148 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1023954018 7:44871163-44871185 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954032 7:44871200-44871222 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954097 7:44871388-44871410 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1023954154 7:44871576-44871598 GGCCGCCCCGTCAGGGAAGTGGG - Intergenic
1023954210 7:44871765-44871787 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954224 7:44871802-44871824 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1024625873 7:51208363-51208385 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1024931187 7:54667742-54667764 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1025103188 7:56151303-56151325 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1025775168 7:64554350-64554372 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1025775187 7:64554392-64554414 AGCTGCCCCGTCCAGGAGGTGGG + Intronic
1025775207 7:64554433-64554455 CGCTGCCCCGTCTGGGAGGTGGG + Intronic
1025800885 7:64785026-64785048 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1025800906 7:64785074-64785096 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1025808546 7:64856998-64857020 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1026186078 7:68083079-68083101 GGCAGCCCCGTCCGGGAAGTGGG + Intergenic
1026868475 7:73836593-73836615 GGCCGCCCCTACTGGGAGGTGGG + Intronic
1027182760 7:75952103-75952125 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1027182784 7:75952152-75952174 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1027371258 7:77509628-77509650 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1027371307 7:77509755-77509777 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1027373757 7:77533582-77533604 GGCCGCCCCTACTGGGAGGTGGG - Intergenic
1027546953 7:79539318-79539340 GGCTGCCCAGGCCTGGGGGTGGG + Intergenic
1028535753 7:91888062-91888084 GGCAGCCCCGTCTGGGAAGTGGG + Intergenic
1028535765 7:91888099-91888121 AGCCGCCCCATCTGGGAGGTGGG + Intergenic
1028535779 7:91888136-91888158 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1028535809 7:91888251-91888273 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1028535931 7:91888705-91888727 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1028535963 7:91888820-91888842 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1028548123 7:92026940-92026962 GGCCGCCCTGTCTGGGATGTGGG + Intronic
1028595633 7:92544963-92544985 AGCCGCCCCGTCCGGGAGGTCGG - Intergenic
1028882656 7:95897390-95897412 GGCTACACTGTCTGGGGGGCAGG - Intronic
1029233742 7:99094874-99094896 GGGTGCGCTGTCTGGGGAGTGGG - Intronic
1029313211 7:99686751-99686773 GTCTGCCCCTACTGGGGGGGGGG - Intronic
1029525803 7:101092738-101092760 CGCTGTCCCGTCCGGGAGGTGGG + Intergenic
1029569202 7:101359234-101359256 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1030329369 7:108255894-108255916 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1030329411 7:108255982-108256004 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1030602688 7:111609802-111609824 GGCTGCCCAGTCTGGAGGGTGGG + Intergenic
1030602746 7:111609998-111610020 TGCGACCCCGTCTGGGAGGTGGG + Intergenic
1030602856 7:111610285-111610307 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1030788643 7:113695184-113695206 GTCTGCCCCATCTCTGGGGTTGG - Intergenic
1032028664 7:128463625-128463647 AGCCGCCCCGTCTGGCAGGTGGG + Intergenic
1032028684 7:128463666-128463688 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1032042932 7:128577102-128577124 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1032056764 7:128689810-128689832 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1032179494 7:129663322-129663344 GGCCACCCCGTCTGGGAAGTGGG - Intronic
1032179551 7:129663515-129663537 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1032569617 7:132985002-132985024 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1033090231 7:138378905-138378927 AGCCGCCCCGTCTGGGGGGTGGG - Intergenic
1033090250 7:138378945-138378967 AGCCGTCCCGTCTGGGAGGTGGG - Intergenic
1033090269 7:138378985-138379007 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1033294178 7:140115196-140115218 AGCCGCCCCGTCCGGGAGGTAGG + Intronic
1033376140 7:140763348-140763370 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1033565663 7:142575532-142575554 CGCCGCCCCGTCTGGGATGTGGG + Intergenic
1034207830 7:149333153-149333175 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1034638661 7:152585994-152586016 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1034638873 7:152586543-152586565 CGCAGCCCTGTCTGGGAGGTGGG - Intergenic
1034723450 7:153315140-153315162 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1035259610 7:157653105-157653127 GGCTGCACCGTCTGGGGGGCAGG - Intronic
1035611997 8:973213-973235 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1035612017 8:973260-973282 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1035612036 8:973303-973325 AGCCGCCCTGTCTGGGAGGTGGG - Intergenic
1036536541 8:9657311-9657333 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1036737314 8:11330316-11330338 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1036786694 8:11692694-11692716 GGCTGCTCCGTCGGGAGGCTGGG + Intronic
1037791349 8:21945199-21945221 CGCCACCCCGTCTGGGAGGTGGG - Intronic
1038168008 8:25103280-25103302 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1038778745 8:30553198-30553220 GGCTGCCGATTCTGGGGGGCAGG + Intronic
1039153094 8:34528628-34528650 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1039153329 8:34529227-34529249 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1039183879 8:34895272-34895294 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
1039650811 8:39339027-39339049 AGCTGCCCCGTCCGGGAGGTGGG - Intergenic
1039650829 8:39339072-39339094 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1039650851 8:39339118-39339140 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1039753146 8:40496417-40496439 AGCTGCCCTGTCCGGGAGGTGGG - Intergenic
1040041292 8:42919052-42919074 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1040069819 8:43179850-43179872 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1040070035 8:43180403-43180425 CGCAGCCCTGTCTGGGAGGTGGG - Intronic
1040093179 8:43419264-43419286 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1040616227 8:49041485-49041507 AGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1040616263 8:49041566-49041588 GGCCGCCCTGTCTGGGAGGTGGG - Intergenic
1040916876 8:52573225-52573247 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1040916939 8:52573449-52573471 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1040916952 8:52573486-52573508 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1040916965 8:52573523-52573545 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1040916977 8:52573560-52573582 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1041070808 8:54125468-54125490 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1041358094 8:57022128-57022150 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1041358116 8:57022177-57022199 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1041523114 8:58776513-58776535 AGCAGCCCCTTCTGGGAGGTGGG + Intergenic
1041652365 8:60313523-60313545 GGCTGCTCTGTCTGTGGAGTAGG - Intergenic
1041677259 8:60548781-60548803 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1041796379 8:61752616-61752638 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1042290667 8:67167359-67167381 AGCTGCCCCGTCCGGGTGGGAGG - Intronic
1042475729 8:69245910-69245932 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1042475779 8:69246037-69246059 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1042756836 8:72223425-72223447 GGCTGCCTTGGCTGGGGGCTGGG + Intergenic
1042912900 8:73845073-73845095 AGCTGCACCATCTGGGAGGTGGG + Intronic
1043961517 8:86423819-86423841 CGCCGCCCCGTCCGGGAGGTGGG - Intronic
1043961587 8:86423995-86424017 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1043985842 8:86694089-86694111 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1044190456 8:89310319-89310341 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1044581917 8:93833497-93833519 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1044581940 8:93833571-93833593 GGCTGCCCCGTCTGGGATGTGGG - Intergenic
1044581964 8:93833647-93833669 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1044581977 8:93833684-93833706 GGCTGCCCCGTCTGGGATGTGGG - Intergenic
1044582098 8:93834052-93834074 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1044582133 8:93834160-93834182 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1044637430 8:94340967-94340989 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1044637457 8:94341022-94341044 CACCGCCCCGTCTGGGAGGTGGG + Intergenic
1044969480 8:97605243-97605265 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1044969500 8:97605289-97605311 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1045021864 8:98051702-98051724 CGCCGCCCAGTCTGGGAGGTGGG - Intergenic
1045021881 8:98051742-98051764 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1045021900 8:98051784-98051806 AGCTGCCCCATCTGGGAGGTGGG - Intergenic
1045120282 8:99028583-99028605 AGCTGCCCCGTCCGGGAGGGGGG - Intronic
1045195667 8:99927388-99927410 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1045524066 8:102928310-102928332 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1045524171 8:102928537-102928559 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1047687567 8:127317106-127317128 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1048368550 8:133758067-133758089 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1048966898 8:139621677-139621699 GGCTGCTCTGTCTGGGGAGAAGG + Intronic
1049481585 8:142826966-142826988 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1049481604 8:142827006-142827028 GGCCACCCCGTCTGGGAGGTGGG - Intergenic
1049704912 8:144037170-144037192 GGCCGCCCCGTCCGGGAGGGAGG + Intronic
1049975967 9:861694-861716 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1049975999 9:861776-861798 AGCCGCCCCGTCTGGGAAGTGGG - Intronic
1050417882 9:5434294-5434316 GGCCGCCCCGTCTGGGAAGTGGG + Intronic
1050417965 9:5434558-5434580 AGCCGCCCCGTCTGGGAAGTGGG + Intronic
1050417977 9:5434592-5434614 GGCCGCCCCCTCTGGGAGGTGGG + Intronic
1050463566 9:5897401-5897423 GGGTGCCCAGTGTGGGAGGTGGG + Intronic
1050818337 9:9844425-9844447 GGCTGCCCGGGCTGAGGTGTGGG + Intronic
1050925721 9:11260340-11260362 GACTGCTCTCTCTGGGGGGTGGG - Intergenic
1051280951 9:15442166-15442188 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1052236091 9:26214778-26214800 GGCCGCCCTGTCTGGGGGGTAGG - Intergenic
1052236109 9:26214816-26214838 AGCCGCCCCATCTGGGAGGTGGG - Intergenic
1052259185 9:26493029-26493051 GGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1052259304 9:26493399-26493421 AGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1052274855 9:26664494-26664516 AGCCGCCCCATCTGGGAGGTGGG + Intergenic
1052274888 9:26664575-26664597 AGCCGCCCCCTCTGGGAGGTGGG + Intergenic
1052274907 9:26664612-26664634 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
1052492735 9:29189021-29189043 AGCCGCCCCGTCTGGGAGGTAGG - Intergenic
1052928720 9:34039125-34039147 AGCCGGCCCGTCTGGGAGGTGGG + Intronic
1052942015 9:34137865-34137887 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1052942042 9:34137915-34137937 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1052942137 9:34138141-34138163 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1053081658 9:35183150-35183172 GGCCGCCCCATCTGGGAGGTGGG - Intronic
1053407634 9:37891259-37891281 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1053916400 9:42948002-42948024 GGCTGCCCCTTCTGGGCTGGAGG - Intergenic
1054711531 9:68515955-68515977 GCTTGCCCCGTATGGGGGCTAGG + Intronic
1054848499 9:69821582-69821604 GGCTGCCACTTCCTGGGGGTAGG + Intronic
1054949536 9:70834739-70834761 GGCTGCACCATCTGAGGGTTTGG - Intronic
1055414108 9:76064020-76064042 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1055580430 9:77702697-77702719 TGCCACCCCGTCTGGGAGGTGGG - Intergenic
1055580460 9:77702774-77702796 TGCCGCCCCATCTGGGAGGTGGG - Intergenic
1056097883 9:83273031-83273053 AGCTGCCCCGTCCGGGAGGTGGG + Intronic
1056229040 9:84526441-84526463 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1056229052 9:84526478-84526500 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1056229095 9:84526632-84526654 AGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1056229108 9:84526669-84526691 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1056229133 9:84526745-84526767 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1056229147 9:84526782-84526804 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1056229173 9:84526856-84526878 GGCTGCCCTGTCTGGGATGTGGG - Intergenic
1056229225 9:84527003-84527025 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1056229249 9:84527074-84527096 GGCCGCCCCGTCGGGGAAGTGGG - Intergenic
1056564374 9:87759044-87759066 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1057296914 9:93851714-93851736 GGCTGCCTCCTCTCTGGGGTAGG + Intergenic
1057674786 9:97130396-97130418 GGCCACCCCGTCTGGGATGTGGG - Intergenic
1057674831 9:97130525-97130547 GGCCGCCCCTCCTGGGAGGTGGG - Intergenic
1057674849 9:97130564-97130586 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1057716129 9:97497999-97498021 AGCCGCCCTGTCTGGGAGGTGGG - Intergenic
1057751405 9:97796261-97796283 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1057838315 9:98464508-98464530 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1058018993 9:100068308-100068330 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1058019121 9:100068593-100068615 GGCTGCCCCGTCCGGGAGGGAGG + Intronic
1058049669 9:100393065-100393087 GGCCTCCCCGTCTGGGAGGTGGG + Intergenic
1058244117 9:102603268-102603290 AGCCACCCCGTCTGGGAGGTGGG - Intergenic
1058375434 9:104316589-104316611 GGCCGCCCCATCTGGGAAGTGGG + Intergenic
1058375471 9:104316697-104316719 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
1058425876 9:104874892-104874914 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1058722926 9:107777099-107777121 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1058723081 9:107777454-107777476 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1059118088 9:111617439-111617461 AGCTGACCCGTCCGGGAGGTGGG - Intergenic
1059879805 9:118677933-118677955 AGCTGCCCCGTCCGGGAGGTGGG - Intergenic
1059879865 9:118678071-118678093 AGCTGCCCCGTCCGGGAGGAAGG - Intergenic
1060041565 9:120305190-120305212 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1060065469 9:120496849-120496871 GGCCGCCCCTACTGGGAGGTGGG + Intronic
1060080163 9:120636795-120636817 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1060080185 9:120636836-120636858 AGCCGCCCCGTCTGGGGGGTGGG + Intronic
1060406998 9:123377772-123377794 GGCTGCTCCGGCTGAGGGGGCGG - Exonic
1060625615 9:125108757-125108779 AGCCGCCCCGTCCGGGAGGTGGG + Intronic
1060687228 9:125624008-125624030 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1060703702 9:125780376-125780398 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1060703729 9:125780428-125780450 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1061667625 9:132169604-132169626 GGCTGTGCCGCCTGGTGGGTGGG - Intronic
1061737393 9:132670643-132670665 GCCTGCGCCGTCTGGGGAGGAGG + Exonic
1061831674 9:133300192-133300214 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
1061831694 9:133300234-133300256 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic
1061957166 9:133969778-133969800 GGGTGTCCAGGCTGGGGGGTGGG - Intronic
1061960025 9:133983201-133983223 GGCTTCCCAGTTTGAGGGGTGGG - Intronic
1061977313 9:134075924-134075946 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1061977331 9:134075965-134075987 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1061982974 9:134116227-134116249 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1061983599 9:134117686-134117708 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1062463690 9:136672148-136672170 GGCTACCCAGGCTTGGGGGTCGG + Intronic
1062584506 9:137243031-137243053 GGCTGCCCCGGCTGGTCAGTGGG - Exonic
1062741295 9:138176742-138176764 GGCTGCCCCGGCTGGTCAGTGGG - Intergenic
1203463930 Un_GL000220v1:68321-68343 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1203562696 Un_KI270744v1:71747-71769 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1203634388 Un_KI270750v1:97233-97255 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1203672186 Un_KI270755v1:25931-25953 GGCTGCCCCCTCTGGGCTGCCGG + Intergenic
1186328122 X:8502250-8502272 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1186854480 X:13612638-13612660 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1187183570 X:16965053-16965075 AGCTGCCCCATCTGGGAGGGAGG - Intronic
1187183666 X:16965278-16965300 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1187184208 X:16968659-16968681 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1187184234 X:16968709-16968731 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1187212476 X:17244866-17244888 CGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1187844566 X:23523085-23523107 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
1187844611 X:23523230-23523252 GGCTGTCCCATCTGGGATGTGGG + Intergenic
1187976338 X:24709029-24709051 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1188086477 X:25906148-25906170 AGCTGCCCCGTCCGGGAGGTGGG + Intergenic
1188086493 X:25906188-25906210 CGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1188214390 X:27458863-27458885 AGCCACCCCGTCTGGGAGGTGGG + Intergenic
1188214405 X:27458903-27458925 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1188214420 X:27458943-27458965 GGCCGCCCTGTCTGGGAGGTGGG + Intergenic
1188367589 X:29333594-29333616 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1188477263 X:30602700-30602722 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1188492699 X:30754000-30754022 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1189056783 X:37707224-37707246 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1189056805 X:37707271-37707293 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1189210353 X:39278013-39278035 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1189210404 X:39278140-39278162 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1189210426 X:39278188-39278210 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1189421770 X:40862851-40862873 GGCGGCCCCGTCTGGGAGGTGGG + Intergenic
1189569992 X:42285724-42285746 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1189825207 X:44911089-44911111 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1189837603 X:45040410-45040432 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1189882043 X:45503849-45503871 GGCCACCCCTTCTGGGAGGTGGG - Intergenic
1189882075 X:45503924-45503946 GGCCGCCCGGTCTGGGAGGTGGG - Intergenic
1189955858 X:46275644-46275666 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1189955959 X:46275868-46275890 AGCTGCCCCGTCTGGGAGGGAGG + Intergenic
1189968411 X:46395750-46395772 AGCTGCCCCGTCTGGGAGGGAGG - Intergenic
1189968455 X:46395848-46395870 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1190159114 X:48017242-48017264 CGCCGCCCCGTCTGGGAGGTGGG + Intronic
1190171573 X:48115574-48115596 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1190171623 X:48115701-48115723 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1190174768 X:48139345-48139367 AGCCGCCCTGTCTGGGAGGTGGG + Intergenic
1190174825 X:48139470-48139492 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1190505217 X:51119562-51119584 AGCTGCCCCATCCGGGAGGTGGG - Intergenic
1190521181 X:51280272-51280294 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1190769678 X:53504344-53504366 CACTGCCCCGTCCGGGAGGTGGG + Intergenic
1190769729 X:53504471-53504493 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1190779179 X:53578780-53578802 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1190793615 X:53721824-53721846 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1190839091 X:54129064-54129086 GGCCGCCCCGTCCGGGAGGTTGG - Intronic
1190839114 X:54129112-54129134 GGCCGCCCCGTCCGGGAGGGAGG - Intronic
1190906883 X:54736725-54736747 AGCTACCCCGTCTGGGAGGTGGG + Intergenic
1190906911 X:54736792-54736814 CGCTGCCCCATCTGGGATGTGGG + Intergenic
1191009999 X:55748936-55748958 AGCTGCCCCGTCCGGGAGGGAGG + Intronic
1191010046 X:55749035-55749057 AGCCGCCCCGTCTGGGAGGGAGG + Intronic
1191068876 X:56380066-56380088 AGCCGACCCGTCTGGGAGGTGGG - Intergenic
1191068964 X:56380254-56380276 AGCCGCCCCGTCTGGGAGGGAGG - Intergenic
1191679288 X:63825386-63825408 CGCCACCCCGTCTGGGAGGTGGG - Intergenic
1191828707 X:65392531-65392553 AGCCACCCCGTCTGGGAGGTGGG + Intronic
1191828739 X:65392611-65392633 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1191828757 X:65392648-65392670 GGCCTCCCCATCTGGGGGGTGGG + Intronic
1191835431 X:65457418-65457440 GGCCGCCCCGTCCGGGAGGGTGG + Intronic
1191894169 X:65975301-65975323 CGCTGCCCCGTCCGGGAGGTGGG - Intergenic
1192252254 X:69422422-69422444 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1192324862 X:70123287-70123309 CGCCACCCCGTCTGGGAGGTGGG + Intergenic
1192350051 X:70349408-70349430 GGCCGCCCCATCTGGGAAGTAGG - Intronic
1192350063 X:70349445-70349467 GGCCGCCCCGTCAGGGAAGTGGG - Intronic
1192476952 X:71452122-71452144 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1192500059 X:71644963-71644985 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1192500140 X:71645135-71645157 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1192505031 X:71676286-71676308 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1192505113 X:71676549-71676571 GGCTGCCCCGTCTGGGAAGTGGG + Intergenic
1192505136 X:71676625-71676647 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1192610310 X:72559965-72559987 CGCTGCCCCGTCTGGGAGGTGGG + Intronic
1192658908 X:73021911-73021933 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1192663840 X:73068816-73068838 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
1192663886 X:73068963-73068985 AGCCGCCCCGTCTGGGAAGTGGG + Intergenic
1192663934 X:73069106-73069128 GGCCACCCCGTCTGGGAGGTGGG + Intergenic
1192663946 X:73069143-73069165 GGCTGCCCCATCTGGGAAGTGGG + Intergenic
1192664024 X:73069364-73069386 GGCTGCCCTATCTGGGAAGTGGG + Intergenic
1192664102 X:73069628-73069650 AGCTGCCCCGTCGGGGAAGTGGG + Intergenic
1192664135 X:73069736-73069758 GGCCACCCCGTCTGGGATGTGGG + Intergenic
1192739970 X:73882576-73882598 CACTGCCCCATCTGGGAGGTGGG + Intergenic
1192761322 X:74098575-74098597 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1192761403 X:74098754-74098776 AGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1192768814 X:74167206-74167228 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1192768862 X:74167304-74167326 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1192794108 X:74412555-74412577 AGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1192794148 X:74412649-74412671 AGCTGCCCCGTCCGGGAGGGAGG - Intergenic
1192885665 X:75334725-75334747 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1192885681 X:75334762-75334784 GGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1192885726 X:75334912-75334934 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1192885790 X:75335130-75335152 AGCCGCCCCGTCTGGGAAGTGGG - Intergenic
1192885866 X:75335351-75335373 GGCCGCCCCATCTGGGAAGTGGG - Intergenic
1192892734 X:75407572-75407594 AGCTGCCCCGTTTGGGAGGTGGG + Intronic
1192892750 X:75407613-75407635 AGCCGCCCCGTCTGGGAGGTGGG + Intronic
1192969969 X:76218724-76218746 GGCTGCCCAGTCTGGAAGGTGGG - Intergenic
1193068101 X:77279556-77279578 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1193068125 X:77279605-77279627 AGCTGCCCTGTCTGGGAGGGAGG + Intergenic
1193068146 X:77279655-77279677 AGCTGCCCCATCTGGGAGGGAGG + Intergenic
1193328965 X:80215148-80215170 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1193328986 X:80215190-80215212 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1193345177 X:80396915-80396937 AGCCGCCCCGTCTGGGAGGGAGG - Intronic
1193362304 X:80591450-80591472 AGCCGCCCCGTCTGGGAGGGAGG + Intergenic
1193889990 X:87033229-87033251 AGCCGCCCCGTCCGGGAGGTGGG - Intergenic
1194253066 X:91602280-91602302 GGCTGCCACTGCTGGGGGATGGG - Intergenic
1194714559 X:97275235-97275257 AGCCGCCCCGTCTGGGAGGTGGG - Intronic
1195754063 X:108183593-108183615 GGATGCCCTGTTTGGGGAGTGGG - Intronic
1197185965 X:123587897-123587919 AGCCGCCCCGTCCGGGAGGTCGG + Intergenic
1197199318 X:123734335-123734357 GGCCGCCCCGTCCGGGAGGGAGG + Intergenic
1197455708 X:126674104-126674126 AGCCGCCCCGTCCGGGAGGTGGG + Intergenic
1197455813 X:126674328-126674350 CGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1198108604 X:133483800-133483822 TGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1198189098 X:134285933-134285955 CACCGCCCCGTCTGGGAGGTGGG - Intergenic
1199452655 X:147992477-147992499 AGCTGCCCCGTCCGGGAGGGAGG - Intronic
1199586524 X:149421122-149421144 AGCTGCCCCGTCCGGGAGGGAGG + Intergenic
1199836724 X:151599413-151599435 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1200143785 X:153915216-153915238 GGGTGCCAGGGCTGGGGGGTGGG + Intronic
1200154481 X:153968159-153968181 TGCTGCCAGGTGTGGGGGGTGGG - Intronic
1200324551 X:155223790-155223812 AGCCGCCCCGTCCGGGAGGTGGG - Intronic
1200572002 Y:4843524-4843546 GGCTGCCGCTGCTGGGGGATGGG - Intergenic
1200952969 Y:8918400-8918422 GGCTGCCCAGTCTGGGAAGTGGG - Intergenic
1201758884 Y:17517325-17517347 GGCTGCCCCGGCTGGTCAGTGGG + Intergenic
1201842671 Y:18388665-18388687 GGCTGCCCCGGCTGGTCAGTGGG - Intergenic
1201948304 Y:19535816-19535838 AGCTGCCCCCTCTGGGAGGGAGG + Intergenic
1202028836 Y:20552011-20552033 GGGCGCCCTGTCTGGGAGGTGGG + Intergenic