ID: 1008928519

View in Genome Browser
Species Human (GRCh38)
Location 6:56912593-56912615
Sequence GTGTTAAGCTCCTGAGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 15, 3: 97, 4: 564}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008928519_1008928523 25 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928523 6:56912641-56912663 TCACGCATAGATCAGCAAGTGGG No data
1008928519_1008928522 24 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928522 6:56912640-56912662 GTCACGCATAGATCAGCAAGTGG No data
1008928519_1008928526 30 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928526 6:56912646-56912668 CATAGATCAGCAAGTGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1008928519_1008928524 26 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928524 6:56912642-56912664 CACGCATAGATCAGCAAGTGGGG No data
1008928519_1008928525 27 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008928519 Original CRISPR GTGTTAAGCTCCTGAGGTTT TGG (reversed) Intronic
901780624 1:11592125-11592147 GTTTTAAGCCACTGAGATTTGGG + Intergenic
901824383 1:11851180-11851202 GTGTGAAGTTGCTAAGGTTTGGG - Intergenic
902152599 1:14456177-14456199 GTTTTAAGCTGCTAGGGTTTGGG - Intergenic
903429118 1:23278421-23278443 GTTTTAAGCTGCTAAGTTTTAGG + Intergenic
904107103 1:28094505-28094527 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
904879068 1:33680822-33680844 GTGTTAAACCACTGAGATTTGGG + Intronic
904956417 1:34287747-34287769 GTTTTAAGCCACTAAGGTTTGGG + Intergenic
904975632 1:34454100-34454122 GTGTTAAGCCACTGAGTTTTAGG - Intergenic
905006068 1:34711417-34711439 TTGTTAAGCCACTAAGGTTTTGG - Intergenic
905235043 1:36540414-36540436 GTGTTATGCCACTGAGATTTTGG + Intergenic
905475926 1:38228031-38228053 CTGTTAAGCCGCTGAGATTTTGG + Intergenic
906131572 1:43461895-43461917 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
906292562 1:44628945-44628967 GTGTTAAGCCACTAAGTTTTGGG - Intronic
906798098 1:48713393-48713415 GTGTAAAGCAGCTGAGGTTGCGG + Intronic
906809382 1:48810702-48810724 GTGATGAGCTACTGAGATTTGGG + Intronic
906813519 1:48853398-48853420 GTTTGAAACTGCTGAGGTTTAGG + Intronic
906866189 1:49423162-49423184 ATGTTAAGCCACAGAGGTTTGGG + Intronic
907122235 1:52017855-52017877 GTGTCAAACTCCTGACCTTTAGG - Intergenic
907615069 1:55915593-55915615 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
907825427 1:58012280-58012302 ATGTTAAGCTGTTGAGATTTAGG - Intronic
908331795 1:63078148-63078170 GTTTTAAGCTACTGAGATTTGGG + Intergenic
908376508 1:63547592-63547614 GTTTTAAGCCACTGAGTTTTGGG - Intronic
908915858 1:69125754-69125776 GTGTTAAGCTACTAAAATTTGGG - Intergenic
909041111 1:70653578-70653600 GTGTTAAGTCACTGAGGTTTTGG - Intergenic
909801741 1:79818678-79818700 GAGTTAAGCCACTAAGGTTTTGG - Intergenic
910020730 1:82586457-82586479 GTTTTAAGCCCCTGAGTTTTGGG - Intergenic
911107691 1:94149398-94149420 TAGTTAATCTCCTTAGGTTTGGG + Intronic
911590872 1:99746145-99746167 GTGTTGAGCTCATGGGGTTCTGG - Intronic
911748181 1:101464325-101464347 ATTTTATGATCCTGAGGTTTGGG - Intergenic
911846794 1:102763115-102763137 GTTTTAAGCTACTAAGTTTTTGG + Intergenic
912654016 1:111469494-111469516 GTATTGAGCTACTGAGATTTTGG - Intergenic
912841137 1:113040512-113040534 GTGTTGAACTCATGAGGTTCTGG - Intergenic
913096615 1:115523460-115523482 GTTTTAAGCCACTGAGTTTTAGG - Intergenic
915382714 1:155457146-155457168 GTTTTAAGCCTCTGAGATTTGGG + Intronic
916275022 1:162984598-162984620 GTGTTAAGCCACTAAGTTTTGGG + Intergenic
916315617 1:163444875-163444897 ATGTTGGGCTCCTGTGGTTTTGG + Intergenic
916471492 1:165127581-165127603 CTGTTAAGCCACTGAGTTTTGGG + Intergenic
916651259 1:166836653-166836675 GTTTTAAGCTACTGAGTTCTGGG - Intergenic
916995556 1:170294788-170294810 GTTTTAAGCTGCTGAAATTTTGG - Intergenic
917116601 1:171609621-171609643 GTCTTAAGCTACTAAGTTTTGGG - Intergenic
917595651 1:176526601-176526623 GAGTTAAGACACTGAGGTTTCGG + Intronic
917928561 1:179808314-179808336 GTTTTAAGCTGCTGAGTTTGTGG - Intronic
918033716 1:180844586-180844608 TTTTTAAGCTACTGAGTTTTGGG - Intronic
918092286 1:181308004-181308026 GTTTTAAGCCTCTGAGTTTTGGG - Intergenic
918865783 1:189897603-189897625 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
919019020 1:192079674-192079696 GTGCTAAGCTACTGAGGTTGTGG - Intergenic
919275462 1:195409399-195409421 ATTTTATGCTGCTGAGGTTTGGG - Intergenic
919383791 1:196893812-196893834 TTATTAAGCTACTGAGATTTGGG - Intronic
920864584 1:209741260-209741282 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
921279435 1:213551055-213551077 GAGTTCAGCCCCTGAGGTTTAGG - Intergenic
922005674 1:221528311-221528333 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
922580416 1:226693223-226693245 GTGTTCTGCTTCTGAGTTTTTGG - Intronic
922596445 1:226817213-226817235 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
922876713 1:228945464-228945486 GTGTTAAGCCACTGAGATTTTGG + Intergenic
923112491 1:230903355-230903377 GTGTGAAGCACGTGAGGTTTAGG + Intergenic
924315538 1:242791646-242791668 GCTTTAAGCCACTGAGGTTTGGG - Intergenic
1063482564 10:6388773-6388795 GTTTTAAGCTGCTAAGTTTTTGG - Intergenic
1063652405 10:7951246-7951268 GTTTTAAGCTGCTAAAGTTTGGG - Intronic
1063873338 10:10444280-10444302 GTGTTAAGCCACTGAGATTTTGG - Intergenic
1063995703 10:11616642-11616664 GTGTTAAGCTTTTGAGCTTAGGG + Intergenic
1064822712 10:19356504-19356526 GTGTTAAGCTGCTAAAATTTGGG - Intronic
1065186978 10:23178024-23178046 GTGTGAAGCTGCTGAGATTTGGG - Intergenic
1065348911 10:24777819-24777841 GTCTTAAGCACCTGAGATTTGGG - Intergenic
1066358239 10:34705751-34705773 GTGTTGTGGTGCTGAGGTTTTGG - Intronic
1066438285 10:35414109-35414131 GTCTTAAGCTGCTGAGTTTCTGG - Intronic
1067361823 10:45589137-45589159 GTTTTAAACTACTGAGTTTTGGG - Intronic
1067698231 10:48550710-48550732 GTGTCAAGATCCTGAGATTTGGG + Intronic
1067894127 10:50161354-50161376 GTGTTAAGCTATTAAGGTTGTGG - Intergenic
1068124683 10:52824747-52824769 GTTTTTATCTCCTGAGATTTTGG - Intergenic
1069591050 10:69642076-69642098 GTTTTAAGCTGCTAAGTTTTTGG - Intergenic
1070102242 10:73399281-73399303 GTGTTAAGTCACTGAGATTTGGG + Intronic
1071152661 10:82652877-82652899 GTTTTAAGCTGCTGAGTTTTGGG + Intronic
1071731114 10:88249433-88249455 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1071882523 10:89914942-89914964 GTTTTAAGCTGCTAAGTTTTAGG + Intergenic
1072121511 10:92409187-92409209 GTGGTAAGGACTTGAGGTTTGGG - Intergenic
1074665506 10:115718162-115718184 GTGTTCAACTACTGAGCTTTTGG + Intronic
1074816481 10:117145282-117145304 GTTTTAAGCTACTAAGCTTTGGG + Intergenic
1076032349 10:127170271-127170293 GTGATAAGACCCTGAGGCTTCGG - Intronic
1077387904 11:2281570-2281592 GTTTTAAGCTACTAAGTTTTGGG + Intergenic
1078148017 11:8735454-8735476 GTGTTAAGCCACTAAGTTTTGGG + Intronic
1078495878 11:11816440-11816462 GTTTTAAGCCACTGAGATTTGGG - Intergenic
1078807697 11:14722811-14722833 GTTTTAAGCTGCTTAGTTTTGGG + Intronic
1079274336 11:19020069-19020091 GTGTTAAGTCACTGAGATTTTGG + Intergenic
1079574448 11:21986054-21986076 GTGTTAAGCTACAGAGATTTGGG - Intergenic
1080115208 11:28614554-28614576 ATGTTCATCTCCTGAGGGTTGGG - Intergenic
1080538693 11:33245991-33246013 GTTTTAAGCTACTCAGTTTTGGG - Intergenic
1080604163 11:33850693-33850715 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1080615237 11:33939910-33939932 GTCTTAAGCTCCTAAGGTTGTGG + Intergenic
1080933995 11:36842523-36842545 CTGTTAAGCTACTAAGGTTGTGG - Intergenic
1081305528 11:41507683-41507705 GTTTTATGCTCCTGAAATTTGGG - Intergenic
1081499294 11:43650098-43650120 GTTTTAAGCTTCTAAGGTTGTGG + Intronic
1081516256 11:43833295-43833317 GTGTTAAGCCACTGAGATTTGGG - Intronic
1081633308 11:44703729-44703751 GTCTTAAGCTACTAAGCTTTGGG - Intergenic
1081706670 11:45186145-45186167 GTTTTAAGCCACTGTGGTTTTGG + Intronic
1081746621 11:45477657-45477679 GTATTCAGTGCCTGAGGTTTGGG - Intergenic
1081885067 11:46488236-46488258 GTCTTAAGCTCCTGATGTCAAGG - Intronic
1083097132 11:60262748-60262770 GTTTTAAGTTAGTGAGGTTTTGG - Intergenic
1083392222 11:62361401-62361423 GTCTTAAGCTCCTGAGCTCAAGG + Intronic
1084394669 11:68901341-68901363 GTTTTAAGCTGCTAAGTTTTGGG + Intronic
1085205310 11:74728221-74728243 GTATCAGGCTCCTGAGGTGTCGG - Intronic
1087728836 11:101755698-101755720 GTTTTAAGCTGCTGAAATTTTGG - Intronic
1087934901 11:104021724-104021746 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1087986817 11:104692468-104692490 GTTGTATGCTACTGAGGTTTGGG + Intergenic
1088010289 11:104992572-104992594 GTGTTAAACTACTGAGGTTTTGG + Intergenic
1088239316 11:107757745-107757767 GTTTTAAGCTACTAAGCTTTGGG - Intergenic
1088499124 11:110464993-110465015 GTTTTAAGCTACTAAGTTTTGGG - Intergenic
1088715005 11:112541459-112541481 GTGTTAAGCCACCGAGATTTTGG + Intergenic
1088770615 11:113032328-113032350 GTGGTAAGCCCCTGAGATCTGGG - Intronic
1088845545 11:113663170-113663192 GTGTGGTCCTCCTGAGGTTTGGG - Intergenic
1089189894 11:116646141-116646163 GTGTTAAACTGCTGAGTTCTGGG + Intergenic
1089338401 11:117741487-117741509 GTGTTAAGCCATTGAGATTTAGG + Intronic
1091152970 11:133346115-133346137 GTGTTAAGATCCTGATAATTTGG + Intronic
1092935966 12:13364938-13364960 GTTTTATGCACCTGAGTTTTAGG - Intergenic
1093102116 12:15039759-15039781 GTGTTAAGGTGCTGGGGTTATGG + Intergenic
1094296387 12:28911554-28911576 GTTTTAAGGTCCTAAGTTTTTGG - Intergenic
1094746724 12:33353321-33353343 GTCTTTAGCTCCTGAAATTTTGG - Intergenic
1095909519 12:47411784-47411806 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1096252732 12:50043634-50043656 GTTTTGAGCTCCTAAGTTTTGGG - Intergenic
1096291438 12:50347091-50347113 GTTTTAAGCCACTGAGGCTTGGG - Intronic
1096430899 12:51541963-51541985 GTTTTAAGCTACTGAATTTTGGG + Intergenic
1097359505 12:58642956-58642978 TTTTTAAGCTTCTGAGATTTAGG + Intronic
1098221064 12:68270386-68270408 GTTTTAATCTGCTGAGTTTTGGG - Intergenic
1098237883 12:68435392-68435414 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1098512932 12:71340374-71340396 GTGTTAAGCCACTGAAATTTTGG - Intronic
1098640634 12:72834940-72834962 GTGTTAGGCTACTGAGATTTGGG - Intergenic
1098847369 12:75554338-75554360 GTTTTAAGCTACTGAGTTTTGGG - Intergenic
1098976302 12:76905565-76905587 GTTGTAAGCCCCTAAGGTTTAGG + Intergenic
1098999068 12:77155644-77155666 ATTTTAAGCTCCTGAATTTTGGG + Intergenic
1099529646 12:83762427-83762449 GTCTTAAGCTACTAAGCTTTGGG - Intergenic
1099742516 12:86659047-86659069 GTCTTAAACTTCTGAGATTTGGG + Intronic
1100222347 12:92518849-92518871 GTGTTAAGACACGGAGGTTTGGG + Intergenic
1100236012 12:92661761-92661783 GTGTTAAGATGCTGAGATCTGGG - Intergenic
1100337235 12:93642660-93642682 GTCTTAAGCTACTGAGATTTGGG + Intergenic
1100371043 12:93968973-93968995 GTTTTAAGCCCCTGAGTTTGGGG - Intergenic
1100947675 12:99805104-99805126 GTGTTAAGCTATTAAGTTTTGGG + Intronic
1101345788 12:103885084-103885106 TTTTTAAGCTACTGAGATTTGGG - Intergenic
1101448325 12:104754301-104754323 GTGTTAAGCCACTAAGTTTTGGG - Intronic
1101511591 12:105398008-105398030 GTTTTAAGCTGCTGAACTTTGGG + Intergenic
1101845573 12:108360595-108360617 GTGGGAAGCCCCTGAGGTTTTGG + Intergenic
1102194698 12:111016729-111016751 GTCTTAAGCCTCTGTGGTTTGGG + Intergenic
1102396866 12:112593413-112593435 GTGTTAAGCTGGTGGGATTTTGG + Intronic
1102636323 12:114327418-114327440 GTGTCAAGCCACTGAGTTTTAGG + Intergenic
1102927954 12:116841097-116841119 GCTTTAAGCTGCTGAGTTTTGGG - Intronic
1102955580 12:117056541-117056563 GTGTTAAACTACTAAGTTTTGGG + Intronic
1103243575 12:119435749-119435771 GTTTTAAGTTACTGAGTTTTGGG - Intronic
1103469060 12:121165494-121165516 GTTTCAGGCTTCTGAGGTTTGGG - Intronic
1104129673 12:125881252-125881274 GTATTAAGCTTCTGAGATTTGGG + Intergenic
1104939090 12:132386516-132386538 GGGAAAAGCTGCTGAGGTTTTGG - Intergenic
1105037122 12:132933649-132933671 GTTTTCAGCCCTTGAGGTTTGGG + Intronic
1105610031 13:21960554-21960576 GTGTGAAGTCCCTGAGGATTGGG - Intergenic
1106129140 13:26925187-26925209 GTGCAAAGGTCCTGAGGTCTGGG + Intergenic
1106644049 13:31614030-31614052 TTGTTAAGCCACTGAGTTTTGGG + Intergenic
1106701332 13:32232460-32232482 GTGTTAAGCCTCTGAGCTCTGGG - Intronic
1106925006 13:34604870-34604892 GTTTTAAGCTTCTAAGTTTTGGG - Intergenic
1106982581 13:35305731-35305753 GTTTTAAGCCCCTGAGATTCGGG + Intronic
1107109691 13:36683508-36683530 GTTTTAAGCCACTGAGATTTGGG - Intronic
1107321318 13:39191720-39191742 TTGTTAAGCTACTGAAGTCTTGG + Intergenic
1107606125 13:42058949-42058971 GTGTTAAGTCCCTGAGATTTGGG + Intronic
1108288896 13:48937807-48937829 GTTTTAAGCTCTCAAGGTTTTGG - Intergenic
1109038450 13:57297798-57297820 GTGTTCAGCTCCAGAGGATCAGG + Intergenic
1109371656 13:61428591-61428613 GTGTTAAGCTGCTGAGAGTTTGG - Intergenic
1109988894 13:70027757-70027779 GTTTTAAGCCTCTGAGATTTGGG + Intronic
1111135981 13:84044048-84044070 GTTTTGAGCTCCTAAGTTTTGGG + Intergenic
1112387915 13:98957277-98957299 GTGTTCAGCTGCTGAGATTCTGG + Intronic
1112574957 13:100627351-100627373 GTGTTAAGCCCCTCAGTTTGTGG - Intronic
1112596505 13:100812813-100812835 GTGTTAAGCCACTGAAATTTGGG - Intergenic
1113001333 13:105641384-105641406 GTGTTAAGCTACTAAGTTTGTGG + Intergenic
1114707723 14:24744320-24744342 GTGTTAAGCCCCTGAGATTTAGG + Intergenic
1114996341 14:28357024-28357046 GTGCAATGCTGCTGAGGTTTAGG - Intergenic
1115088499 14:29546180-29546202 GTGTTAAGCCACTGAGACTTTGG + Intergenic
1115647121 14:35376530-35376552 GTTTTAAGCCACTGAGTTTTTGG - Intergenic
1115846296 14:37539276-37539298 GTTTTAAGCTACTGACTTTTGGG + Intronic
1116867464 14:50042478-50042500 GTGTTAAGCCACTGAGATGTTGG + Intergenic
1117141972 14:52798266-52798288 GTGTTAAGCCACAGAGATTTGGG - Intergenic
1117383074 14:55184923-55184945 GTTTTAAGCTGCTAAGTTTTGGG + Intronic
1118535077 14:66753447-66753469 GTTTTAAGCCCCTGAGTTTTAGG + Intronic
1118740347 14:68735064-68735086 GTCTCAGGCTCCTGAGGTGTTGG - Intergenic
1118812766 14:69287416-69287438 GTGTTTATCTCCTGACGTTTGGG + Intronic
1118886528 14:69871384-69871406 GTTTTAAGCTGCTAAGTTTTGGG + Intronic
1119019240 14:71092971-71092993 GTGTTGAACTCATGAGGTTCTGG - Intronic
1119161194 14:72453704-72453726 GTGTTAAGCCCCTGAAATTTGGG - Intronic
1119286996 14:73463342-73463364 CTTTTAAGCTACTGAGTTTTGGG - Intronic
1119506714 14:75179357-75179379 CTTTTAAGCTTATGAGGTTTGGG - Intergenic
1119945339 14:78687562-78687584 GTGTTAAGCCTCTGAGATTTTGG - Intronic
1120230663 14:81837245-81837267 GTGAGAAGCACATGAGGTTTGGG + Intergenic
1120396483 14:83973170-83973192 GTGTTAAGCTACCGAAATTTTGG + Intergenic
1120492430 14:85194154-85194176 GTTTTAAGCCACTGAGATTTGGG + Intergenic
1121225024 14:92315395-92315417 GTGCTAAGCTCATGAGATTTGGG + Intergenic
1121515406 14:94546433-94546455 GTTTTCAGCCGCTGAGGTTTGGG - Intergenic
1121579325 14:95015109-95015131 GTGCTAAGCTACTGAGATTTTGG - Intergenic
1121744561 14:96278153-96278175 TTGTTAAGCTGCCGAGGTTTGGG + Intergenic
1122309808 14:100787402-100787424 CTGTAAAGTGCCTGAGGTTTTGG + Intergenic
1123909969 15:24956412-24956434 GTGTTCAGCTTCTGCTGTTTCGG + Intronic
1124092565 15:26620100-26620122 TTGTAAAGCTCCGGAGGTTCAGG - Intronic
1124409757 15:29427403-29427425 GTTTTAAGCCACTGAGTTTTTGG - Intronic
1124700618 15:31909045-31909067 GTTTTAAGCTGCTGAATTTTGGG - Intergenic
1124994733 15:34712258-34712280 GTGATGAGCTGTTGAGGTTTTGG - Intergenic
1125343614 15:38697679-38697701 GTTTTAAGCTGCTAAAGTTTTGG + Intronic
1125542258 15:40476371-40476393 GTGTGATGCTCCTGGGGTGTGGG - Intergenic
1125648147 15:41290791-41290813 GTTTTAATCTACTGAGTTTTGGG - Intergenic
1126659166 15:51014746-51014768 GTGTTAAGCCACTGAGATTTGGG + Intergenic
1128319510 15:66683232-66683254 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1128537946 15:68504686-68504708 GTTTTAGGCTGCTGAGTTTTGGG - Intergenic
1128621094 15:69150607-69150629 GTGTTAAGCTACTGAGACGTGGG - Intergenic
1128749126 15:70136062-70136084 ATGTTAAGATACTGAGGGTTAGG - Intergenic
1129147318 15:73660347-73660369 GTGTTAAGCTTATCAGGCTTTGG + Intergenic
1129352047 15:74961384-74961406 GTTTTAAGCTGCTGAGCTGTGGG - Intronic
1129944703 15:79528618-79528640 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
1130296927 15:82653837-82653859 GTTTTAAGCTGCTTAGCTTTAGG - Intergenic
1130396287 15:83504819-83504841 GTTTTAAGCTGCTGAGTTTGGGG + Intronic
1130429679 15:83834053-83834075 GTTTTAAGCTACTGAGCTTTGGG - Intronic
1130924912 15:88377936-88377958 GTGATAAGCAACTGAGATTTGGG + Intergenic
1131012529 15:89030852-89030874 GTTTTAAGCTCCTGGGACTTGGG + Intergenic
1131631213 15:94178578-94178600 GTTTTAAGCTATTGAGTTTTTGG - Intergenic
1132218171 15:100083323-100083345 GTGTTAAGCCACTGAGATCTAGG + Intronic
1133741491 16:8655123-8655145 GTCTTAAGCTTCTAAGTTTTGGG - Intergenic
1133796820 16:9053005-9053027 GTGTTAGGCCACTGAGATTTGGG - Intergenic
1133913537 16:10087571-10087593 GTAATAAGCTACTGAGATTTTGG - Intronic
1134333691 16:13273808-13273830 TTCTTAAGTTTCTGAGGTTTAGG - Intergenic
1134762561 16:16727110-16727132 GTTTTAAGCTACTAAGTTTTTGG - Intergenic
1134870260 16:17646492-17646514 GTTTTAAGCTGCTGAGCTTTGGG + Intergenic
1134983492 16:18632044-18632066 GTTTTAAGCTACTAAGTTTTTGG + Intergenic
1135066402 16:19313918-19313940 GTTTTAAGCCACTGAGTTTTGGG - Intronic
1135486898 16:22873691-22873713 GTGTTAAGCCACTAAGTTTTGGG - Intronic
1135591697 16:23709848-23709870 GTTTTAAGCTCTTGAGTTTTGGG + Intronic
1136569365 16:31087651-31087673 GTGTTGCCCTCCTGAGGCTTGGG + Exonic
1137839714 16:51629051-51629073 GTGTTAAGCCACTGAAATTTGGG + Intergenic
1138250697 16:55499621-55499643 CAGTCAAACTCCTGAGGTTTGGG - Intronic
1138314137 16:56053850-56053872 GCTTTAAGCTACTGAGATTTTGG - Intergenic
1138639882 16:58376897-58376919 GTTTTAAGCCACTAAGGTTTTGG - Intronic
1138986215 16:62331800-62331822 GTTTTAAGCTCCTAAGTTTGCGG + Intergenic
1139252631 16:65510672-65510694 ATGTTAAGCCACTGAGGTTCTGG - Intergenic
1139458267 16:67101747-67101769 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
1141296826 16:82777596-82777618 GTTTTAAGCTGCTAAGTTTTGGG - Intronic
1142368101 16:89661089-89661111 GTTTTAAACTGCTGAGGTTTGGG + Intronic
1143306189 17:5948734-5948756 GTCTTAAGCTGCTAAGTTTTGGG - Intronic
1143982425 17:10881446-10881468 GTGGTAAGCTCCTGTCCTTTTGG - Intergenic
1144193121 17:12864334-12864356 GTGTTACTCTCCTCAGGCTTAGG + Intronic
1144272372 17:13630436-13630458 GGATTGAGCTCCTGAGTTTTGGG + Intergenic
1144436691 17:15248976-15248998 GTTTTAAGATCTTCAGGTTTAGG + Intronic
1144705685 17:17366395-17366417 GTATTAAGCCCTTGAGATTTGGG + Intergenic
1145760736 17:27424295-27424317 CTGCCAAGCTCCTGAGCTTTGGG - Intergenic
1146718353 17:35105012-35105034 GTCTTAAGCCACTAAGGTTTTGG + Intronic
1146897767 17:36557710-36557732 GTGTAAAGGTTCTGAGGTTGGGG + Intronic
1146945083 17:36868097-36868119 GTTTTAAGCTACTAAGTTTTGGG + Intergenic
1150157865 17:62869172-62869194 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1150526248 17:65925927-65925949 GTTCTAAGCCACTGAGGTTTAGG + Intronic
1150890276 17:69140138-69140160 GTGTTAAGCCACTGAGATTTGGG + Intronic
1150928243 17:69556773-69556795 GTTTTAAGCTACTAAGTTTTTGG - Intergenic
1151110154 17:71666871-71666893 GTGTTAAGCTACTGAGATATTGG + Intergenic
1151299634 17:73214156-73214178 GTGTTAAACTACTGAGGCTTTGG + Intronic
1151439871 17:74121412-74121434 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
1151487235 17:74408624-74408646 GTGTTAAGCCACTAAGTTTTGGG + Intergenic
1151908381 17:77064723-77064745 GTTTTAAGCTGCTGAAGTTGTGG - Intergenic
1151999494 17:77636596-77636618 GTTTTAAGCTGCTGAGTTTGTGG - Intergenic
1152293945 17:79455968-79455990 GTGTGAAGTTCTTGAGGTTTGGG - Intronic
1152542969 17:80986047-80986069 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1152838510 17:82550993-82551015 GTTTTAAGCTTCGGAGGCTTAGG + Intronic
1153062634 18:1009889-1009911 GTGTGAAGCTCCTGACATTAGGG + Intergenic
1153103939 18:1506144-1506166 ATGTTAAGCGTCTGAGGTCTGGG + Intergenic
1153638242 18:7131785-7131807 GTTTTATGCTTCTGAGGTTTGGG - Intergenic
1153941718 18:9984226-9984248 GTGTAAAGCCACTGAGATTTTGG + Intergenic
1153963010 18:10155696-10155718 GTGTTAAGCCATTGAGGTTTGGG + Intergenic
1154020315 18:10659014-10659036 GTTTTAAGCCACAGAGGTTTGGG - Intergenic
1155102713 18:22628866-22628888 GTTTTAAGCCACTGAGGTTTGGG - Intergenic
1155223454 18:23706762-23706784 GTTTTAAGCCCCTAAGTTTTGGG - Intronic
1155228493 18:23751374-23751396 TTGTTAAGCCACTGAGATTTGGG - Intronic
1155680554 18:28481201-28481223 GTGTTGAGCTGCTGTGGTCTTGG + Intergenic
1155699297 18:28723593-28723615 ATGTTAAGCCACTGAGTTTTGGG - Intergenic
1155920672 18:31600000-31600022 TTGTTAAGCCCCCGAGATTTGGG - Intergenic
1156278257 18:35606028-35606050 GTTTTAAGCCACTGAGGTTTTGG - Intronic
1156659242 18:39327029-39327051 GTGTTCAGCCCCTGAGACTTGGG + Intergenic
1156996817 18:43478907-43478929 GGATTAAGGTCCTGAGTTTTAGG + Intergenic
1157074721 18:44452764-44452786 GTCTTAAGCTACTAAGTTTTGGG + Intergenic
1157113271 18:44841042-44841064 GTTTTAAGCTACTAAGTTTTAGG - Intronic
1157481652 18:48059076-48059098 GTTTTAAGCTGCTATGGTTTTGG + Intronic
1157784188 18:50467381-50467403 GTTTTAAGCTGCTGTGTTTTTGG - Intergenic
1157850223 18:51041832-51041854 GTTTTAAGCTACTGATCTTTTGG + Intronic
1157970257 18:52258970-52258992 GTGTTGAGCCACTGAGATTTTGG + Intergenic
1157999978 18:52607064-52607086 GTGTAAAGCTACTGAGATTTTGG - Intronic
1158110881 18:53940319-53940341 GTGTTAAGTTTCTGAGATTTTGG + Intergenic
1158250252 18:55479765-55479787 GTGTTAAGCTACTGAAGTTTGGG + Intronic
1158309277 18:56141103-56141125 GTGTTAAGCCACTGAAATTTTGG - Intergenic
1158457961 18:57623967-57623989 GTTTTAAGCTGCTAAGGTTTGGG - Intergenic
1158858999 18:61573668-61573690 GTGTTAAGCTACTAAGATTTTGG + Intergenic
1158933725 18:62345899-62345921 GTGTAAAGCTCCTGAGTTGGAGG + Intronic
1159131760 18:64288058-64288080 ATTTTAAGCTGCTGAGATTTGGG - Intergenic
1159211877 18:65333608-65333630 GTCTTAAGCCACTGAGTTTTGGG + Intergenic
1159710612 18:71753958-71753980 GTGTTAAGCTACTGAGAGTTTGG - Intronic
1160063271 18:75551106-75551128 GTTTGAAGCTGCTGAGATTTTGG - Intergenic
1161754079 19:6119047-6119069 GTTTTAAGCTACTGATCTTTGGG - Intronic
1162415302 19:10532651-10532673 GTGTTAAACCACTGAGCTTTGGG + Intergenic
1162880336 19:13654189-13654211 GTTTTAAGCCCCTGAGTTTTGGG + Intergenic
1163000923 19:14366646-14366668 GTTTTAAGCTCCTGAGATTTGGG - Intergenic
1163787914 19:19286210-19286232 GTGTTAAACTCATGAAGTTCTGG - Intronic
1164886737 19:31784679-31784701 TTTTTAAGCTGCTGAGTTTTGGG - Intergenic
1165652683 19:37505241-37505263 GTTTTAAGCTTCTGAGTTTAGGG - Intergenic
1166545017 19:43628997-43629019 GTTTTAAGCTCCTAAGTTGTGGG + Intronic
1166770414 19:45278418-45278440 GTGTTAGGCCTCGGAGGTTTGGG + Intronic
1167295930 19:48649614-48649636 GTTTTAAGCCACTGAGTTTTAGG - Intergenic
925050513 2:811193-811215 GTGTTGAGCTTCTAAGTTTTTGG - Intergenic
925645046 2:6027322-6027344 GTTTTAAGCTGCTAAGATTTGGG + Intergenic
926024976 2:9533888-9533910 GTGTTAAGCTACTCAGCTATGGG + Intronic
926450594 2:12999428-12999450 ATGTTAAGCTACTGAGGTTTGGG - Intergenic
926684130 2:15685437-15685459 GTGTTAAGCCACTAAGTTTTGGG - Intergenic
926962426 2:18372916-18372938 GTTTCAGGCTCCAGAGGTTTTGG - Intergenic
926965745 2:18408723-18408745 GTATTAAGCTACTTAGGTTTTGG - Intergenic
927021919 2:19025958-19025980 TTGTTAAGCCCCTGAGATTGGGG + Intergenic
927471061 2:23377149-23377171 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
927803507 2:26123244-26123266 GTGTTAAACTCATGGGGTTCTGG - Intronic
928011751 2:27615355-27615377 GTTTTAAGCCACTGAGGTTCAGG - Intronic
928996471 2:37297235-37297257 TGGTTAAGCTCCTGAGGAATAGG + Intronic
930610072 2:53532524-53532546 GTGTTAAACTCATGGGGTTCTGG - Intergenic
931176195 2:59857495-59857517 GTGTTAAGTTACTGAGACTTTGG - Intergenic
931214818 2:60231248-60231270 CTGATAAACTCCTGAGCTTTGGG + Intergenic
931889222 2:66651727-66651749 GTGTTAAACCACTGAGATTTTGG + Intergenic
932067550 2:68582342-68582364 GTGTTAAGACACTGAGATTTTGG - Intronic
932776868 2:74533527-74533549 TTGGTAAGCTCCTGAGGTAATGG + Exonic
933195807 2:79388156-79388178 GTTTTAAGCTACTGAGGTCTTGG - Intronic
933587687 2:84197963-84197985 GTTTTAAGCTGCTGACTTTTGGG - Intergenic
933850851 2:86365423-86365445 GTGTTAAGCTCCCCAGATTATGG + Intergenic
934734605 2:96683527-96683549 ATGCTAAGGTCCTGGGGTTTGGG + Intergenic
934744518 2:96750352-96750374 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
934883422 2:98004039-98004061 GTTTTAAGCTATTGAGATTTGGG - Intergenic
935886524 2:107625336-107625358 GTGTTAAGCTGCTAAATTTTGGG + Intergenic
935943222 2:108263121-108263143 CTGTTAAACTACTGAGGTTTGGG + Intronic
937499781 2:122465966-122465988 ATTTTAAGCTCCTGAGTTTTGGG - Intergenic
937831373 2:126428023-126428045 GTGTTAAGTCACTGAGATTTAGG + Intergenic
938144355 2:128821429-128821451 GTTTTAAGCTTCTAAGTTTTGGG + Intergenic
940197211 2:151108239-151108261 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
940428961 2:153565158-153565180 GTTTTAAGCTGCTAAGTTTTTGG + Intergenic
940683010 2:156809829-156809851 GTGTGAAGCCACTGAGATTTGGG - Intergenic
940878288 2:158920851-158920873 GTGTTAAGCTGCTGAGGTTTGGG - Intergenic
941125709 2:161580782-161580804 TTGCTAAGGTCCTGAGATTTGGG - Intronic
942048513 2:172116168-172116190 GTTTCAAGCTACTGAGTTTTGGG - Intergenic
942436389 2:175981897-175981919 GTTTTAAGCTACTAAGTTTTGGG + Intronic
942577382 2:177378566-177378588 GTTTTAAGCTGCTAAGTTTTGGG + Intronic
942907601 2:181202604-181202626 GTTTTAAGCTGCTAAGTTTTAGG + Intergenic
943263084 2:185690720-185690742 GTGTTAAACTCTTGGGTTTTGGG + Intergenic
943735993 2:191355333-191355355 GTTTTAAGCTGCTGAGTTTTGGG + Intronic
944505290 2:200404672-200404694 GTTTTAAGCTGCTGAAGTTGTGG - Intronic
945027497 2:205632952-205632974 GTTTTAAGCTACTTAGGTTATGG - Intergenic
945170008 2:206986009-206986031 GGGTTAAGCCACTGAGATTTAGG + Intergenic
945605065 2:211918896-211918918 GTTTTAAGCCACTGAGATTTTGG + Intronic
946482127 2:220067402-220067424 GTGTTAAGCTACTGAAATTCAGG - Intergenic
946781994 2:223201431-223201453 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
947024280 2:225719121-225719143 GTTTTAAGCCACTGAGATTTTGG - Intergenic
947256604 2:228172654-228172676 GTCTTAATCCCCTGGGGTTTTGG - Intronic
947443932 2:230148690-230148712 GTTTTAAGCCACTGAGATTTGGG + Intergenic
947679907 2:232021122-232021144 CTGTTTAGCTCCTGGGGTATAGG + Intronic
947778825 2:232738948-232738970 GTGCTAAACTCCTTAGATTTAGG + Intronic
948762443 2:240200480-240200502 GTGTAAAGCTGCTAAGTTTTGGG + Intergenic
1169703248 20:8472849-8472871 GTGTTAAGCTACTGAGATGTGGG - Intronic
1169977291 20:11344527-11344549 ATGTTAAGCTTTTGAGATTTGGG - Intergenic
1170082332 20:12490833-12490855 GATTTAAACTTCTGAGGTTTGGG + Intergenic
1170089507 20:12575287-12575309 GTGTTAAGCTGCTGAGTTTTAGG - Intergenic
1170455728 20:16531011-16531033 GTTTTAAGCCCCTAAGTTTTGGG + Intronic
1170547990 20:17451277-17451299 ATTTTAAGCTACTGAGTTTTGGG - Intronic
1170635266 20:18098944-18098966 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1170713921 20:18816220-18816242 GTGTTCAGCTCCTGACTATTTGG + Intronic
1170715271 20:18825532-18825554 GTGAAAACCTGCTGAGGTTTTGG + Intronic
1171043013 20:21783075-21783097 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1171047431 20:21823765-21823787 CTGTAAAGCTCCTCAGCTTTTGG + Intergenic
1171187902 20:23136689-23136711 GTGTTAAGTCACTGAGATTTAGG - Intergenic
1171392123 20:24808474-24808496 GTTTCAAGCCCCTAAGGTTTAGG - Intergenic
1172141689 20:32726834-32726856 GTATTGTGCTCCTGAGGTTCTGG - Intronic
1172756396 20:37288020-37288042 GTTTTAAGCTCCTAAGTTTTAGG - Intergenic
1172958101 20:38776586-38776608 GTGTTAAGCCACTGAGATTTTGG - Intergenic
1173186683 20:40845614-40845636 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
1173316811 20:41951817-41951839 GTGGTAAACCACTGAGGTTTTGG + Intergenic
1173403418 20:42744614-42744636 GTGTTAAGCTACTAAGCCTTGGG - Intronic
1173525398 20:43728887-43728909 GTTTTAAGCTACTGAAGTTTTGG - Intergenic
1173577227 20:44120338-44120360 GTCTTAAGTACCTGAGATTTGGG + Intronic
1173655057 20:44694384-44694406 GTGCAAAGCCACTGAGGTTTTGG - Intergenic
1174037983 20:47679781-47679803 GTCTTAAGCTGCTGAGTTTGTGG + Intronic
1174124632 20:48294687-48294709 ATTTTAAGCTGCTGAGATTTGGG + Intergenic
1174744145 20:53045069-53045091 GTTTTAAGCTATTGAGATTTGGG - Intronic
1174880780 20:54277193-54277215 GTTTTAAGCTGCTGAGTTTTGGG + Intergenic
1175177797 20:57123762-57123784 GTGTTAAGCCACTGTGGTTTAGG - Intergenic
1175271652 20:57738323-57738345 GTTTTAAGCTGCTGAGTTTCTGG - Intergenic
1175758018 20:61542153-61542175 GGGTTAAGCTACTGAGATTTGGG + Intronic
1176148296 20:63575111-63575133 GTTTTAAGCCCCTGAGCTTTGGG + Intergenic
1176989495 21:15478091-15478113 ATGTTAAACCACTGAGGTTTGGG - Intergenic
1177252542 21:18613094-18613116 TTATTAAGCCTCTGAGGTTTGGG + Intergenic
1177932668 21:27304095-27304117 GTGTTCTGCTGCTGAGATTTTGG + Intergenic
1177950332 21:27528028-27528050 AAGGAAAGCTCCTGAGGTTTTGG - Intergenic
1178471345 21:32895711-32895733 GTGTTAAACCACAGAGGTTTGGG + Intergenic
1178503337 21:33143823-33143845 GTTTTATGCCACTGAGGTTTTGG - Intergenic
1178629625 21:34247968-34247990 GTGTTCAGCTGCTAAGCTTTGGG + Intergenic
1179029281 21:37705920-37705942 GGGTTAAGCTACTGAAATTTGGG - Intronic
1179244602 21:39620796-39620818 GTGTTAAGACCCCGAGATTTTGG + Intronic
1179413894 21:41182562-41182584 GTGTTGAGCTGCTGTGGTCTTGG - Intronic
1180080317 21:45483655-45483677 GTGAGGAGCTCCTGACGTTTTGG - Intronic
1182810113 22:33108981-33109003 GTGTCAAGCTGATGAGGTTGTGG + Intergenic
1183251553 22:36733821-36733843 GTGTTAAGCCACTGAGCTTTGGG - Intergenic
1183251819 22:36735660-36735682 GCGTTAAGCCACTGAGCTTTGGG + Intergenic
1183348691 22:37322253-37322275 GTGTGAAGCCACTGAGATTTGGG - Intergenic
1184533033 22:45069072-45069094 GTGTTGAGCTTCTGAGATATGGG - Intergenic
949238507 3:1840828-1840850 GTCTTAAGCCACTGAGATTTTGG + Intergenic
949597932 3:5567275-5567297 GTTTTAAGCTGCTAAGTTTTAGG + Intergenic
949636674 3:5990161-5990183 GTGTTCAGCCACTGAGTTTTGGG - Intergenic
950370701 3:12527652-12527674 TTGTTAAGCCCCTGAGACTTAGG - Intronic
950432891 3:12961192-12961214 GTGCTGAGCTTCTGAGGCTTTGG - Intronic
950555089 3:13690517-13690539 GTGATGAGCTGCTGAGATTTGGG + Intergenic
950966962 3:17153218-17153240 GTTTTAAGCTACTGAGTTTTGGG - Intergenic
951053861 3:18124879-18124901 GTGTTAAGCCACGGAGATTTTGG + Intronic
951262866 3:20532456-20532478 GTTTTAAGCCACTGAGATTTGGG - Intergenic
951462411 3:22965599-22965621 GTGTCAAGCTCCTGAGGATTTGG - Intergenic
951660545 3:25059335-25059357 TTGTTAAACTCCTGAGGCTTTGG + Intergenic
951677582 3:25259619-25259641 GTGTGAAGCTAATGAAGTTTCGG + Intronic
952263436 3:31762684-31762706 GTGTCAAGCTCCTGAGCTCGAGG + Intronic
952403657 3:32986342-32986364 GTTGTAAGCTACTAAGGTTTGGG + Intergenic
952540951 3:34367124-34367146 GTCTTAAGCTCCTGAGTTTGGGG + Intergenic
952894353 3:38067444-38067466 GTTTTAAGTTGCTGAGCTTTGGG - Intronic
953155299 3:40365772-40365794 ATGTTAAGCTACTGGGATTTGGG - Intergenic
953477120 3:43215010-43215032 GGGGTATGCTACTGAGGTTTTGG - Intergenic
953726690 3:45405726-45405748 GTTTTAAGCCACTGAGATTTGGG - Intronic
953760449 3:45682873-45682895 GTTTTAAGCCACTGAGGTTGTGG - Exonic
953837657 3:46361263-46361285 GTGATAAGCCACTGAGTTTTAGG + Intergenic
954922862 3:54206841-54206863 ATGTTAAGTTCCTGAAATTTAGG - Intronic
955176289 3:56617185-56617207 TTGTTCATCTCCTGAGATTTCGG + Exonic
955349799 3:58184973-58184995 GTGTTAAGCCACTGAGTTTGGGG - Intergenic
955914219 3:63890742-63890764 GTGTTAAGGCACTGGGGTTTTGG - Intronic
956113070 3:65890645-65890667 TTGTTCAACTCCTGAGTTTTTGG - Intronic
956304871 3:67812715-67812737 GTGATATGCTCTTGAAGTTTGGG - Intergenic
956358393 3:68418873-68418895 GTTTTAAGCTGCTAAGTTTTGGG - Intronic
956701716 3:71964890-71964912 GTTTTAAGCTGCTAAGCTTTGGG + Intergenic
956949914 3:74270499-74270521 GTTTTAGGCCACTGAGGTTTGGG + Intronic
957141729 3:76368315-76368337 GTTTTAAGCTGCTAAGTTTTGGG - Intronic
957760088 3:84544329-84544351 GTATTATGTTCTTGAGGTTTGGG + Intergenic
959121915 3:102242643-102242665 GTTTTAAGCTACTGAGATTGTGG + Intronic
959917608 3:111835566-111835588 GTTTTAAGCCGCTGAGTTTTGGG - Intronic
960022891 3:112975489-112975511 GTGTTAAGCCACTGAGTTTGTGG - Intergenic
961910543 3:130311484-130311506 GTTTTAAGCTACTGGGTTTTGGG + Intergenic
961986528 3:131140528-131140550 GTTTTAAGGTACTAAGGTTTGGG + Intronic
962321497 3:134394351-134394373 GTTTTAAGCCACTAAGGTTTGGG - Intergenic
962383855 3:134916970-134916992 GTTTTAAGCCACTGAGGTTGTGG + Intronic
962417198 3:135193829-135193851 GTGCTAAGCCACTGAGGTCTTGG - Intronic
963440820 3:145337179-145337201 GTTTTAAGCTACTAAGATTTAGG + Intergenic
963654557 3:148029154-148029176 ATTTTAAGCCCCTGAGATTTAGG - Intergenic
964638018 3:158878589-158878611 GTTTTAAGCTACTAAGTTTTTGG - Intergenic
964958177 3:162388554-162388576 TTGTATAGCTGCTGAGGTTTTGG - Intergenic
965752679 3:171992501-171992523 GTCTTAAACTCCTGAGGTCAAGG + Intergenic
966143226 3:176780372-176780394 GTTTTAAGCCACTGAGATTTTGG + Intergenic
966566004 3:181382269-181382291 GTGTTAAACCACTGAGGTTTTGG + Intergenic
966687697 3:182713974-182713996 GTGTGATGATGCTGAGGTTTGGG - Intergenic
967391322 3:188958175-188958197 GTGCTAATCTCCTGAGGATTTGG + Intronic
967488858 3:190065473-190065495 GTTTTAAGCCACTGAGATTTAGG + Intronic
969139861 4:5059204-5059226 GTCTTAAGCCACTGAGATTTGGG + Intronic
969358414 4:6645517-6645539 GTTTTAAGCCACTGAGATTTGGG + Intergenic
969653344 4:8481011-8481033 GTTTTAATCTCCTCAGGATTGGG - Intronic
970360230 4:15301971-15301993 GCGATAAGCCCCTGTGGTTTGGG - Intergenic
970472129 4:16389260-16389282 GTTTTAAGCTGCTGAGTTTGGGG + Intergenic
970545349 4:17123901-17123923 GTGTTGAGCCACTGAGATTTGGG - Intergenic
970976174 4:22045673-22045695 GTGTTAAGTCACTGAGGTTTTGG - Intergenic
971368320 4:25995155-25995177 GTGTGAAGCCCCTCAGGTTGTGG + Intergenic
971741907 4:30532173-30532195 GTATTAAGCTGCTAAGTTTTTGG + Intergenic
971821112 4:31556371-31556393 GTTTTAAGCCTCTCAGGTTTAGG + Intergenic
972246684 4:37252496-37252518 GTTTTAAGCCACTCAGGTTTGGG - Intronic
972321364 4:37976397-37976419 GTTTTAAGCTTCTCAGTTTTGGG + Intronic
972567231 4:40280671-40280693 GTTTTAAGCTACTGAGCTTTGGG - Intergenic
972776789 4:42248934-42248956 GGGTTAAGTCCCTGAGATTTTGG - Intergenic
973288852 4:48449502-48449524 GTTTTAAGCCCCTGAGTTTTGGG + Intergenic
973327180 4:48875234-48875256 ATGTTAAGCTCCTAAGATCTGGG - Intergenic
973648060 4:52969778-52969800 GTGTTTAGCCCCTGAGATTTGGG + Intronic
973841472 4:54865328-54865350 GTGTTAAGCTACTAGGTTTTGGG + Intergenic
974383893 4:61179825-61179847 ATGTTAAGCTGCTGAGATTTTGG - Intergenic
975065475 4:70057564-70057586 GTGTTAAGATGCTGAGTTCTGGG + Intronic
975491451 4:74993496-74993518 GTTTTAAGCTACTAAGATTTGGG + Intronic
975800264 4:78054139-78054161 GTGTTAAGATACTGTGATTTGGG + Intergenic
975941547 4:79653573-79653595 GTTTTAAGCCCCTGAGTTGTGGG - Intergenic
976187088 4:82452802-82452824 GTCTTAAGCTCCTGAGCTCAGGG + Intronic
976426767 4:84913092-84913114 GTGTTGAACTCATGAGGTTCTGG - Intronic
976792385 4:88893196-88893218 TTGTGAAGCTACTGAGATTTGGG - Intronic
977357394 4:95964553-95964575 GTTGTAAGCCACTGAGGTTTTGG + Intergenic
977649928 4:99457604-99457626 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
978246927 4:106584211-106584233 GTGTTAAGCTTCTTGGATTTAGG - Intergenic
978401040 4:108331115-108331137 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
979505240 4:121487202-121487224 GTTTTAAACTACTGAGATTTGGG + Intergenic
979630658 4:122899093-122899115 GTCTTGAACTCCTGAGGTTCAGG + Intronic
979721563 4:123905916-123905938 GTGTGAAGGACCTGAGATTTGGG + Intergenic
980325786 4:131343523-131343545 GCTTTAAGCTGCTAAGGTTTGGG + Intergenic
980700657 4:136424448-136424470 GTTTTAAGCCACTGAAGTTTGGG + Intergenic
980717833 4:136651135-136651157 GTTTTAAGCTGCTGAGTTTGTGG + Intergenic
981087749 4:140701335-140701357 GTGTTAAGCCACTGAGACTTTGG + Intronic
981110966 4:140932963-140932985 GTGTTAAGCCACTGAGAGTTGGG + Intronic
982099755 4:151956278-151956300 GTTTTAAGCTGCTAAGCTTTGGG + Intergenic
982421320 4:155201552-155201574 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
982619305 4:157683491-157683513 GTGTTAAACCACTGATGTTTTGG - Intergenic
983368200 4:166823430-166823452 GTGTGAAGTTGCTGAGATTTAGG + Intronic
983715132 4:170773035-170773057 GTGTTAAACTCATGGGGTTCCGG + Intergenic
983813589 4:172095326-172095348 CTCTTAAGTTCCTGAGGTCTGGG - Intronic
983873747 4:172852178-172852200 ATGCTGAGCTGCTGAGGTTTTGG - Intronic
983901912 4:173145167-173145189 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
984020862 4:174483531-174483553 TTGTTAAGCCCCTGCGATTTGGG + Intergenic
984418861 4:179494419-179494441 GTTTTAAGCCACTAAGGTTTTGG - Intergenic
984523127 4:180824336-180824358 TTGTTAAGCCACTGAGATTTTGG - Intergenic
984707750 4:182860278-182860300 ATGTTAAGCCACTGAGGTTTTGG + Intergenic
984729466 4:183054044-183054066 GTGTTGAACTCATGAGGTTCTGG - Intergenic
986052965 5:4107524-4107546 GTTTTAAGCTACTGAGATGTGGG - Intergenic
986066689 5:4241001-4241023 GTGTAGAGCCCCTGAGGCTTGGG + Intergenic
986247274 5:6021508-6021530 GCTTTAAGCTTCTGAGATTTTGG - Intergenic
986399004 5:7361246-7361268 GTTTTAAGTTCCTGAGTTTGTGG + Intergenic
986482081 5:8199722-8199744 GTGTTAAACTCCTGAGAACTTGG - Intergenic
986667419 5:10115592-10115614 GTTTTAAGCTCCTAAGTTTGTGG + Intergenic
986692986 5:10329277-10329299 GTTTTAAGCTACTAAGTTTTAGG - Intergenic
986697195 5:10368306-10368328 GCTTTAAGCTCCTGAGGTTTAGG - Intronic
986699125 5:10388485-10388507 GTTTTAAGCCACTAAGGTTTGGG - Intronic
986803118 5:11281954-11281976 GTTTTAAGCTACTAAGTTTTGGG - Intronic
986995269 5:13600698-13600720 GTATTAAGCCACTGAGATTTTGG - Intergenic
987521060 5:18984240-18984262 TTGCTAAGTTCCTGAGATTTGGG - Intergenic
987765458 5:22223179-22223201 GTGTTAAAGTTCTGATGTTTTGG + Intronic
988400955 5:30759644-30759666 GTGTTGAACTCATGAGGTCTGGG - Intergenic
988543539 5:32135248-32135270 GTTTTAAGCAACTGAGGTTTTGG + Intronic
988627059 5:32888514-32888536 GTCTTAAACTGCTGAGATTTTGG - Intergenic
989173885 5:38501169-38501191 GTGTTAAGCCACTGAATTTTAGG + Intronic
990439039 5:55825316-55825338 TTGTTAAGCCACTGAAGTTTTGG - Intergenic
991952604 5:71961122-71961144 GTCATAAGCTCCTGAGGCTTGGG + Intergenic
992324860 5:75650763-75650785 GTTTTAAGCCACTGAGCTTTGGG - Intronic
992467791 5:77024339-77024361 GTTTAAAGCCACTGAGGTTTGGG - Intergenic
992642127 5:78777056-78777078 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
993371645 5:87099835-87099857 TGGTTAAGCTCATGAGGTTAAGG + Intergenic
993731693 5:91430245-91430267 GTTTCAAGCCACTGAGGTTTCGG - Intergenic
994028273 5:95110546-95110568 ATGTTAAGCTCCTGAAATTGTGG + Intronic
994247664 5:97498920-97498942 GTTTTAAGCTGCTGAGTTTGTGG + Intergenic
995017289 5:107325531-107325553 TTTTTAAGCTGCTGAGATTTTGG - Intergenic
995299500 5:110561631-110561653 GTGTTAAGCCTCTTAGTTTTTGG - Intronic
995515627 5:112951965-112951987 CTGTTAAGCCACTGAGATTTTGG + Intergenic
995574186 5:113512638-113512660 GTGGTAAACTGCTGAGATTTGGG - Intergenic
995741073 5:115356209-115356231 GTGTTAAGCTTCTGAGATTTGGG + Intergenic
996503232 5:124239945-124239967 GTTTTAAGCCACTAAGGTTTTGG + Intergenic
997380375 5:133431737-133431759 GTTTTAAGCTGCTAGGGTTTGGG + Intronic
997407719 5:133665229-133665251 GGGTCAAGCCACTGAGGTTTAGG - Intergenic
998314487 5:141169216-141169238 GTGTTAAGCTGTTGAGATTTGGG + Intergenic
999360412 5:150981173-150981195 GTATTAAGCCACTGAGATTTAGG + Intergenic
1001147986 5:169201619-169201641 GTGTTAACCCACTGAGATTTTGG - Intronic
1001800855 5:174542757-174542779 CTTTTAAGCTCCTTAGTTTTGGG - Intergenic
1001887914 5:175312432-175312454 GTGTTAAGCTGCTGATGATTGGG + Intergenic
1001967029 5:175917540-175917562 GTGTTAAGCCACTGAGATATTGG - Intergenic
1002249906 5:177921672-177921694 GTGTTAAGCCACTGAGATATTGG + Intergenic
1004325694 6:14672144-14672166 GTGTTAACCCACTGAGATTTGGG + Intergenic
1004451471 6:15751911-15751933 GTTTTAAGCCACTGAGATTTGGG - Intergenic
1004483662 6:16045240-16045262 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1004489168 6:16097881-16097903 GTGTTAAGCCATTGAGATTTGGG - Intergenic
1005422538 6:25667462-25667484 GTGTTAAGACCCTGTGGTTCAGG - Intronic
1005423952 6:25681724-25681746 GTGTTAAGCCACTGAGATTTAGG + Intronic
1006595046 6:35186720-35186742 GTGTTAAGCCACTGAGATATTGG - Intergenic
1006621276 6:35366144-35366166 GTTTTAAGCTACTAAGTTTTGGG - Intronic
1007366985 6:41401284-41401306 GTTTTAAGCTGCTAAGTTTTAGG - Intergenic
1008187978 6:48418483-48418505 GTGTTAAGCTTCTAAGCTTATGG - Intergenic
1008928519 6:56912593-56912615 GTGTTAAGCTCCTGAGGTTTTGG - Intronic
1009222122 6:60995162-60995184 GTGTAAACCTCCTGAGATATTGG - Intergenic
1009363779 6:62842513-62842535 GTGTTTACCTCCTGTGGTATTGG - Intergenic
1009487490 6:64243323-64243345 GTGTTAAGCCACTGAGATTTGGG - Intronic
1010306860 6:74334925-74334947 GTGTTAAGCTATTGAGATTTTGG - Intergenic
1011237872 6:85237700-85237722 GTGTCATGCTCCTGAGCTCTTGG - Intergenic
1011363164 6:86550044-86550066 GTGTTAATCTCTTTAGGATTGGG - Intergenic
1011403678 6:86992853-86992875 GTGTTAAGCCACTGATATTTTGG - Intronic
1011788346 6:90870594-90870616 TAGTTAAGCTTCTGAGATTTGGG + Intergenic
1013065174 6:106676981-106677003 GTTTTAAGCTGCTGAATTTTGGG + Intergenic
1013177020 6:107686596-107686618 ATGTTAAGCTGCTGATATTTTGG + Intergenic
1013873654 6:114798313-114798335 GATTTAAGATCATGAGGTTTTGG + Intergenic
1013965906 6:115954936-115954958 GTGTTAAGCCCTCGAGGATTTGG + Intronic
1014295038 6:119607384-119607406 GTTTTAAGCCCCTCAGTTTTCGG + Intergenic
1014763227 6:125381324-125381346 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
1015502237 6:133946374-133946396 GTTTTAAGCTACCGAGTTTTTGG + Intergenic
1016203037 6:141436271-141436293 GTGTTAAACTACTAAGATTTTGG - Intergenic
1016305118 6:142675912-142675934 GTGTGAAGCCGCTGAGGTGTGGG + Intergenic
1016724141 6:147341438-147341460 GTGGTAAGTTCATGAGGTTCAGG - Intronic
1016794709 6:148105679-148105701 GAGTCAAGGTCCTGAAGTTTGGG + Intergenic
1017027302 6:150192643-150192665 GTGTTAAGCTACTGAGATTTGGG - Intronic
1018303286 6:162426662-162426684 GTGTTAAACTCCTGAGCTCAAGG + Intronic
1018994544 6:168701151-168701173 GAGTCATGCTCCTGAGGTGTCGG + Intergenic
1019812112 7:3172458-3172480 GTTTTAAGCCACTGAGTTTTGGG - Intronic
1020582609 7:10023364-10023386 ATCTTAATCTCCTGAGTTTTGGG + Intergenic
1021645753 7:22787956-22787978 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1022206019 7:28164257-28164279 GTCTAAAGCTACTGAGTTTTGGG + Intronic
1022764177 7:33392198-33392220 GTTTTAAGCCACTAAGGTTTGGG - Intronic
1022863921 7:34397746-34397768 GTTTTAAGCTACTAAGTTTTAGG - Intergenic
1022988860 7:35687127-35687149 GTGTTAAGCTACTGAGATCTTGG - Intronic
1024555918 7:50603600-50603622 GTTTTAAGCCACTAAGGTTTGGG + Intronic
1026741389 7:72980806-72980828 GTTTTAAGCTTCTGGGTTTTGGG - Intergenic
1027102346 7:75384272-75384294 GTTTTAAGCTTCTGGGTTTTGGG + Intergenic
1027922949 7:84419292-84419314 GTTTTAAGCTACTGAGATTTGGG + Intronic
1028015753 7:85709752-85709774 TTGTTAAGCCCCTGAGGTTTTGG - Intergenic
1028509924 7:91612922-91612944 GTTTTAAGCTACTGAGTTTGGGG + Intergenic
1029603963 7:101587320-101587342 GGGTTAAGCAACTGAGTTTTGGG - Intergenic
1030869483 7:114737671-114737693 CTGTTAAGCCACTGAGATTTGGG - Intergenic
1031641451 7:124169669-124169691 ATGTTAAGCCACTGAGCTTTCGG + Intergenic
1032163474 7:129527837-129527859 GCATTAAGCTGCTGAGGTTTGGG - Intergenic
1032259210 7:130321383-130321405 GTTTTAAGCTGCTAAGTTTTAGG - Intronic
1032550402 7:132779299-132779321 GTGTTAAGCACCTGAGGGTGAGG + Intergenic
1032741060 7:134739779-134739801 GTCTTAAGCCACTGAGATTTTGG + Intergenic
1033258141 7:139819424-139819446 GTGTGAAGCTCTTGAGATTTGGG + Intronic
1033317531 7:140310079-140310101 GTTTTAAGCTCCCCAGGTTGTGG + Intronic
1034319851 7:150169976-150169998 GTGTTAAGCTACTGAATTTGGGG - Intergenic
1034532841 7:151707491-151707513 GTGTGACCCTCCCGAGGTTTGGG - Intronic
1034772897 7:153797247-153797269 GTGTTAAGCTACTGAATTTGGGG + Intergenic
1034901700 7:154911721-154911743 GTGTTAAGCTTCTAAGTATTGGG + Intergenic
1037598199 8:20372261-20372283 GTTTTAAGCTACCGAGCTTTGGG - Intergenic
1037669082 8:20998774-20998796 GTTTTAAGCTGCTAAGCTTTGGG + Intergenic
1037917781 8:22783076-22783098 GGGTAGGGCTCCTGAGGTTTGGG + Intronic
1038217405 8:25574917-25574939 GTTTTAAGCTGCTGAGATTGGGG - Intergenic
1038286146 8:26207920-26207942 GTTTTAAGCTGCTAAGGTTTGGG - Intergenic
1038697252 8:29817612-29817634 CTGTTTGGCTCCTGAGGGTTGGG - Intergenic
1038861109 8:31389914-31389936 GTGTTAGGCCACGGAGGTTTTGG + Intergenic
1039170244 8:34736938-34736960 GTGTTAAGCCTCTGAGATTTTGG + Intergenic
1039914134 8:41847165-41847187 GTGTTAAGCCACTGAGATTTTGG - Intronic
1041578696 8:59431450-59431472 GTGTTCAGCCCCTGGGGATTTGG + Intergenic
1042121343 8:65491705-65491727 ATTTTAAACTTCTGAGGTTTGGG + Intergenic
1044164964 8:88970235-88970257 GTTTTAAGCTACTGAGGTTTAGG + Intergenic
1045424915 8:102056270-102056292 GTTTTAAGAGCCTGAGCTTTAGG + Intronic
1045566301 8:103319489-103319511 GTGTCAGTCTCCTGAGGGTTGGG + Intronic
1046612157 8:116437880-116437902 GTCTTAAGCTACTGAGTTTGTGG + Intergenic
1047344588 8:124014802-124014824 ATGTTAAGCCACTGAGTTTTGGG - Intronic
1047598097 8:126398985-126399007 GTGTTAAGCCACTGAGACTTTGG + Intergenic
1047670667 8:127142826-127142848 GTGTTAAGTCCCTGAGATATAGG - Intergenic
1048074053 8:131049493-131049515 GTTTTAAGCCCCTAAGTTTTGGG + Intergenic
1048420133 8:134270105-134270127 GTGTTAATCCACTGAGATTTTGG - Intergenic
1048495479 8:134932011-134932033 GTGTTAAGCTACTAAGATTTGGG - Intergenic
1050027481 9:1350892-1350914 GTTTCAAGCTCCTGAGACTTGGG + Intergenic
1050115529 9:2259520-2259542 GTGTTAAGCCATTGAGATTTAGG + Intergenic
1051491727 9:17674210-17674232 GTTTTAAGCTGCTTAGTTTTGGG - Intronic
1051993434 9:23182531-23182553 GCTTTAAGCCTCTGAGGTTTGGG - Intergenic
1052178807 9:25500252-25500274 GTGTTAAGCTACTGAGATTTGGG + Intergenic
1052557515 9:30036229-30036251 GTGTTTAAAACCTGAGGTTTGGG + Intergenic
1052809862 9:33047900-33047922 GTGTTAAGCCACCGAGATTTGGG + Intronic
1055268519 9:74528099-74528121 GTTTTATGCCACTGAGGTTTAGG - Intronic
1055438679 9:76317942-76317964 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1055475661 9:76661068-76661090 GTGTTAAACCACTGAGATTTGGG + Intronic
1055674434 9:78640984-78641006 GTGCTAAGTCACTGAGGTTTAGG + Intergenic
1056055136 9:82814008-82814030 GTGTTAACCTGCTTAGATTTGGG + Intergenic
1056953003 9:91059970-91059992 GTGTTAAGCCACTGAGACTTTGG - Intergenic
1058125937 9:101194986-101195008 ATGTTAAGCCACTGAGATTTAGG - Intronic
1058719793 9:107753201-107753223 GTTTTAAGCCCCTAAGTTTTGGG + Intergenic
1059024524 9:110611232-110611254 GTGTTAAGCTACTAAGTTTTAGG + Intergenic
1059226597 9:112678630-112678652 GTTCTAAACTCCTGAGTTTTAGG - Intergenic
1059709942 9:116858236-116858258 GTGTGAAGCTACTGAGTTTTGGG + Intronic
1059865730 9:118511948-118511970 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
1060041822 9:120306872-120306894 GTGTTACAATCCAGAGGTTTTGG - Intergenic
1060250105 9:121979405-121979427 GTTTTAAGCTGTTAAGGTTTGGG + Intronic
1060258182 9:122050991-122051013 GTTTTAAGCTGCTTAGTTTTGGG + Intronic
1060458206 9:123820629-123820651 GTGTTAAGTCACTGAGTTTTGGG + Intronic
1061615967 9:131779177-131779199 GTTTTAAGCTACTGAGTTTGTGG + Intergenic
1062249344 9:135586483-135586505 GTGTTCAGCTCCTGAGTCTGTGG - Intergenic
1185888378 X:3802522-3802544 GTTTTAAGCTACTCAGGTTGTGG + Intergenic
1186646532 X:11512896-11512918 GTTTGAAGCCTCTGAGGTTTGGG + Intronic
1186667135 X:11728794-11728816 GTGTTAAGCCACTGAGTTTGTGG - Intergenic
1186962358 X:14750281-14750303 GTGTTAAGCCTCTGAGTTTGTGG - Intergenic
1187232179 X:17433894-17433916 GGGTTAAGTCACTGAGGTTTGGG - Intronic
1187244887 X:17545266-17545288 GTATTAAGCTGCTGAGATTTGGG - Intronic
1187299879 X:18037933-18037955 GTTTTAAGACACTGAGGTTTGGG - Intergenic
1187448109 X:19375163-19375185 GTTTTAAGCTTCTGAAATTTTGG + Intronic
1187736190 X:22306041-22306063 GTGTAAAGCTTCTGAGACTTTGG + Intergenic
1188599195 X:31940659-31940681 ATGTTAAGCCACTGAGGTGTGGG + Intronic
1189114954 X:38332716-38332738 GTGTTAAGCCACTGAGATTTGGG - Intronic
1189251737 X:39605561-39605583 GTGTTAAGCCACTGAGATTTTGG + Intergenic
1189296883 X:39924806-39924828 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1189340509 X:40201265-40201287 GTTTTAAGCTGCTAAGTTTTGGG - Intergenic
1189570563 X:42291497-42291519 GTTTTAAGCTACTGAAGTTTTGG + Intergenic
1189689906 X:43605192-43605214 GTTTTAAGCTGCTAAGTTTTAGG + Intergenic
1190451309 X:50583934-50583956 GTTTTAAGCTACTGAGTTTGTGG + Intergenic
1190866674 X:54390626-54390648 GTTTTAAGCTGCTAAGTTTTGGG + Intergenic
1194902695 X:99533319-99533341 GTGGTAAGCCACTGAGATTTGGG - Intergenic
1195274782 X:103271070-103271092 GTGTTAAGCCACTGAGGTTTTGG + Intergenic
1195777201 X:108420414-108420436 ATTTTAAGCTACTGAGATTTGGG + Intronic
1196090178 X:111732358-111732380 GAGTTAAGCCACTGAGATTTTGG - Intronic
1196732547 X:118955465-118955487 GTTTTGAGCTCCTGAATTTTGGG + Intergenic
1196747657 X:119086016-119086038 GTGTGAAGGTCCAAAGGTTTTGG + Intronic
1196769628 X:119281000-119281022 GTGTTAAGCTGCTGAGTTTTGGG + Intergenic
1197112558 X:122793808-122793830 GTGTTAAGCCACTGATATTTGGG + Intergenic
1197146443 X:123177665-123177687 GTTTTAAGCCACTAAGGTTTGGG - Intergenic
1197683824 X:129416843-129416865 GTGTTAAGCCATTGAGATTTGGG - Intergenic
1197685853 X:129438792-129438814 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
1199547362 X:149019977-149019999 GTGTTAAGCTACTGACATTTGGG + Intergenic
1201219166 Y:11750005-11750027 GCTTTAAGCCACTGAGGTTTGGG - Intergenic
1201471069 Y:14335581-14335603 GTGTTTAGCTCCTGTATTTTTGG + Intergenic
1201497104 Y:14599908-14599930 GTATTAAGCTGCTTAGGTTCAGG - Intronic