ID: 1008928520

View in Genome Browser
Species Human (GRCh38)
Location 6:56912599-56912621
Sequence TTTATTGTGTTAAGCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008928520_1008928524 20 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928524 6:56912642-56912664 CACGCATAGATCAGCAAGTGGGG No data
1008928520_1008928526 24 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928526 6:56912646-56912668 CATAGATCAGCAAGTGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1008928520_1008928523 19 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928523 6:56912641-56912663 TCACGCATAGATCAGCAAGTGGG No data
1008928520_1008928525 21 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data
1008928520_1008928522 18 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928522 6:56912640-56912662 GTCACGCATAGATCAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008928520 Original CRISPR TTTATTGTGTTAAGCTCCTG AGG (reversed) Intronic
901945951 1:12703834-12703856 TTTGTTGTGTGAAGCTACTGAGG - Intergenic
903857838 1:26347076-26347098 TTTCTAGTTTTCAGCTCCTGGGG - Intronic
904087767 1:27921943-27921965 TTTATTTTGTTATCCTCCTAAGG + Intergenic
904282448 1:29430334-29430356 TTTATTGTGTTAAGCCATTGAGG + Intergenic
905614280 1:39383443-39383465 TTTATTGTATTAAAATACTGAGG + Intronic
905623384 1:39468831-39468853 TTTATTTTGTTAAGCTGCCCAGG + Intronic
909041112 1:70653584-70653606 TTTAATGTGTTAAGTCACTGAGG - Intergenic
909308614 1:74116095-74116117 TTTATTGTTTTAAGCTGTAGTGG - Intronic
910538898 1:88332232-88332254 TTAATTGTATTAAGCCACTGAGG + Intergenic
910898426 1:92093007-92093029 TTTCATGTGTGAAGCTCCTGTGG + Intronic
911701359 1:100956591-100956613 GTTACTGTGTTTAGCTCCTTGGG + Intronic
912116618 1:106415428-106415450 TTTATTATGTTATAATCCTGAGG - Intergenic
913375569 1:118148184-118148206 TTGATAGTGGTAAACTCCTGAGG - Intronic
913679269 1:121173110-121173132 TTCCTTGTGTTAAGGTGCTGAGG - Intronic
914031101 1:143960757-143960779 TTCCTTGTGTTAAGGTGCTGAGG - Intronic
914158347 1:145107207-145107229 TTCCTTGTGTTAAGGTGCTGAGG + Intronic
914843236 1:151265388-151265410 TTTTCTGTGTTCACCTCCTGGGG - Exonic
914903083 1:151722376-151722398 GTGATTTTGTTAAGCTCCTATGG - Intronic
916563966 1:165957161-165957183 TTTGTTGATTTAAGCTTCTGAGG - Intergenic
917185639 1:172351958-172351980 TTTATTGTATTAGTCTCCTTTGG - Intronic
919019021 1:192079680-192079702 TGTGTTGTGCTAAGCTACTGAGG - Intergenic
920466568 1:206191645-206191667 TTCCTTGTGTTAAGGTGCTGAGG - Intronic
921746567 1:218747325-218747347 TTTATTTTGTTAATCTTTTGTGG - Intergenic
923909998 1:238430947-238430969 TCTTTTGTGTTAAGCTACTAGGG - Intergenic
1063423137 10:5929811-5929833 TTTATTCTGCTTAACTCCTGGGG - Intronic
1063853163 10:10216296-10216318 TTTACTGTGCTAAGCAACTGAGG - Intergenic
1065896950 10:30171431-30171453 TTTATAGTGCTAAGCGCCAGTGG + Intergenic
1068187760 10:53608595-53608617 TTTTTTGTATTAAACTCCAGAGG + Intergenic
1068871978 10:61955134-61955156 TTTGTTGTGTTCAGCTATTGAGG - Intronic
1070529004 10:77319900-77319922 TTTCTTGTGTTATGCCACTGTGG + Intronic
1071528948 10:86374663-86374685 TTCATTGTGTTCATTTCCTGTGG - Intergenic
1071769412 10:88708993-88709015 TTTAATGTGTTATGATCCTTTGG - Intergenic
1071915352 10:90289084-90289106 TTTATTGTGGTTAGCAGCTGTGG + Intergenic
1072250671 10:93579899-93579921 TTTATTGTGTTAATCCACTGAGG - Intronic
1072911332 10:99504429-99504451 TCTGTTGTGTTAAGCACTTGGGG - Intergenic
1077745386 11:4898089-4898111 TTTATTGTGTGAAGGTCTTATGG + Intronic
1078459607 11:11504112-11504134 TCTTTTCTGTTGAGCTCCTGAGG + Intronic
1081880273 11:46444185-46444207 TTTATTGTGTTACGTGCCAGGGG - Intronic
1082808652 11:57465319-57465341 TGTGTTGTGTCACGCTCCTGAGG - Intronic
1083205842 11:61148567-61148589 TTTTTTTTTTTAACCTCCTGTGG - Intronic
1087064852 11:94018659-94018681 TTTATTTTCTTTAGCTCCTATGG + Intergenic
1088010288 11:104992566-104992588 CTTATTGTGTTAAACTACTGAGG + Intergenic
1088393211 11:109338816-109338838 GAGATTGTGTTAAGCTCCTTTGG + Intergenic
1088892361 11:114055205-114055227 TTTTTTTTTTTTAGCTCCTGAGG - Intergenic
1088924074 11:114282849-114282871 TTTATTTTGTTAAGCCACTGAGG + Intronic
1089060972 11:115625906-115625928 ATATTTGTGTTCAGCTCCTGAGG + Intergenic
1091024880 11:132133383-132133405 TGTATTGTGTTAAGCTCTTAAGG - Intronic
1093007793 12:14069168-14069190 TTTGCTGTGTTAAGCTCCTGGGG + Intergenic
1093719210 12:22418911-22418933 TATATTGTATTAGGTTCCTGTGG - Intronic
1093719709 12:22425551-22425573 TATATTGTATTAGGTTCCTGTGG - Intronic
1094211543 12:27898385-27898407 TTCCTTGTGTTAAGCTCATATGG - Intergenic
1094272668 12:28634113-28634135 TTTGTTGTTATAAGCCCCTGAGG - Intergenic
1096291440 12:50347097-50347119 TTTGTTGTTTTAAGCCACTGAGG - Intronic
1097210942 12:57369143-57369165 TTGATGGTGTTAAGATGCTGGGG - Intronic
1098147195 12:67509719-67509741 CTTATTGTGCTATGCTACTGGGG + Intergenic
1098340140 12:69443022-69443044 TTTGTTGTTTTAAGCTGCTAAGG - Intergenic
1100294961 12:93252468-93252490 TTTATTGTTTTCAATTCCTGGGG + Intergenic
1100410180 12:94309371-94309393 TCTATTGTATCAAGCCCCTGAGG - Intronic
1100686854 12:96995958-96995980 TTTCTTTTGATAAGCTACTGAGG - Intergenic
1102194696 12:111016723-111016745 TTTGTTGTCTTAAGCCTCTGTGG + Intergenic
1102524744 12:113504179-113504201 TTTATTGTTGTAAGCCTCTGGGG + Intergenic
1104608663 12:130209057-130209079 TCTATTGTGTTAAGCTGCTAAGG + Intergenic
1105641686 13:22271274-22271296 TTTATTGTTTAATACTCCTGTGG - Intergenic
1105906553 13:24816446-24816468 TTTATTGTGGTAAGCAGCTATGG - Intronic
1106057920 13:26255114-26255136 TTTATTATGGTAACCTTCTGGGG + Intronic
1107679521 13:42833911-42833933 TTTATTGTGTTAGTTTTCTGTGG - Intergenic
1109303207 13:60610900-60610922 TTTATTGTGTTGGGCACTTGGGG + Intergenic
1110267643 13:73556431-73556453 TTTATACTGCTGAGCTCCTGTGG + Intergenic
1110351299 13:74511173-74511195 TCTATTTTGTTAAGCCACTGAGG - Intergenic
1110667207 13:78131633-78131655 TTTATTGTGTGTATTTCCTGAGG - Intergenic
1112074363 13:95893867-95893889 TTTACTCTGTCAGGCTCCTGTGG - Intronic
1112956433 13:105064567-105064589 ATGATTGTGTTAATTTCCTGTGG + Intergenic
1113210582 13:107974932-107974954 TTTATTTTATTAATATCCTGTGG + Intergenic
1113569408 13:111343212-111343234 GTTAGTGTGGGAAGCTCCTGGGG + Intronic
1115064147 14:29235499-29235521 TTTTTTGTGTTTAGATGCTGTGG - Intergenic
1115569234 14:34651522-34651544 ATTATTGTGTTAAGCCACTGTGG + Intergenic
1117434066 14:55699654-55699676 TCTATTGTGTTTAGCCACTGGGG + Intronic
1118890992 14:69908753-69908775 TTTATTGTGGTAACCTCCTTAGG + Intronic
1119115577 14:72018036-72018058 TTTCTTGTGTTAGTCTGCTGAGG + Intronic
1122584705 14:102797207-102797229 TATATTGTCTTAAGCTTCTTAGG + Intronic
1123711254 15:22989432-22989454 TTTATTGTGTCAACCTAGTGAGG - Intronic
1124407426 15:29404776-29404798 TGTATTGAGTTAGGCTGCTGGGG - Intronic
1125189052 15:36968113-36968135 TCTTTTGTGTTAAGCCACTGAGG + Intronic
1126909396 15:53402084-53402106 TATATTGTGATAAGCCACTGTGG - Intergenic
1131568939 15:93512991-93513013 TTATTTCTGTTAAGATCCTGTGG + Intergenic
1133654773 16:7850242-7850264 TTTATAGTGTTAATTTCCTAGGG - Intergenic
1136730177 16:32403746-32403768 TTTATTGTCTTATGCTTCTGTGG - Intergenic
1137004835 16:35266002-35266024 TTTACTCTGTGAAGATCCTGTGG + Intergenic
1137458499 16:48636749-48636771 TTTGTTGTGTGAAGCCGCTGAGG - Intergenic
1137515800 16:49143131-49143153 TTTATTGTCTTAAGATTATGCGG + Intergenic
1139252632 16:65510678-65510700 TTTAGTATGTTAAGCCACTGAGG - Intergenic
1202996224 16_KI270728v1_random:113562-113584 TTTATTGTCTTATGCTTCTGTGG + Intergenic
1203022911 16_KI270728v1_random:425904-425926 TTTATTGTCTTATGCTTCTGTGG + Intergenic
1146371409 17:32267033-32267055 TTTCTTGGGTTAACCTCCCGGGG + Intronic
1148985123 17:51613859-51613881 TTTATTATGTTAAACTTTTGGGG + Intergenic
1149089653 17:52762831-52762853 TCTTTTGTGTTAAGCTACTAAGG - Intergenic
1149154886 17:53616271-53616293 TTTTTTGTGTTAATCTTATGAGG + Intergenic
1149248501 17:54740190-54740212 TTTATTGTGAACAGCTGCTGGGG + Intergenic
1151314853 17:73315526-73315548 TTTATTTTGTTAATTTCCTCTGG - Intergenic
1152166041 17:78707204-78707226 TTTGTTGTTTTAGACTCCTGTGG - Intronic
1153103937 18:1506138-1506160 TTTGTTATGTTAAGCGTCTGAGG + Intergenic
1153445462 18:5167559-5167581 TCAATTGTTTTAAGCTCTTGAGG - Intronic
1155778031 18:29793186-29793208 TTTATTTTGCTCAGCTCATGAGG + Intergenic
1156278258 18:35606034-35606056 TTTGTTGTTTTAAGCCACTGAGG - Intronic
1156732621 18:40212769-40212791 TTTTTTTTTTTAAGCTTCTGGGG + Intergenic
1157481651 18:48059070-48059092 TTTATTGTTTTAAGCTGCTATGG + Intronic
1164969633 19:32520630-32520652 TTTATTGTTTTAAGCTGCCAAGG - Intergenic
1166426791 19:42686124-42686146 TTTAGTGTGTTAAGATCCTGAGG + Intronic
1167209138 19:48122258-48122280 GTCATTGTGCGAAGCTCCTGGGG - Intronic
925787408 2:7446405-7446427 TTTATTGTGTTAATTTTCTGAGG - Intergenic
928481673 2:31690223-31690245 TTGAGTGTGTTAAGAACCTGAGG + Intergenic
928815731 2:35292724-35292746 TTTTTTGTGTTAAACTACTAGGG + Intergenic
931778672 2:65561557-65561579 TTTGTTATGTTCAGTTCCTGGGG + Intergenic
933195808 2:79388162-79388184 TTTGCTGTTTTAAGCTACTGAGG - Intronic
933509340 2:83219635-83219657 GTTTTTTTGTAAAGCTCCTGTGG - Intergenic
933650714 2:84847730-84847752 TGTGTTGTGTTAGGCTCCTAGGG + Intronic
936869601 2:117119411-117119433 TTGATTGTGTTATGCTTGTGGGG + Intergenic
937516673 2:122663513-122663535 TTTATTAAGATAAGATCCTGGGG - Intergenic
937768083 2:125685295-125685317 TTTATGGTGTTTAGCTGGTGTGG - Intergenic
939125551 2:138173349-138173371 ATCATTGTGATAAGCTCCTATGG - Intergenic
940070328 2:149679326-149679348 TTTATTGTAGTAAGCCTCTGAGG - Intergenic
940878290 2:158920857-158920879 TTTGTTGTGTTAAGCTGCTGAGG - Intergenic
942523759 2:176831305-176831327 TTTATTGTTTAAAGCTCCCCAGG + Intergenic
942856219 2:180552348-180552370 ATTGTTGTGTTAACCACCTGAGG + Intergenic
943680822 2:190766008-190766030 TTTCTTGTGTTAAGCCACTGTGG - Intergenic
943718198 2:191175483-191175505 TGTATTGTTTTAAGTTCCAGTGG + Intergenic
946037461 2:216755419-216755441 TTTATTGTGTTAAGCCATTGAGG - Intergenic
946212391 2:218157701-218157723 TTTATTATCTTTAGCTCCTCAGG - Intergenic
946632940 2:221690948-221690970 TTTGTTGTTTTAAGCCACTGAGG + Intergenic
946706344 2:222462141-222462163 TTGCTTGTGTTATTCTCCTGAGG - Intronic
947446417 2:230167046-230167068 TTTATTGGGTGCAGCTCCTTGGG - Intergenic
1169841150 20:9939380-9939402 ATTGTTGTTTTAAGCTACTGGGG - Intergenic
1171117997 20:22543553-22543575 TTTAGTGTGTTAATCTCCTGAGG - Intergenic
1173343712 20:42178576-42178598 TTTGTTATTTTAAGCTGCTGTGG - Intronic
1173593636 20:44244830-44244852 TCTATTGTGTGAAGCCACTGAGG - Intergenic
1174257881 20:49271742-49271764 TTCATTGTGTTTAGGCCCTGTGG - Exonic
1177223857 21:18228198-18228220 TTTAATTTTTTAAGCTACTGGGG + Intronic
1177280668 21:18978579-18978601 TTATTTTTGTTAAGCTCCTGTGG + Intergenic
1177547447 21:22577804-22577826 TTTATATTGTTAATCTCCTATGG - Intergenic
1177829973 21:26127113-26127135 TTTATTGTATTAACTCCCTGTGG + Intronic
1179413895 21:41182568-41182590 TTTTATGTGTTGAGCTGCTGTGG - Intronic
1183151189 22:36038642-36038664 TTAATTTTGTTAAGCCGCTGAGG + Intergenic
1184283930 22:43455831-43455853 ATTATTGTGTTAATTTCCTGAGG + Intronic
1184311531 22:43647965-43647987 TTTATTGTTTTAAGCTACCCAGG + Intronic
951377517 3:21938911-21938933 TTCATTGTTTGAAGCTCATGAGG + Intronic
951462412 3:22965605-22965627 TTTACAGTGTCAAGCTCCTGAGG - Intergenic
953366859 3:42352542-42352564 TTTAATGAGTTGAGCTCCTCAGG - Intergenic
955532070 3:59884417-59884439 TTTATTGTGTTGATATCCAGTGG - Intronic
955914220 3:63890748-63890770 TATATTGTGTTAAGGCACTGGGG - Intronic
957291628 3:78284154-78284176 TTAATTGTGTTAATTCCCTGAGG + Intergenic
957794444 3:84985452-84985474 TTTATTAGGTTAAGCTAATGAGG + Intronic
957895329 3:86414114-86414136 TTCATTGTCTTAAATTCCTGTGG + Intergenic
958982169 3:100734550-100734572 TTTATTGGGGTAAACTCCTCTGG + Intronic
959402739 3:105922779-105922801 ATTATTGTGTTAACCACCTTTGG - Intergenic
959727515 3:109560893-109560915 TCTTTTGTGTTCAGCTACTGGGG + Intergenic
961989791 3:131176184-131176206 TTTGTTGTATTATGCTCCAGTGG - Intronic
963829467 3:149991623-149991645 TTTTTTTTTTTAAACTCCTGCGG + Intronic
964178995 3:153860717-153860739 TTAATTGTTTTCAGCTCCAGTGG + Intergenic
967200662 3:187069859-187069881 TTTGTTTTGTTAAGCTAGTGTGG - Intronic
967727204 3:192872927-192872949 TCTGTTGGGTTAAGCTACTGGGG - Intronic
969987784 4:11229520-11229542 TTTCTTGTGTTATCCTCATGTGG + Intergenic
970360232 4:15301977-15301999 TTTGTTGCGATAAGCCCCTGTGG - Intergenic
971736269 4:30456506-30456528 TTTATTGCGTTATGTTTCTGGGG - Intergenic
972869445 4:43279210-43279232 TTTATTGTGTCAAGTACCTGTGG + Intergenic
973308491 4:48679439-48679461 TTTATCATTTTAAGCTCCTTAGG - Intronic
974637760 4:64587792-64587814 TTTATTGTTGAAAGCTTCTGAGG + Intergenic
975606574 4:76161041-76161063 TTGATAGTGATAAGCTCCTAAGG - Exonic
975938011 4:79605355-79605377 GTTATTGTTTTAAGCCACTGAGG - Intergenic
975960682 4:79900351-79900373 TGTGTTGTGTTAAGCAACTGTGG + Intergenic
976561023 4:86501190-86501212 TTTATTGTTTTTATCTCCTGTGG - Intronic
976834727 4:89358475-89358497 TTTATAATGTTACGCTCCTGTGG + Intergenic
977336360 4:95704833-95704855 TTTTTTTTTTTAAGTTCCTGAGG - Intergenic
979480125 4:121206878-121206900 TTTCTTGCACTAAGCTCCTGAGG + Intronic
981831923 4:149011572-149011594 TCTATTGTTTTAAGCTTTTGTGG + Intergenic
983514292 4:168640364-168640386 TTTAATGTGCTAAGCTACTTGGG - Intronic
983882025 4:172943467-172943489 TTTATTGTTTTAAGCCGCTCAGG + Intronic
984459133 4:180010755-180010777 TTTATTGTTTTACACTCCTGGGG + Intergenic
986283166 5:6339866-6339888 TTTATTGTTTTACAGTCCTGAGG - Intergenic
986697196 5:10368312-10368334 TTTGATGCTTTAAGCTCCTGAGG - Intronic
987051650 5:14152066-14152088 TTTATTGTGTGAAGCTAGTTAGG - Intronic
988654525 5:33193946-33193968 TTTATTGTGATATACTACTGTGG + Intergenic
991136814 5:63192089-63192111 TTTGTTGGGTTAAGCCACTGAGG + Intergenic
991598558 5:68329298-68329320 TTTATTATGTTGACCTCCTTGGG + Intergenic
992816754 5:80448810-80448832 TGTAGTGTGTTAATCTCCTTGGG + Intronic
993221612 5:85105452-85105474 TTTATTGATTTTAGCTCCTCAGG - Intergenic
995548249 5:113254027-113254049 TTTATTCTGCTCAGCACCTGTGG - Intronic
998014194 5:138719277-138719299 TTGATTGTGTTCTGCTCCTTTGG - Intronic
999574510 5:152960739-152960761 TTTATAGTATTTGGCTCCTGAGG + Intergenic
1000877597 5:166660322-166660344 ATTGTTGTTTTAAGCTACTGAGG - Intergenic
1001174660 5:169456766-169456788 TTTATTGTGTGCAGCTCCTGAGG + Intergenic
1001679825 5:173547930-173547952 TTTTGTGTTTTAAGCTACTGAGG + Intergenic
1005128667 6:22477360-22477382 TTTATTAAGTTAAGCTCCTGAGG + Intergenic
1005422539 6:25667468-25667490 TATAGTGTGTTAAGACCCTGTGG - Intronic
1007182707 6:39941913-39941935 GTGATGGTGTTAGGCTCCTGAGG + Intergenic
1008928520 6:56912599-56912621 TTTATTGTGTTAAGCTCCTGAGG - Intronic
1011374521 6:86675216-86675238 TTTCTTGTGTTAATTTCCTTAGG + Intergenic
1012199629 6:96389532-96389554 TTTTCTGTGTTAAGCTCTTAAGG - Intergenic
1012296149 6:97526982-97527004 TTTATAGTTTTAAGCTCATCAGG + Intergenic
1012853535 6:104474900-104474922 TTTATTGTTTTAAGCTGGTTTGG - Intergenic
1013260044 6:108432747-108432769 TGTTTTGTTTTAAGCTCCTTAGG - Intronic
1014658079 6:124132328-124132350 TCTTTTGTGTTCAGCTACTGGGG - Intronic
1015439769 6:133234329-133234351 TGTATTGTGTTCATGTCCTGGGG - Intergenic
1017301888 6:152870309-152870331 TTTATTGGTTTAGTCTCCTGTGG - Intergenic
1017353653 6:153475740-153475762 TTTTTTGTGTTAATCTCAAGTGG - Intergenic
1017603713 6:156110937-156110959 TATATTGTCTTCAGCTTCTGAGG + Intergenic
1018092197 6:160355120-160355142 TTTATTGTGTTACACAACTGAGG + Intronic
1018338682 6:162825674-162825696 TCTATTATCTTGAGCTCCTGGGG + Intronic
1019878499 7:3837786-3837808 TTTATTTTGGTAACCTCATGTGG + Intronic
1021189057 7:17599480-17599502 ATAATTGTGTTTATCTCCTGAGG - Intergenic
1023108637 7:36788167-36788189 GTAATTGTGGTAAGCTGCTGAGG + Intergenic
1023212051 7:37816525-37816547 TTTACTGTGAAAATCTCCTGTGG + Intronic
1023883533 7:44335058-44335080 TTCATTGTGCCAAGCTTCTGTGG - Intergenic
1024385404 7:48746098-48746120 TTTTTTCTTTTAAGCTCCTTGGG - Intergenic
1024909323 7:54427265-54427287 TTTGTTGTGTTAAGCCACTAAGG - Intergenic
1024985214 7:55188251-55188273 TCTATTTTGTAAATCTCCTGTGG - Intronic
1025832836 7:65069082-65069104 TTTATTGTGGTGAGCTCTTTGGG - Intergenic
1025902607 7:65758603-65758625 TTTATTGTGGTGAGCTCTTTGGG - Intergenic
1026070954 7:67119209-67119231 GTCATTTTTTTAAGCTCCTGGGG - Intronic
1026705946 7:72693089-72693111 GTCATTTTTTTAAGCTCCTGGGG + Intronic
1027440574 7:78215189-78215211 ATTATTGTGTTGAGCAGCTGGGG + Intronic
1027541390 7:79471048-79471070 TTGATTGTGTTAAGTGTCTGTGG - Intergenic
1027547577 7:79547935-79547957 TTTCTAGTTTTAAGCTCCTTGGG - Intergenic
1028061474 7:86323060-86323082 TTTATTGGGTAAATTTCCTGTGG + Intergenic
1028310797 7:89332896-89332918 TTTATAATGTTTAGCTCCTTGGG - Intronic
1028937573 7:96483485-96483507 TTTGTTGGGTTAAGCATCTGAGG - Intronic
1029963993 7:104718966-104718988 TTTCTTCTCTTAAGATCCTGCGG + Intronic
1031268306 7:119611279-119611301 TTTATTGTGGTTAGCAGCTGTGG - Intergenic
1031429786 7:121653230-121653252 TTTATTGTGCTGTGGTCCTGTGG + Intergenic
1032593549 7:133215859-133215881 TTTATTGTGTTCACCATCTGAGG - Intergenic
1034728773 7:153365339-153365361 TTTGTAGGGTAAAGCTCCTGTGG + Intergenic
1037968437 8:23152466-23152488 TTTATTGTAGTCAGCTCCTGTGG + Intronic
1038861108 8:31389908-31389930 TTTATTGTGTTAGGCCACGGAGG + Intergenic
1039392890 8:37196162-37196184 TTTATTGTGATCAGCAGCTGAGG + Intergenic
1040014322 8:42688957-42688979 TTTGTTTTTTTAAGCTCCTCAGG - Intergenic
1041923353 8:63208448-63208470 TTTAATGTGTTAAACACCAGTGG + Intronic
1043170072 8:76954886-76954908 TTTATTTTGTCAATCTCCTATGG - Intergenic
1043277193 8:78413465-78413487 TTTATTATGTTTAGCTTATGTGG + Intergenic
1043676468 8:82962061-82962083 TAAATTGTGTTCAGCTCCTGTGG - Intergenic
1044164963 8:88970229-88970251 TTTGTTGTTTTAAGCTACTGAGG + Intergenic
1047787153 8:128164764-128164786 TTCATTGTGTTTTGGTCCTGGGG + Intergenic
1052119347 9:24691793-24691815 TTTATTGTATTAAGCCTCTGGGG + Intergenic
1052775459 9:32728423-32728445 TTTATTGTGGTCAGCAGCTGTGG - Intergenic
1052786524 9:32833225-32833247 TTTATTGTATTAAGTTCTTCGGG - Intergenic
1053246652 9:36540031-36540053 TTTATTGTCTTAAGCTGATATGG + Intergenic
1055095128 9:72405482-72405504 TTTATTGTGGTAATCTCCCCAGG - Intergenic
1055173917 9:73294422-73294444 GTTATTGTATTAAGATTCTGTGG + Intergenic
1056367346 9:85918895-85918917 CTTTTTCTGTTAAGATCCTGTGG + Intergenic
1058761749 9:108140743-108140765 TCTATTGTGTTAACCTGCTGAGG - Intergenic
1059922611 9:119175611-119175633 TTTATAGTGTTGAGGGCCTGTGG - Intronic
1060748074 9:126150811-126150833 TCTATTGTGTTAAGCTACTGAGG + Intergenic
1061068188 9:128292191-128292213 TTTATTGTGTTCAGCCACAGAGG - Intergenic
1061437687 9:130576445-130576467 TGTATTGTTGTAAGCTACTGAGG + Intergenic
1061589132 9:131587603-131587625 TTCATTCCGCTAAGCTCCTGGGG - Intronic
1187216457 X:17281900-17281922 TTTATTGATTTAAGCCACTGTGG + Intergenic
1188098993 X:26058979-26059001 TTTATTGTTTTTAGTTCCAGTGG - Intergenic
1188599193 X:31940653-31940675 TCTATTATGTTAAGCCACTGAGG + Intronic
1188839512 X:34998545-34998567 TTAATTGAGTTATGCTCCTATGG + Intergenic
1193436251 X:81478000-81478022 TTTATTGTGTTATGCTACAAAGG - Intergenic
1193443809 X:81575622-81575644 TTTATTGAGTATAACTCCTGTGG - Intergenic
1195067003 X:101246480-101246502 TTTCTTGTTTTAAGCTAATGAGG + Intronic
1195274781 X:103271064-103271086 TTTGTTGTGTTAAGCCACTGAGG + Intergenic
1195979759 X:110564719-110564741 TTTATTGTGTTGAGGGCCAGAGG - Intergenic
1197879121 X:131146331-131146353 TATATTGTGTAAAGTTACTGAGG - Intergenic
1198836931 X:140815724-140815746 TCTTTTGTGTTAAGCTACCGGGG + Intergenic