ID: 1008928521

View in Genome Browser
Species Human (GRCh38)
Location 6:56912630-56912652
Sequence ATCTATGCGTGACATGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008928521_1008928525 -10 Left 1008928521 6:56912630-56912652 CCTCGCTCATGTCACGCATAGAT 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data
1008928521_1008928526 -7 Left 1008928521 6:56912630-56912652 CCTCGCTCATGTCACGCATAGAT 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1008928526 6:56912646-56912668 CATAGATCAGCAAGTGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1008928521_1008928528 27 Left 1008928521 6:56912630-56912652 CCTCGCTCATGTCACGCATAGAT 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1008928528 6:56912680-56912702 ACAGAGTCATTTAGAACACCAGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008928521 Original CRISPR ATCTATGCGTGACATGAGCG AGG (reversed) Intronic
902712667 1:18251068-18251090 ATCTATGGATGGGATGAGCGTGG + Intronic
922014927 1:221635684-221635706 ATCTATGCAAGAAATGAGAGTGG + Intergenic
1080770861 11:35340156-35340178 ATCTTTTCCTGACATGAGCTGGG - Intronic
1085762107 11:79250372-79250394 ACCTATGCCTGACCTGAGCCTGG - Intronic
1128055019 15:64692897-64692919 ATCCTTTCGTGACCTGAGCGTGG + Intronic
1134649422 16:15896835-15896857 ATCCATGTGTGACATGCGAGAGG + Intergenic
944469298 2:200035905-200035927 ATCCATGTGTGACATGAGTGTGG + Intergenic
1171115175 20:22519243-22519265 ATCTAGGCATGAGATGGGCGTGG + Intergenic
1181918767 22:26302719-26302741 ATCTATGTGTGAAATCAGGGAGG + Intronic
955480449 3:59384567-59384589 CTCTATGCGTGGCATGAGCTAGG - Intergenic
969500798 4:7551629-7551651 CTCTACCCGTGACATGAGCTGGG + Intronic
1008928521 6:56912630-56912652 ATCTATGCGTGACATGAGCGAGG - Intronic
1034596632 7:152201265-152201287 CTGTATGTGTGACATGAGGGAGG - Intronic
1040761927 8:50857826-50857848 TTCTGTGCGGGAAATGAGCGAGG + Intergenic
1041092987 8:54320118-54320140 AGCTATGGGTGACATGAGTCTGG + Intergenic
1056658719 9:88529342-88529364 ATCTAAAGGTGACATGAGTGTGG - Intergenic
1195726961 X:107927853-107927875 ATGTGTGCGTGACAGGAGGGAGG - Intergenic