ID: 1008927027

View in Genome Browser
Species Human (GRCh38)
Location 6:56897832-56897854
Sequence TAGTGAGTCAGGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 423}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008927027_1008927038 23 Left 1008927027 6:56897832-56897854 CCCTGCTCCCTCCTGACTCACTA 0: 1
1: 0
2: 5
3: 27
4: 423
Right 1008927038 6:56897878-56897900 TCAGGCACCATCCTTGTGGAAGG 0: 1
1: 0
2: 2
3: 9
4: 145
1008927027_1008927035 19 Left 1008927027 6:56897832-56897854 CCCTGCTCCCTCCTGACTCACTA 0: 1
1: 0
2: 5
3: 27
4: 423
Right 1008927035 6:56897874-56897896 ACCCTCAGGCACCATCCTTGTGG 0: 1
1: 0
2: 2
3: 14
4: 128
1008927027_1008927034 5 Left 1008927027 6:56897832-56897854 CCCTGCTCCCTCCTGACTCACTA 0: 1
1: 0
2: 5
3: 27
4: 423
Right 1008927034 6:56897860-56897882 TGGCAGTAGCTGCAACCCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 120
1008927027_1008927039 24 Left 1008927027 6:56897832-56897854 CCCTGCTCCCTCCTGACTCACTA 0: 1
1: 0
2: 5
3: 27
4: 423
Right 1008927039 6:56897879-56897901 CAGGCACCATCCTTGTGGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008927027 Original CRISPR TAGTGAGTCAGGAGGGAGCA GGG (reversed) Intronic
900776064 1:4586288-4586310 TACTGATTCAGGAGGGTGAAAGG + Intergenic
900932909 1:5747872-5747894 GAGGGAGGCAGGAGGGAGAAAGG + Intergenic
903537642 1:24077495-24077517 GAGTGAGCCAGGAGGGAGGCGGG - Intronic
903973364 1:27133557-27133579 GAGTGAGCCTGGTGGGAGCAGGG + Intronic
904313358 1:29643528-29643550 AAGTGACTAAGGAGGCAGCAGGG + Intergenic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
906254860 1:44340595-44340617 CAGTGAGTCAGGAGAGAGATGGG - Intronic
906741170 1:48186952-48186974 TAGTTAGGCAGGTGTGAGCAAGG - Intergenic
908457276 1:64315992-64316014 TAAGCAGACAGGAGGGAGCAAGG - Intergenic
909338551 1:74505343-74505365 ACTGGAGTCAGGAGGGAGCAGGG - Intronic
909958230 1:81802956-81802978 TCGTGGGTCGGGAGGGTGCAGGG + Intronic
911863316 1:102983591-102983613 TAGAAACTCTGGAGGGAGCATGG + Intronic
913134359 1:115873676-115873698 TAATGAATGAGGAGGGAGAAGGG + Intergenic
913293288 1:117294996-117295018 TAGAGTGTCTGGAGGGAGCACGG + Intergenic
913323596 1:117607044-117607066 TCGCGAGGCAGGAGGGAGCAGGG + Intronic
913530621 1:119731945-119731967 TAGGGACACAGGTGGGAGCAAGG + Intronic
913965925 1:143377507-143377529 TCTTGAGGCAGGAGGAAGCAAGG - Intergenic
914060299 1:144203115-144203137 TCTTGAGGCAGGAGGAAGCAAGG - Intergenic
914118851 1:144763254-144763276 TCTTGAGGCAGGAGGAAGCAAGG + Intergenic
914254938 1:145954202-145954224 TAGAGCTTCTGGAGGGAGCACGG + Intronic
914667988 1:149847929-149847951 TAGTGGGTTTGGAGAGAGCATGG + Intronic
916075360 1:161197362-161197384 TAGAGAGGGAGGAGGGAGGAGGG + Intronic
916816836 1:168362402-168362424 TAGCTAGTCAGGTGTGAGCAGGG + Intergenic
916992465 1:170259152-170259174 TAGAGAGACAGGAGTGTGCAAGG - Intergenic
918001890 1:180505264-180505286 TAGCTAGTCAGGAATGAGCAGGG + Intergenic
919771015 1:201158599-201158621 ATGTGAGCCAGGAGGGAGCCGGG + Intronic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
921745190 1:218732501-218732523 TAGTGAGGCCAGAGAGAGCAAGG + Intergenic
922089518 1:222382381-222382403 GGGTGAGTCAGGAGGCAGAAAGG + Intergenic
922705269 1:227787230-227787252 TGGTGTCTCAGGAGGGCGCAGGG + Intergenic
922816415 1:228452725-228452747 TGGAGGGTCAGGAGGGATCAGGG - Intergenic
923044068 1:230342223-230342245 TAGAGAGGCAGGAGGGTGCCCGG - Intronic
924164075 1:241264050-241264072 TAGTAAGTCAGGGTGGTGCACGG - Intronic
924290484 1:242531219-242531241 CACTGAATCAGGAGGGAGGAGGG - Intergenic
924447636 1:244148776-244148798 TTGTGAGTCAGGGGGCAGCATGG + Intergenic
1063413715 10:5856480-5856502 TAGACAGACAGGAGGGAGCCAGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1065001691 10:21343144-21343166 TAGAGGTTCTGGAGGGAGCACGG - Intergenic
1066260478 10:33724955-33724977 TTCTGAGGCAGGAGGGAGGAGGG - Intergenic
1068959820 10:62855340-62855362 TTGGGAGTCAGGGGGGAGAATGG + Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069842769 10:71350115-71350137 GAGTGAGTCTGTAGGGAGCTGGG - Intronic
1070776394 10:79112351-79112373 TAGCAATTCAGGTGGGAGCATGG + Intronic
1070789302 10:79180126-79180148 AAGGGAGCCAGGAGGGGGCATGG + Intronic
1070843506 10:79504111-79504133 GAGAGAGAGAGGAGGGAGCACGG + Intergenic
1071969240 10:90886281-90886303 AAGAGAGTCAAGAGGGAACAGGG + Intronic
1072573487 10:96678626-96678648 GTGTGAGTCAAAAGGGAGCATGG + Intronic
1073043919 10:100625074-100625096 AAGGGACTCAGGAGGGAGCCAGG - Intergenic
1073360095 10:102891320-102891342 TAGCTAGTCAGGCGTGAGCAGGG - Intronic
1074729018 10:116348805-116348827 TCCTGAGGCAGGAGGAAGCAGGG - Intronic
1075587816 10:123670037-123670059 CAGTGAGTCAGGGAAGAGCAAGG - Intronic
1075617019 10:123897554-123897576 TAGTGTGTCAGGGTGCAGCATGG + Intronic
1076793042 10:132786723-132786745 GAGTGAGGCAGGCGGGAGCGGGG + Intergenic
1079035361 11:17015070-17015092 ATGTGAAACAGGAGGGAGCAGGG + Intergenic
1080685962 11:34514923-34514945 TATTGAGTCAGGAAGGAACGGGG - Intergenic
1080930248 11:36802525-36802547 CAGTGAGTCAGAGGGGAGAAGGG + Intergenic
1081075531 11:38668201-38668223 TATTGATACAGGAGGGGGCAGGG - Intergenic
1081969373 11:47187170-47187192 TAGGGAGAGAGGAGGGAGAAGGG - Intergenic
1082960177 11:58912444-58912466 TAGGGAGTGTGGAGGAAGCAAGG - Intronic
1083628615 11:64084676-64084698 GGGCCAGTCAGGAGGGAGCAGGG + Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083877302 11:65531093-65531115 TAAGCAGTCAGGAGGGAGGAGGG - Intronic
1083993810 11:66262266-66262288 AAGTGAGGCAGGAAGGAACATGG - Intronic
1084085085 11:66851340-66851362 GAGTGGGTCAGGAAGGAGCCAGG - Intronic
1086319642 11:85631121-85631143 TAGAGAGGTAGGAGAGAGCAGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087080868 11:94169770-94169792 TGGAGACTCGGGAGGGAGCATGG + Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088520210 11:110689609-110689631 TAGCTAGTCAGGTGTGAGCAGGG + Intronic
1088824524 11:113482676-113482698 TGGAGAGTCAGGTGGGAGCTGGG + Intergenic
1089084997 11:115809485-115809507 AATTGAGTCAGGAGGGAGCACGG - Intergenic
1089303226 11:117511169-117511191 TAGGGAGGGAGGAGGGAACATGG + Intronic
1089687170 11:120160618-120160640 TAGTGACTCAGAAGGCAGGAAGG + Intronic
1089884724 11:121808976-121808998 TAGTGAGAGAGGTGGGTGCAGGG - Intergenic
1090474668 11:127009006-127009028 CAGTGAGACAGAAGGAAGCAGGG - Intergenic
1091410383 12:235255-235277 TTGTGAGTGAGGAAGCAGCAGGG + Intronic
1092526619 12:9313636-9313658 GAGTGACTCAGGAAGGAGGAGGG - Intergenic
1092540654 12:9418143-9418165 GAGTGACTCAGGAAGGAGGAGGG + Intergenic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1094512394 12:31104340-31104362 GAGTGACTCAGGAAGGAGGAGGG - Exonic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096101458 12:48972625-48972647 GGGTGAGTCAGGCGGGAGCACGG - Intergenic
1096113471 12:49041896-49041918 TGGTGAGGCAGAAAGGAGCATGG - Exonic
1096519246 12:52174838-52174860 TAGGGAGGCAGGTGGGACCAGGG + Intronic
1097242624 12:57586135-57586157 TAGTGGGTCTGGAGACAGCATGG - Exonic
1097353124 12:58570797-58570819 TAGGTAGACAGAAGGGAGCATGG + Intronic
1098838878 12:75455045-75455067 TAGTGGCTTGGGAGGGAGCATGG - Intergenic
1099687720 12:85910736-85910758 TAGTTAGTCAGGCATGAGCAGGG + Intergenic
1100912469 12:99381107-99381129 TAGTGCATTTGGAGGGAGCATGG + Intronic
1101718779 12:107333370-107333392 TAGGGAGGCAGGAGAGAGCTGGG + Intronic
1101789108 12:107911917-107911939 CAGTGAGTGAGGAGGGACCCTGG - Intergenic
1102168592 12:110824966-110824988 GAGGGAGCCAGGAGGGAGCCAGG + Intergenic
1102190036 12:110980842-110980864 TAGAGAGACAGGAGGGAGGACGG + Intergenic
1102819354 12:115894782-115894804 TGTTGAGTGAGAAGGGAGCAAGG + Intergenic
1103457866 12:121080285-121080307 TACTGGGGCAGTAGGGAGCAGGG - Intergenic
1104056066 12:125231069-125231091 TAGAGCCTCCGGAGGGAGCACGG - Intronic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1106310404 13:28549205-28549227 AGGTGAGACAGGAGGGAACAAGG + Intergenic
1108140968 13:47420844-47420866 TAGTGACTCAGAAGTGAGCCAGG + Intergenic
1108362599 13:49680920-49680942 TTGGGAGTCAGGAGGGAGAGAGG - Intronic
1108586145 13:51871456-51871478 AAGTGATTCAAGAGAGAGCAAGG - Intergenic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1112697437 13:101966389-101966411 TACAGACTCTGGAGGGAGCATGG + Intronic
1112798669 13:103086215-103086237 TAGTGACTCAAGAAGCAGCAAGG + Intergenic
1113037252 13:106063732-106063754 TCGTGCTTGAGGAGGGAGCAAGG - Intergenic
1113576788 13:111400509-111400531 TAGAGAGAGAGGAGGGAGGAGGG - Intergenic
1113632563 13:111898037-111898059 GAGTGACTCAGGGAGGAGCAGGG + Intergenic
1116139670 14:40975241-40975263 GAGTGATTCAGGAGAGAGCAAGG + Intergenic
1118324104 14:64769833-64769855 CAGAGAGAGAGGAGGGAGCACGG - Intronic
1118603959 14:67489578-67489600 AAAGGAGTGAGGAGGGAGCAGGG - Intronic
1118714615 14:68550141-68550163 TCATGGGCCAGGAGGGAGCACGG - Intronic
1118734182 14:68690343-68690365 TCCTGAGTCAGAGGGGAGCAGGG + Intronic
1119770863 14:77219924-77219946 CAGGGAGTGGGGAGGGAGCAGGG + Intronic
1120163492 14:81170109-81170131 CAGTGAGCCAAGAGAGAGCAGGG + Intergenic
1120700630 14:87695105-87695127 TGGTGAGGTAGGAGGGAGCTAGG + Intergenic
1121171139 14:91855362-91855384 TAGAGCCTCTGGAGGGAGCATGG - Intronic
1123002606 14:105303985-105304007 TAGTCTGTCAGGTGAGAGCAAGG - Exonic
1125159746 15:36629071-36629093 TAGAGCCTCTGGAGGGAGCATGG + Intronic
1125321108 15:38490015-38490037 TAGTGAGGAAGGAGGGTACATGG + Exonic
1125343974 15:38700410-38700432 TAGTCAGGCAGGAGGGAGAGAGG + Intergenic
1125730258 15:41889010-41889032 ATCTGAGTCAGCAGGGAGCAGGG + Intronic
1125934737 15:43625415-43625437 TAGGAAGTCAGGAGGGGGCCAGG + Intergenic
1128072674 15:64807378-64807400 GAGTGGGTCATGGGGGAGCACGG - Intergenic
1128539402 15:68515903-68515925 TAGGGAGGTAGGTGGGAGCAGGG - Intergenic
1128776622 15:70325207-70325229 TAGGGAGTCAGAGGTGAGCATGG - Intergenic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1129248097 15:74292267-74292289 TGGTGAGTCAGGGTGGAGGATGG - Intronic
1130826078 15:87547608-87547630 TAGGGAGGGAGGAGGTAGCAGGG + Intergenic
1130841024 15:87701352-87701374 CAGTGAGTGAGTAGTGAGCAGGG - Intergenic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131065658 15:89433569-89433591 TTCAGAGTCTGGAGGGAGCAGGG + Intergenic
1134378199 16:13699322-13699344 GAGTGATTCAGGAAAGAGCAAGG - Intergenic
1134880863 16:17744805-17744827 GAGTGAGTTAGGAGGAGGCAGGG + Intergenic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136634436 16:31510654-31510676 TCCTGAGTGGGGAGGGAGCATGG + Intergenic
1138351157 16:56346953-56346975 TAGAGTGTTAGGTGGGAGCAGGG - Exonic
1138791793 16:59912987-59913009 TGGTGAGTCAGGAGGAAACGTGG + Intergenic
1139430103 16:66906520-66906542 TAGGGAGATAGGAGGGTGCATGG - Intergenic
1139645533 16:68326889-68326911 TGATGAGTCAGAAGGCAGCAGGG + Intronic
1139842339 16:69891724-69891746 TAGTGAGTCAGGAGAGAACTGGG - Intronic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1140127968 16:72133626-72133648 TAGCTAGTCAGGTGTGAGCAGGG + Intronic
1140145810 16:72307321-72307343 CTATGAGTCAGGAGGGAGGAAGG + Intergenic
1140924801 16:79571942-79571964 GAGTGAGTCAGGCAGGGGCAGGG - Intergenic
1141503901 16:84462421-84462443 CAGGGAGGAAGGAGGGAGCAAGG + Intronic
1141553065 16:84819112-84819134 TTGTGACTGAGGCGGGAGCACGG + Intergenic
1143378348 17:6480367-6480389 CAGCCAGTCAGGAGAGAGCACGG - Intronic
1144038255 17:11386507-11386529 TAGTCAGCCAGAAGGGAGGATGG + Intronic
1144095602 17:11897938-11897960 TAGAGCCTCTGGAGGGAGCACGG - Intronic
1144199549 17:12927752-12927774 TGGGAAGTCAGGCGGGAGCAGGG - Intronic
1145015047 17:19391120-19391142 CAGTGAGTCAGGAGGCTGTATGG - Intergenic
1145392074 17:22462810-22462832 GAGTGAGGCAGGAGGGTTCAGGG + Intergenic
1146255237 17:31388501-31388523 AAGGGAGGCAGGAGGGAGCCTGG + Intergenic
1146916079 17:36679350-36679372 CACTGAGGCAGGAGGGAGCCGGG - Intergenic
1147308207 17:39578216-39578238 GAGTGAGAGAGGAGGGGGCAGGG - Intergenic
1148074815 17:44929141-44929163 GGGTGAGGCAGGAGGGAGCCAGG - Intronic
1149582085 17:57757775-57757797 TAGAGAGTTAGGAGGAAGCTTGG - Intergenic
1149830594 17:59868319-59868341 ATGTGATCCAGGAGGGAGCAAGG - Intronic
1150455192 17:65301639-65301661 TAGGGAGTCAGGAGAAAACACGG - Intergenic
1151025045 17:70668670-70668692 TAGTTGGACAGGAGGGAGCAAGG + Intergenic
1151245661 17:72792682-72792704 TATTGACCCAGGAGGGATCATGG - Intronic
1151355545 17:73555894-73555916 CAGAGAGTCAGGGGGGACCAGGG + Intronic
1151510428 17:74555796-74555818 TAGTGATCCAAGAGAGAGCAAGG - Intergenic
1151833450 17:76569112-76569134 GAGTGAGTCAGGAGGGGGTGGGG + Intronic
1153217244 18:2832201-2832223 TAGTTAGTCAGGCATGAGCAGGG + Intergenic
1153601055 18:6781676-6781698 CAGTGTGTCAGGTGGGAGCTGGG - Intronic
1155423837 18:25685207-25685229 TGGGGAGGCAGGAAGGAGCACGG + Intergenic
1156787434 18:40932375-40932397 TAGTAATACAGGAGGGAGAATGG + Intergenic
1156858147 18:41806683-41806705 CAGTGATGCAGAAGGGAGCATGG + Intergenic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1157723628 18:49945505-49945527 TAGTGATCCAGGAGAGAGCTGGG - Intronic
1158847596 18:61461409-61461431 TAGTGGCTGTGGAGGGAGCATGG - Intronic
1158867176 18:61649109-61649131 AAGTGCATCAGCAGGGAGCAGGG - Intergenic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1161234207 19:3189986-3190008 GAGTGAGCGAGGAGGGAGAAGGG - Intronic
1163245058 19:16088335-16088357 GAGTGAGACAGGAGGCAGCAGGG + Intronic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164858413 19:31543328-31543350 TAATGGGTCAGGATTGAGCAAGG + Intergenic
1165250069 19:34524059-34524081 GAGTGAGGCTGGTGGGAGCAGGG - Intergenic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165882451 19:39053498-39053520 TTGTGAGCCAGGATGCAGCACGG - Intergenic
1166015318 19:39974877-39974899 CAGTGAGCGAGCAGGGAGCAAGG - Intronic
1167096647 19:47378091-47378113 TAGTGAGCCAGGAGGCAGGAGGG - Intronic
1168102497 19:54148534-54148556 CAGTGAGTGAGGAGGCAGCGGGG + Exonic
1168240827 19:55088073-55088095 TAGGAGGTCAGGAGGGAGCCTGG - Intergenic
1202699703 1_KI270712v1_random:155000-155022 TCTTGAGGCAGGAGGAAGCAAGG - Intergenic
925489131 2:4372603-4372625 GAGTGACTCAAGAGGAAGCAAGG - Intergenic
927472206 2:23385196-23385218 GAGCGAGCCAGAAGGGAGCATGG + Exonic
928018377 2:27680548-27680570 GAGTGAGTGAGGTGGGAGGATGG + Intronic
928314401 2:30234518-30234540 TAGAGAGTCAGAGGGGAGCCAGG - Intronic
929564293 2:42975091-42975113 GAGTGAGCCAGTAGGGAGCCGGG + Intergenic
931234345 2:60400702-60400724 GAGGGAGTCATGAGCGAGCAGGG - Intergenic
931272813 2:60717652-60717674 TATTGAGTCAGACGTGAGCAGGG - Intergenic
931430281 2:62203567-62203589 TAGAAAGTCAGGAGGGTGCAAGG + Intronic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
931832140 2:66064000-66064022 TAGGGAGACAGGAGGGACCACGG - Intergenic
932450795 2:71809485-71809507 TAGTGAGGGAGGAGGGAACTTGG + Intergenic
933632562 2:84673972-84673994 TATAGAGTCAAGAGGGAGAAGGG + Intronic
933929843 2:87138489-87138511 TAGCTAGTCTGGAGGAAGCACGG - Intergenic
934001176 2:87714281-87714303 TAGCTAGTCTGGAGGAAGCACGG - Intergenic
934170646 2:89538488-89538510 TCTTGAGGCAGGAGGAAGCAAGG - Intergenic
934280949 2:91612808-91612830 TCTTGAGGCAGGAGGAAGCAAGG - Intergenic
934650120 2:96085836-96085858 CAGAGAGGCAGGAGGGACCAAGG + Intergenic
936363095 2:111824912-111824934 TAGCTAGTCTGGAGGAAGCACGG + Intronic
936630065 2:114192559-114192581 CAGTGAGTCATGAGATAGCAAGG - Intergenic
937854532 2:126662883-126662905 TGGAGAGCAAGGAGGGAGCAGGG - Intronic
938205870 2:129422741-129422763 AAATGAGACAGGAGCGAGCATGG - Intergenic
938643884 2:133311379-133311401 CAGTGTGCCAGGAGAGAGCATGG - Intronic
938670312 2:133580225-133580247 CAGAGAGTCAGGAGGTAGAATGG - Intergenic
938738339 2:134206840-134206862 TAGAGCCTCTGGAGGGAGCACGG + Intronic
938757870 2:134397377-134397399 TGGTGAGGCAGGAGCCAGCATGG - Intronic
938905309 2:135831083-135831105 TAGAGAGCTAGGAGAGAGCACGG - Intronic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
940688660 2:156885901-156885923 TAGAGGCTTAGGAGGGAGCATGG + Intergenic
942619447 2:177831981-177832003 TATCTAGTCAGGAAGGAGCACGG + Intronic
942883352 2:180891509-180891531 TGGAGAGTCAGAAGGGAGGAAGG - Intergenic
942902092 2:181133013-181133035 TAGGGACTCATGAGGGGGCAGGG - Intergenic
944994254 2:205276259-205276281 TAGTGAGCCAGCAGGGCGCCTGG + Intronic
947089674 2:226495891-226495913 TAGCCAGCCAGGAGGGAGGAGGG + Intergenic
947531590 2:230912062-230912084 GGGTGAGAAAGGAGGGAGCAGGG - Intronic
947952578 2:234160930-234160952 TACTGAGGCAGGAGGGAACTGGG + Intergenic
1169028759 20:2391910-2391932 CAGAGAGACAGGAGGAAGCATGG - Intronic
1170148837 20:13206562-13206584 TGGTGAGACAGGAGGGAGGAAGG + Intergenic
1171273179 20:23832341-23832363 CAGGGCGACAGGAGGGAGCAGGG - Intergenic
1172767582 20:37358957-37358979 GAGTGAGTGAAGAGTGAGCAAGG - Intronic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173628965 20:44495663-44495685 TACTGTGTAAGGAGGGGGCAGGG - Intergenic
1174063032 20:47845803-47845825 CAGTGAGTCATCAGGGTGCAGGG + Intergenic
1174065206 20:47859808-47859830 CAGTGAGGCTGGAGGCAGCAGGG - Intergenic
1174072691 20:47909871-47909893 CAGTGAGTCATCAGGGTGCAGGG - Intergenic
1174151378 20:48488799-48488821 CAGTGAGTCATCAGGGTGCAGGG + Intergenic
1174387250 20:50194460-50194482 TGGTGACAAAGGAGGGAGCAGGG - Intergenic
1174501656 20:50989370-50989392 TAGGGAGTCAGGAGGAGGCAGGG + Intergenic
1174624409 20:51902441-51902463 AAGGGAGGCAGGAGTGAGCAAGG + Intergenic
1176166514 20:63677002-63677024 GTGAGATTCAGGAGGGAGCATGG - Intronic
1178475816 21:32936078-32936100 TGGTGATCCAAGAGGGAGCAAGG + Intergenic
1179136646 21:38685432-38685454 AAGGAAGTCAGGAGTGAGCATGG - Intergenic
1179509814 21:41865079-41865101 TGGGGAGTGAGGAGTGAGCAGGG - Intronic
1179509837 21:41865168-41865190 TGGGGAGTGAGGAGTGAGCAGGG - Intronic
1180705552 22:17807852-17807874 TAGTGTGGCAGAGGGGAGCAGGG - Intronic
1181382868 22:22520856-22520878 TAGTGAAGGAGGAGGGAGGAGGG - Intergenic
1181693989 22:24583867-24583889 CAGGGAGTCAGCAGGGCGCAAGG + Intronic
1182697782 22:32208148-32208170 AACTGAGTCAGGAGGGACAATGG + Intergenic
1183232345 22:36590865-36590887 TCCTGAGGTAGGAGGGAGCATGG - Intronic
1183329633 22:37212376-37212398 GAGAGAGGCAGGAGGGAGGAAGG + Intergenic
1183445701 22:37852846-37852868 TAGTTAGTGAGGAGAGAGAAAGG + Intronic
1183685657 22:39359990-39360012 GAGGGAGACAGGAGGGACCAAGG - Intronic
1184252223 22:43267321-43267343 AAGGGAGAGAGGAGGGAGCAAGG + Intronic
1184435135 22:44468634-44468656 TAGAGCCTCTGGAGGGAGCATGG - Intergenic
1184747151 22:46462855-46462877 TGATGAGTCAGGAGGTATCAAGG + Intronic
1185290011 22:50019046-50019068 CAGGAAGTCAGAAGGGAGCACGG + Intronic
950186822 3:10950640-10950662 GGGTGAGTGAGGAGGCAGCAGGG - Intergenic
950456538 3:13096026-13096048 TACTGAGGCAGGAGGAACCAAGG - Intergenic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
952675886 3:36029758-36029780 TAGCTAGTCAGGAATGAGCAAGG - Intergenic
954132448 3:48567523-48567545 CAGGGAGTCAGGATGGGGCAGGG - Intronic
954746224 3:52789057-52789079 GAAGGAGACAGGAGGGAGCAGGG - Intronic
955941377 3:64149742-64149764 AAGTGAGTCAGGGAGGAGAAAGG - Intronic
956178326 3:66495283-66495305 TCTTGAGACAGGAGGGAGGACGG - Intronic
956949926 3:74270631-74270653 TAGTGAATTAGGAATGAGCAGGG + Intronic
957211664 3:77266845-77266867 GAGAGAGTAAAGAGGGAGCAAGG - Intronic
959526004 3:107378051-107378073 TAGAGATTCTGGAGGGAGAAAGG + Exonic
959864588 3:111251950-111251972 TTGTGATTCAAGAGGGAGTAAGG - Intronic
961517727 3:127448688-127448710 CAGAGAGTAAGGAGGGAGCGTGG - Intergenic
961779563 3:129313758-129313780 CAGTGAGGCAGGAAGCAGCAGGG + Intergenic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
964917024 3:161851595-161851617 GAGTGAGTGAGGAAGGAGAATGG + Intergenic
966537489 3:181050928-181050950 TTGTGTGAGAGGAGGGAGCAGGG + Intergenic
966805815 3:183806686-183806708 TAGTAATTCACGAGGGAGAAAGG - Intronic
967088030 3:186111290-186111312 TAGTGGCTCAGGTGGGGGCAGGG + Intronic
967332134 3:188301088-188301110 TAGAGAGGCAGGAGGGTGGATGG - Intronic
967974787 3:195027655-195027677 TAGTGAGACAGGCATGAGCAGGG + Intergenic
968745423 4:2357398-2357420 TCCTGAACCAGGAGGGAGCATGG + Intronic
968798879 4:2728997-2729019 TAGCTAGTCAGGTGTGAGCAGGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968956473 4:3722247-3722269 TAGAGAGTCAGGTGGGGGCTGGG + Intergenic
969066039 4:4482043-4482065 TAGTGCTTCAGGAGGGGACAAGG - Intronic
969109050 4:4829910-4829932 AAGAGAGTCAGCAGGGAGGATGG + Intergenic
969256002 4:6002314-6002336 TAGAGCCTCAGGAGGAAGCATGG + Intergenic
969369307 4:6721058-6721080 TAGAGCGTAAGGATGGAGCAGGG - Intergenic
971872076 4:32254339-32254361 AAGTGAGTCTGCTGGGAGCAGGG - Intergenic
971882384 4:32394116-32394138 TAGTGATTCAAGAGAAAGCAAGG + Intergenic
973176009 4:47205756-47205778 TACTGAGTCAGGAAAGAGTAAGG + Intronic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
975058727 4:69970192-69970214 TACTGAGCCAGGAGGAAGCCAGG + Intergenic
976519178 4:86006626-86006648 TAGTGAATCATGAGGGGGTAGGG - Intergenic
980400885 4:132284514-132284536 TAGTGAGAGAGGAGGAAGGAAGG + Intergenic
981140032 4:141257408-141257430 TAGTGAGTAAGGAAGGGGCTAGG - Intergenic
982589007 4:157280585-157280607 TAGTGAGTCAGCTGGGAGCTGGG + Intronic
983204922 4:164902126-164902148 CTGGGAGCCAGGAGGGAGCAAGG - Intergenic
983638002 4:169917623-169917645 GGATGAGTCAGGACGGAGCAGGG + Intergenic
983639365 4:169930331-169930353 TAGATAGACAGGAGGGAGCCAGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
985793526 5:1945663-1945685 CAGTGACTCAGGTGGGTGCAAGG + Intergenic
986072023 5:4294968-4294990 TAATGAGTCAGAAGGGATTATGG - Intergenic
986370664 5:7077323-7077345 GAGTGAGCCTGGAGGGAGCCTGG - Intergenic
986382876 5:7204424-7204446 TAGTGAGTAAGGAGGGACTGTGG + Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986739397 5:10692872-10692894 TGGTGAGCCAGGCTGGAGCAGGG - Intronic
986923418 5:12716896-12716918 TACCGACTCAGAAGGGAGCAGGG - Intergenic
987572024 5:19676387-19676409 TAGTTAGACAGGCAGGAGCAGGG + Intronic
987946371 5:24614398-24614420 CATTGGATCAGGAGGGAGCATGG - Intronic
988816516 5:34839686-34839708 TAGTGATTCTGGAGGGTGAAAGG + Intronic
988897791 5:35696919-35696941 TAGTGAGGCAGGAAGGTGCCTGG + Intronic
990074479 5:51826419-51826441 TAGTGAATCAGGATAGGGCATGG - Intergenic
992759959 5:79942851-79942873 TAGAGGTTCTGGAGGGAGCATGG - Intergenic
993325359 5:86527915-86527937 TAATTAGTCAGGAGGGAGGTTGG - Intergenic
995463256 5:112424495-112424517 AAGTGAGTCAGGAGGCAGAATGG - Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
997379640 5:133426425-133426447 TAGGGAGTGCGGAGGGGGCAGGG - Intronic
997983918 5:138488727-138488749 TGGTGAGTCAGGAGACAGCAGGG + Intergenic
998414795 5:141938384-141938406 CAGTGACTCATGAGTGAGCAGGG - Intronic
999914042 5:156238057-156238079 TAGTTACTCAGGAGGGAGGTGGG - Intronic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001296032 5:170499676-170499698 TAGGGAGGAAGGAGGCAGCAGGG + Intronic
1001367507 5:171158697-171158719 AAGTGGGCCAAGAGGGAGCAAGG - Intronic
1002028486 5:176411762-176411784 AAGTGAGTCAGGAATGGGCAGGG - Intronic
1002076966 5:176714081-176714103 TAGTGAGACAGAAGGGAGAAAGG + Intergenic
1002307858 5:178294284-178294306 TAGTGATTTGGGAGGGAGCTCGG - Intronic
1002307888 5:178294403-178294425 TAGTGATTTGGGAGGGAGCTCGG - Intronic
1002342711 5:178527338-178527360 TAGAAAGTCAGGAGGCTGCAGGG - Intronic
1003088015 6:3076982-3077004 CATTGAGTGAGTAGGGAGCAGGG + Exonic
1003954576 6:11149858-11149880 TAGTGAGCCACGAGGCACCAGGG + Intergenic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1004882431 6:20022271-20022293 GAATGTGCCAGGAGGGAGCAAGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1006611847 6:35298725-35298747 TAGTTAGTGGGGAGGAAGCAAGG + Intronic
1007744622 6:44035857-44035879 TTGTGAGCAAGGAGGGTGCACGG + Intergenic
1008366058 6:50681932-50681954 TAGTGGTTCAGGAGAGAGTAAGG - Intergenic
1008456932 6:51721928-51721950 TAATGAGGCAGCAGGAAGCAGGG - Intronic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1009042730 6:58199474-58199496 TTGAGAGTCAGGAGGGAGAGAGG + Intergenic
1009575222 6:65447773-65447795 TAATGAATCATGAGGGAGCTAGG + Intronic
1010378449 6:75201939-75201961 GAGGGAGGCAGGATGGAGCAAGG + Intronic
1011649541 6:89493230-89493252 TAGAAACTCTGGAGGGAGCAGGG - Intronic
1012250102 6:96970390-96970412 TCCTGTGGCAGGAGGGAGCATGG - Intronic
1013346573 6:109266098-109266120 TAGTGTGACAGGATAGAGCAGGG - Intergenic
1013380630 6:109566705-109566727 TGGAGACTCAGAAGGGAGCAGGG + Intronic
1013385713 6:109628311-109628333 TTGTGAGTAGGGTGGGAGCAAGG - Intronic
1017277055 6:152581748-152581770 CAGTGAGTCTGGAGCGAGCCAGG - Intronic
1018218933 6:161559578-161559600 TAGGGAGCCAGGAAGGAGGATGG - Intronic
1018664854 6:166126171-166126193 TAGCTAGTCAGGCAGGAGCAGGG - Intergenic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018728688 6:166632802-166632824 TAGTGAGGGAGGAGAAAGCAGGG + Intronic
1019838271 7:3412932-3412954 TAGGGAATCAGCAAGGAGCAAGG + Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1020109091 7:5438099-5438121 TAGTGTGGCAGGAGTCAGCATGG - Intronic
1020264646 7:6552239-6552261 TAGGGAGTGAGGAGGGCCCATGG - Intergenic
1020397149 7:7729219-7729241 CAGAGAGCCAGGATGGAGCATGG + Intronic
1020890711 7:13874558-13874580 TACTGCTTCAGGAGGGAGCTCGG + Intergenic
1020966943 7:14882595-14882617 TAGAGACTCAGAAGGGAGAAGGG - Intronic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021226173 7:18029013-18029035 TAGTGAGGAAGGAGGCAGAAAGG + Intergenic
1021253230 7:18357753-18357775 CCCTGAGTCAGGAAGGAGCATGG + Intronic
1021834106 7:24650344-24650366 TATTGAGACAGGAGAGAACATGG + Intronic
1022167650 7:27785800-27785822 GAGTGATCCAGGAGAGAGCAAGG + Intronic
1022245118 7:28551686-28551708 TGGTGAGTCGGGAGGGGACAAGG + Intronic
1022591213 7:31665070-31665092 TAGTGAGAGAGGAAGGAGGAAGG - Intergenic
1022952873 7:35355377-35355399 TTGGGAGTCAGTAGGGAGCTGGG - Intergenic
1026550800 7:71366799-71366821 TAGGGAGTCAGGTGTGAGGAAGG - Intronic
1026847687 7:73706921-73706943 AAATGGGTCAGGTGGGAGCAGGG - Intronic
1027264382 7:76486012-76486034 TTGTAAGTCAGGAGGGAACCAGG + Intronic
1027315752 7:76984126-76984148 TTGTAAGTCAGGAGGGAACCAGG + Intergenic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1027942642 7:84704546-84704568 TAATGCCTCTGGAGGGAGCATGG - Intergenic
1028149846 7:87358971-87358993 TAGCAAGTCGGGAGGGAGCCAGG - Intronic
1029698076 7:102227688-102227710 TGCTGAGTCAGGAGGTGGCAGGG + Intronic
1030419263 7:109287179-109287201 TAGAGCCTCTGGAGGGAGCATGG - Intergenic
1030897852 7:115084090-115084112 TAGTGAGGAGGGAGGGAGCCAGG + Intergenic
1031294559 7:119984798-119984820 TAGTGAGTGAGGAGTGAGTGAGG - Intergenic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033492806 7:141860841-141860863 TAATCAGTCAGGAGGCAGCCTGG + Intergenic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036798682 8:11773700-11773722 TGATGAGGCAGGAGGGAGCTTGG + Intronic
1037755759 8:21709215-21709237 TGGTGGGTCAGGAGAGAGCTGGG - Intronic
1037877366 8:22554611-22554633 GAGTGAGTCAGTAGGGAGGAGGG + Intronic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038216664 8:25567859-25567881 TCTTGGGTCAGGAGGCAGCAGGG - Intergenic
1038584661 8:28778048-28778070 CAGGGGGTCAGGAGGGAGCCAGG + Intronic
1039923373 8:41908332-41908354 TAGAGAGCCAGGAGGTGGCAGGG - Intergenic
1040950376 8:52933306-52933328 TAGTAATGCAGGAAGGAGCAGGG + Intergenic
1041018825 8:53617691-53617713 TGGTGAGTAAGAAGGGAGCTCGG + Intergenic
1044721234 8:95150138-95150160 TAGGGAAACAGGAGGCAGCAAGG - Intronic
1044817795 8:96130868-96130890 TGGAGAGTCTGGATGGAGCAAGG - Intergenic
1044982152 8:97727569-97727591 TGGTGATTCAGGGAGGAGCAGGG + Exonic
1046683711 8:117200900-117200922 TAGCAAGTCAGCAGGAAGCAAGG + Intergenic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1048601875 8:135927073-135927095 TAGTGAATTAGGAGGTAGCATGG + Intergenic
1049428593 8:142549006-142549028 TGGTCAGTCAGGATGGAGAAGGG - Intergenic
1049935512 9:497980-498002 AAGCAAGTCAGGAGGGAGCAAGG - Intronic
1050588673 9:7140261-7140283 TAGTCAGTCAGGTATGAGCAGGG - Intergenic
1053567617 9:39269686-39269708 TATTGAGTCAGTAGGGAGCACGG + Intronic
1053833628 9:42110633-42110655 TATTGAGTCAGCAGGGAGCACGG + Intronic
1054129526 9:61349313-61349335 TATTGAGTCAGTAGGGAGCACGG - Intergenic
1056287696 9:85107977-85107999 TGGTGACACAGGAGGGAGGATGG + Intergenic
1056795388 9:89655444-89655466 TTGTGAGGCAGCAGGGAGGAAGG - Intergenic
1057066393 9:92056133-92056155 TGGGGAGTGAGGAGGGAACAGGG - Intronic
1057399371 9:94709527-94709549 TAGGGGATCAGGAGGGAGCGTGG - Intergenic
1057742077 9:97720659-97720681 TAGAGCCTCAGGAGGGAGTAGGG + Intergenic
1058632497 9:107003476-107003498 TAGTGAGACAGAAGGGAGGCAGG + Intronic
1058945494 9:109851735-109851757 AAGTGAGTCAGAAGACAGCAGGG - Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060106985 9:120878677-120878699 CAGTGAGGCAGGTGAGAGCAGGG - Intronic
1061931230 9:133834184-133834206 CAGGGAGTCAGGAGGAAACATGG - Intronic
1062151273 9:135020411-135020433 TAGAGCTTCTGGAGGGAGCACGG + Intergenic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1185511240 X:666556-666578 TAGAGCCTCTGGAGGGAGCATGG + Intergenic
1185511261 X:666645-666667 TAGAGCCTCTGGAGGGAGCATGG + Intergenic
1185523866 X:761885-761907 TAGAGACTGTGGAGGGAGCACGG - Intergenic
1186534247 X:10330322-10330344 AAGTGAGTCAGGGCCGAGCAGGG - Intergenic
1186697469 X:12052405-12052427 GAGAGAGTCAGAAGGGAGTAGGG + Intergenic
1186966615 X:14793831-14793853 CAGTGAGTCAGGAGTCAGAAGGG + Intergenic
1187513839 X:19947416-19947438 TAGTGTGTCAGGAGAAAACATGG + Intronic
1188616355 X:32163471-32163493 TAGTGATTCAGGAAGTAGAATGG + Intronic
1188913971 X:35887511-35887533 TTGTCAGTGAGGAGGGGGCACGG + Intergenic
1188981702 X:36732767-36732789 TAGAGATTTTGGAGGGAGCATGG + Intergenic
1189457661 X:41207897-41207919 TAGTCAGAGAGGAGGGAGAATGG - Intronic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1191754495 X:64579822-64579844 TAGTGAGTCAGGAAAGAGAAGGG + Intergenic
1191937352 X:66439826-66439848 TGGGGAGATAGGAGGGAGCATGG + Intergenic
1192181909 X:68921486-68921508 TATTGTGTCTGGAAGGAGCAAGG - Intergenic
1192498431 X:71632334-71632356 TAGAGCTTCTGGAGGGAGCATGG - Intergenic
1194743289 X:97601842-97601864 TAGAGCCTCTGGAGGGAGCATGG - Exonic
1194746240 X:97631375-97631397 TAGAGGGTCAGGAAGGAGTAGGG + Intergenic
1195388108 X:104332772-104332794 TAAGGAATCAGGAGGAAGCAGGG + Intergenic
1195446863 X:104962141-104962163 TAGTGAATTAGGAGAAAGCAAGG - Intronic
1195676852 X:107513165-107513187 TAGCAGGTCAGGAGGGAGCAGGG - Intergenic
1195990297 X:110675757-110675779 GAGGGAGTGAGGAGGGAGGATGG + Exonic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1196746420 X:119074390-119074412 TAGGGGTTCAGGAGGGAGCTCGG + Intergenic
1197402262 X:126006394-126006416 TGGAGCGTCTGGAGGGAGCAGGG + Intergenic
1198068263 X:133121603-133121625 GAGTCAGTCTGGAGGGACCAGGG + Intergenic
1198227296 X:134657113-134657135 CAGTGAGACAGGAAGGACCAAGG + Intronic
1199264748 X:145817717-145817739 GAGGGAGTGAGGAGGGAGGAGGG - Intergenic
1200270311 X:154676484-154676506 TAGTGAGCCTGGACAGAGCAAGG - Intronic
1200280905 X:154776105-154776127 CAGTGAGTCAAAAGGTAGCAAGG - Intronic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201688944 Y:16741055-16741077 TAGAGAGTCAGAAGGGATCGGGG - Intergenic
1202099176 Y:21287971-21287993 TAGGGAGGCAGCAGGGGGCAGGG - Intergenic