ID: 1008913144

View in Genome Browser
Species Human (GRCh38)
Location 6:56758277-56758299
Sequence TTCTGAGGAGGGCCCTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008913138_1008913144 25 Left 1008913138 6:56758229-56758251 CCAGTTCAGCTGTGGCCATTGAG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1008913144 6:56758277-56758299 TTCTGAGGAGGGCCCTTGAAGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1008913139_1008913144 10 Left 1008913139 6:56758244-56758266 CCATTGAGATGAGAACAGAAGTG 0: 1
1: 0
2: 6
3: 54
4: 414
Right 1008913144 6:56758277-56758299 TTCTGAGGAGGGCCCTTGAAGGG 0: 1
1: 0
2: 3
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008913144 Original CRISPR TTCTGAGGAGGGCCCTTGAA GGG Intronic
903405397 1:23091330-23091352 TTTTGAGCAGGGCACTCGAAGGG - Exonic
911441189 1:97927591-97927613 TTATGAGGTGGGCCCTTTGAGGG - Intergenic
913349029 1:117837627-117837649 TCCTGAGGCTGGCCCTTGCAGGG + Intergenic
915008074 1:152658927-152658949 CACTGCGGAGGGCCCTTCAAAGG + Intergenic
917517066 1:175716977-175716999 TTCTGAGGAGGGCTCTGTAATGG - Intronic
918240578 1:182616679-182616701 TTCTGAGGCTAGCCCTTGCAAGG + Intergenic
919057807 1:192592495-192592517 TGCTGAGGAGGCCACTTCAAGGG - Intergenic
920097107 1:203493453-203493475 TTGGGAGGTGGGCCCTAGAAAGG - Intergenic
923225991 1:231939460-231939482 TCCTTTGTAGGGCCCTTGAATGG + Intronic
923276321 1:232400063-232400085 TATTGAGGAGGGCCTTGGAAGGG - Intronic
924378526 1:243438666-243438688 CTCTGAGAGGGGCCTTTGAAGGG + Intronic
1062951551 10:1507458-1507480 TGCTCACGAGGGGCCTTGAAGGG - Intronic
1063126979 10:3144053-3144075 TGCCGAGGAGGGCCCTGGTATGG - Intronic
1063908514 10:10805533-10805555 TTACGAGGCGGGCACTTGAAGGG + Intergenic
1064063003 10:12154989-12155011 GACTGAGGAGGTCACTTGAAGGG + Intronic
1064202065 10:13293201-13293223 TTGTGAGGATGGCTCTTGAATGG - Intronic
1067251145 10:44587944-44587966 TCCTGAGGAGGGCCCAGGGAGGG - Intergenic
1068556730 10:58466843-58466865 TTCTGAGGAGGGCCCTGGTCAGG - Intergenic
1069616230 10:69807886-69807908 GTCTGCTGAGGGCCCTGGAATGG - Intronic
1070808357 10:79284314-79284336 TGCTTAGGAGGGTCCTTAAAGGG + Intronic
1071837447 10:89432681-89432703 TTCTGAGGAGGGAACATGAAGGG + Exonic
1077200191 11:1302901-1302923 GTCTGAGGAAGGCCCCGGAAGGG - Intronic
1077643839 11:3905838-3905860 CTCTAAAGAGGGCCCTTGCAGGG + Intronic
1084477652 11:69398176-69398198 TCCTGAGGAGGGATCTTGAGAGG - Intergenic
1084921842 11:72477257-72477279 GTCTGGGGAAGGACCTTGAAAGG + Intergenic
1085018806 11:73192303-73192325 TTCTGAGGGCTGCCCTTGACTGG + Intergenic
1085744593 11:79103781-79103803 TTCTGCAGTGGGCACTTGAAGGG + Intronic
1088981105 11:114864788-114864810 TTATGAGTAGGGGACTTGAAAGG - Intergenic
1089014428 11:115154838-115154860 CTCTGAGGAGGCCCCATGTATGG - Intergenic
1089409909 11:118232162-118232184 CTCTGAGGAGGGGCCATGATTGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090802263 11:130180278-130180300 TCCTGGGGAGGGACCGTGAAGGG - Intronic
1091346343 11:134856803-134856825 TTCTGAGGAGGGTTCTTGGACGG + Intergenic
1091743769 12:2977866-2977888 TTCTGAGAAGGGCCCTTTTTTGG + Intronic
1101624510 12:106425648-106425670 TTCTGTGGAGTGCTCATGAAAGG - Intronic
1101842538 12:108338976-108338998 TTCTGAGGGGGGCCAGGGAAGGG - Intronic
1102220438 12:111190863-111190885 GTGTGAGGAGGGTCCTTGGAGGG - Intronic
1104594849 12:130113938-130113960 TACAGAGGAGTGCCCATGAAAGG + Intergenic
1104961744 12:132491280-132491302 TTCTCAGCAGAGCCCTCGAAGGG - Intronic
1106483875 13:30156092-30156114 TTCTGAGGAGGGCTCTGGAAGGG + Intergenic
1110495977 13:76168392-76168414 TTCTGAGGTGGGCTTTTGGAAGG - Intergenic
1110778652 13:79439290-79439312 TTCTGGTGAGGGCCCTTGTATGG + Intergenic
1113591334 13:111503356-111503378 GGCTGAGGAAGGCCCTTGGATGG + Intergenic
1117354498 14:54910962-54910984 TTCTGGGAAAGGCCCTTAAAAGG + Intergenic
1117816733 14:59606546-59606568 TTCTGTTGAGGGCCCTTGCCTGG - Intronic
1118179631 14:63479348-63479370 TTCTGAGGATGATCCTTGAGGGG - Intronic
1118842554 14:69524108-69524130 GGCTCAGGAGGGCTCTTGAATGG - Intronic
1122499847 14:102190073-102190095 TTGTGTGGAGGGCCAGTGAAGGG + Intronic
1122885607 14:104709066-104709088 TCCTGAGCAGGGCCCATGGAGGG + Intronic
1122925575 14:104897989-104898011 TTCTGAGTGGGGCCCCTTAACGG + Intergenic
1127185231 15:56472405-56472427 TTCTGAGCAGGGCACTTCCATGG + Intergenic
1131733491 15:95306924-95306946 TTCTGGTGAGGGCCCTTTACTGG + Intergenic
1135153883 16:20035490-20035512 TTCTGAGCTGTGCCCTTGAAGGG + Intronic
1138446953 16:57070573-57070595 CGCTGATGAGGGCCCTTGAGGGG + Exonic
1138885312 16:61069964-61069986 TTCTGTGGATTGCCATTGAATGG - Intergenic
1139296434 16:65905558-65905580 TCCTTGGGAGGCCCCTTGAATGG + Intergenic
1140477030 16:75244173-75244195 CTCTGAGGAGGGACCTTGCAGGG - Intronic
1142358099 16:89613596-89613618 TCCTGAGGAGGGGCCTGGGAGGG + Intronic
1143363339 17:6388878-6388900 TTGTGGGGAGAGTCCTTGAAAGG - Intergenic
1149290575 17:55214380-55214402 TTCTGAGCAGGGCCTTTGCCAGG + Intergenic
1151994814 17:77601834-77601856 TTCTGGGTAGGGCCCTGGGAAGG - Intergenic
1157589998 18:48830696-48830718 TTCTGAGCAGAGCCCTGGACAGG - Intronic
1163249185 19:16116107-16116129 CCCTGAGGAGGGAACTTGAATGG + Intronic
1164744448 19:30600793-30600815 TTCTGAGGAGGTCTCTGCAAAGG - Intronic
1166809509 19:45507192-45507214 TTCTGAGGAGGGTCTCGGAAGGG - Intronic
1167475277 19:49697031-49697053 TTCTGAGGCAGGACCTGGAAGGG - Intronic
1167527576 19:49994618-49994640 TCCTGTGGAGGGCCCTTGGGGGG - Intronic
925310138 2:2876089-2876111 TGCTGAGGTGGGCCAGTGAAGGG + Intergenic
928201258 2:29249174-29249196 CTCTCAGGAGATCCCTTGAATGG - Intronic
929079772 2:38110733-38110755 ATCTGAAGAGGGCCAGTGAAAGG - Intergenic
930251656 2:49041605-49041627 TTCTGAGGAAGGCCCAAGATAGG + Intronic
933273818 2:80262677-80262699 TTGTGAGGGAGGCCTTTGAAAGG + Intronic
933312301 2:80675959-80675981 TTCTGAGGAGGGCCAGTGGAGGG + Intergenic
933997359 2:87679622-87679644 TTCTCAGGAGGAGCCTAGAAAGG + Intergenic
934955101 2:98610575-98610597 TCCTGAGGTGGGCCCTTGCCAGG - Intronic
936289160 2:111206262-111206284 TGCTGAGGAGTGTCCTTGACCGG - Intergenic
936296491 2:111271288-111271310 TTCTCAGGAGGAGCCTAGAAAGG - Intergenic
937124989 2:119469094-119469116 ATGTGAGGAAGACCCTTGAAGGG + Intronic
937493289 2:122392375-122392397 TTCTGAGCTGGGGCTTTGAAGGG + Intergenic
938689796 2:133777057-133777079 TTCTGTGGAGTGTGCTTGAAGGG + Intergenic
939939533 2:148333200-148333222 TTCTGAGGAAAGCCCTTAACAGG - Intronic
942639689 2:178048491-178048513 TTCTGAGGAGGACCAAGGAATGG - Intronic
942672468 2:178390651-178390673 TTATGAGGAGGGCCCTCAAGTGG - Intronic
947023234 2:225707430-225707452 TTCTCACAAGGGTCCTTGAAAGG + Intergenic
948918513 2:241050747-241050769 CTCTGGGCAGGGCCCATGAAGGG - Intronic
1170722946 20:18900309-18900331 TTCTCAGGAGGGCACTTGAAGGG + Intergenic
1172611049 20:36252857-36252879 TTCTGGGGAGGGGCCTGGTATGG - Intronic
1177732201 21:25042071-25042093 TCCTGAGGAGGGGTCTAGAAGGG - Intergenic
1177912039 21:27044568-27044590 TTCTGAGCTAGGACCTTGAATGG + Intergenic
1178632393 21:34273862-34273884 TTCAGAGAAGGGCCCATTAAAGG - Intergenic
1178947553 21:36960521-36960543 TTCTGATGGGGGCCCTGGAGCGG - Intronic
1179470907 21:41609761-41609783 TTCTGTGTGGGGTCCTTGAAGGG - Intergenic
1180183588 21:46128807-46128829 TTCTCAGGCGGGCTCTTGAGGGG + Intronic
1183083755 22:35474098-35474120 TGCTGAGGGGGGCCCTGGACAGG + Intergenic
1183553561 22:38507416-38507438 TTCTGAGGAGCGCCGTTCAACGG - Intronic
1184122475 22:42461194-42461216 TTCTGAGGAGGGTTTTTGACAGG + Intergenic
1184852781 22:47130286-47130308 TCCTGAGGAGGGGCCTAGAAGGG - Intronic
950221664 3:11201007-11201029 TTCTGAGGAGAGGCCCTCAAAGG - Intronic
950442779 3:13019593-13019615 TTCTGTTGAGAGCCCCTGAAAGG - Intronic
951120386 3:18920089-18920111 TTCAGAGGATAGCTCTTGAAAGG + Intergenic
953083305 3:39641797-39641819 TTCTTGGGATGGCCCTTGAAGGG + Intergenic
953874971 3:46661452-46661474 TTCGGAGCAGGGTCCTTAAAGGG + Intergenic
955695306 3:61629880-61629902 TTGACAGAAGGGCCCTTGAAAGG - Intronic
956072615 3:65470385-65470407 TTCTGAGAAGGGTCCGTGATGGG + Exonic
959283377 3:104376726-104376748 TTCTTAGGAGAGCACTTGTAAGG - Intergenic
960798896 3:121517633-121517655 TTCTGAGCAGCGGCCTTAAAGGG + Intronic
964289867 3:155165852-155165874 TTCTGCTAATGGCCCTTGAAGGG - Intronic
964424317 3:156535218-156535240 TTCTGAGGATAGCACTTGACTGG + Intronic
969712378 4:8851518-8851540 TTCTACAGAGGGCCCTTGGATGG - Intronic
974406557 4:61479346-61479368 TTTTGAGAATGGCCCTTGCATGG - Intronic
975163239 4:71147733-71147755 TTCTGAGGAGGGGTCCTGAGGGG + Intergenic
978498115 4:109381508-109381530 TGCTGAGAAGGGCCCTTAGAGGG - Intergenic
979870994 4:125821949-125821971 TTCTGATGAAGGCCCTTGCATGG - Intergenic
979919174 4:126477389-126477411 TGCTGTGGAGTGCCCTTGGAAGG + Intergenic
981853526 4:149259513-149259535 TCCTGAGGAGGGCTCTTCAGGGG - Intergenic
985643509 5:1074496-1074518 TTCTGAGGTCGGCCTTTGAGTGG - Intronic
985647170 5:1090412-1090434 TTCTGACGGGGGCCCTGGAGAGG + Intronic
986024506 5:3838038-3838060 TTCTGAGAAGTCCTCTTGAAGGG - Intergenic
988407520 5:30842443-30842465 ATCTGAGGAGCACCCTAGAATGG - Intergenic
989804644 5:45587980-45588002 TTCTGATGAGGGCCCTTTTCTGG - Intronic
990698248 5:58446628-58446650 GTCAGAGGAGGGCCACTGAATGG - Intergenic
991503546 5:67301461-67301483 TCCTGAGGGCGGCCCTGGAAAGG - Intergenic
993332529 5:86618109-86618131 CTATGAGGAGGGCCCTGGGAAGG + Exonic
993531855 5:89035039-89035061 TTATGAGGGGGGCCCTATAATGG + Intergenic
997366316 5:133327476-133327498 CTCTCAGGAGGGGCCTGGAAGGG + Intronic
997420843 5:133765617-133765639 TTCTTGGGAAGGCCCTTGAATGG + Intergenic
999194593 5:149773540-149773562 TTGTGAGGAGGGACCTGGGAGGG - Intronic
999282749 5:150375766-150375788 TTCTGAGGGGGCCCCTTGGCAGG - Exonic
1000442025 5:161275293-161275315 TTTAGAGGAGGGCCTTTGACAGG + Intergenic
1004644975 6:17552150-17552172 TTCTCAGAAGGGCCATTGGATGG - Intronic
1004718846 6:18247173-18247195 TTCTGTGAAAGGCCTTTGAAAGG - Intronic
1005903299 6:30238075-30238097 TTCTGAGTAGTGCTCTGGAAGGG + Intergenic
1006296790 6:33173388-33173410 TTCCCAGGGGGGCCCTGGAAGGG + Exonic
1008913144 6:56758277-56758299 TTCTGAGGAGGGCCCTTGAAGGG + Intronic
1010488554 6:76446840-76446862 TTCTCAGTAGAGCCCTTGCAAGG - Intergenic
1013415017 6:109917350-109917372 TTCTGAGGAGGGCATTAGAGGGG - Intergenic
1013611864 6:111803240-111803262 TTCAGAGGAGTGCCCCTGAAGGG - Intronic
1017856467 6:158354090-158354112 TCCTGAGGAGTGCCTTTGGAAGG + Intronic
1018218598 6:161555641-161555663 TCCTGAGGAGGGCCTTTGCCTGG + Intronic
1019767657 7:2863549-2863571 TACTGAGAAGGGCCCTTGCTCGG - Intergenic
1020689378 7:11335941-11335963 CTCTGAGGAAAGCTCTTGAAAGG + Intergenic
1021415317 7:20377039-20377061 TTCTGCTGAGGGCCCTTGTGTGG + Intronic
1022212565 7:28225789-28225811 TCCTGGGGAGGGCCCTGGAAAGG + Intergenic
1022537304 7:31106248-31106270 TTCTGAGCAAGGCCCTCTAATGG - Intronic
1024059411 7:45686780-45686802 TGCTGAGGAGGGCCCTCCGAGGG - Intronic
1024404346 7:48961457-48961479 GTCTGAGGAGGGCCTTGGAGAGG + Intergenic
1024557974 7:50620123-50620145 TTCTGAGGAGGTGCCTGGGAAGG - Intronic
1029361540 7:100091784-100091806 TTCTGATGAGGGTACTTGAAGGG + Exonic
1033114171 7:138610759-138610781 TTCTCAGGGAGGCCCTTCAAGGG - Intronic
1033993951 7:147322157-147322179 TTCAGGGGAGTGGCCTTGAAGGG - Intronic
1034272205 7:149808816-149808838 TTCTGAGGAGGGGCCCTGTTAGG - Intergenic
1035376859 7:158412036-158412058 TGCTGAGGAGGGCACTGGATGGG - Intronic
1035376934 7:158412303-158412325 TGCTGAGGAGGGCGCTGGATGGG - Intronic
1035376959 7:158412392-158412414 TGCTGAGGAGGGCGCTGGATGGG - Intronic
1035376976 7:158412451-158412473 TGCTGAGGAGGGCGCTGGATGGG - Intronic
1035377017 7:158412599-158412621 TGCTGAGGAGGGCACTGGATGGG - Intronic
1035377052 7:158412717-158412739 TGCTGAGGAGGGCGCTGGATGGG - Intronic
1035377086 7:158412835-158412857 TGCTGAGGAGGGCACTGGATGGG - Intronic
1035377112 7:158412923-158412945 TGCTGAGGAGGGCGCTGGATGGG - Intronic
1036763031 8:11525696-11525718 TTCTGAGGAGGGCACATGAGTGG - Intronic
1039800669 8:40951922-40951944 CTCTGAGGAGGGACCCTGACCGG - Intergenic
1041039559 8:53833672-53833694 TGCTGGGGAGGAGCCTTGAAGGG - Intronic
1042033037 8:64498490-64498512 TTCTGAGCTGTGCCCTTAAAGGG + Intergenic
1043482790 8:80669748-80669770 ATCTGAGAAGGGACCTTGAGAGG - Intronic
1043991465 8:86760853-86760875 TTGTGAGCAGCCCCCTTGAAAGG + Intergenic
1049279873 8:141738764-141738786 TTCTGAGGCAGGCCCCTGACAGG + Intergenic
1049732130 8:144183993-144184015 TGCTGAGGAGGGGCCTTGAAGGG - Intronic
1053307968 9:36997203-36997225 TTCTAAGGAGGGCACAGGAAGGG - Intronic
1053455555 9:38230855-38230877 GTCAGAGGATGGCCCTGGAAGGG - Intergenic
1057515489 9:95716794-95716816 TTCTCAGGAAAGCCCTTTAAAGG - Intergenic
1058002292 9:99878491-99878513 ATCTGAGGAAGGCCCAAGAAAGG + Intergenic
1058736263 9:107897002-107897024 TTCTGGGGAGACCCCTTGAGGGG - Intergenic
1061012655 9:127964511-127964533 CTCTGAGGAGAGCCCCTGATGGG - Intronic
1186728468 X:12382650-12382672 TCCTGAGGACTGCCCTAGAAAGG - Intronic
1189590152 X:42502245-42502267 CTCTGAGCAGGGCTCTTGAAAGG + Intergenic
1197561878 X:128034249-128034271 TTTTGAGGTGGGGCCTGGAATGG - Intergenic
1198077808 X:133211377-133211399 TTCTGAGGAGGAGTCTTGATTGG - Intergenic