ID: 1008928525

View in Genome Browser
Species Human (GRCh38)
Location 6:56912643-56912665
Sequence ACGCATAGATCAGCAAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008928520_1008928525 21 Left 1008928520 6:56912599-56912621 CCTCAGGAGCTTAACACAATAAA 0: 1
1: 0
2: 7
3: 30
4: 226
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data
1008928521_1008928525 -10 Left 1008928521 6:56912630-56912652 CCTCGCTCATGTCACGCATAGAT 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data
1008928519_1008928525 27 Left 1008928519 6:56912593-56912615 CCAAAACCTCAGGAGCTTAACAC 0: 1
1: 1
2: 15
3: 97
4: 564
Right 1008928525 6:56912643-56912665 ACGCATAGATCAGCAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008928525 Original CRISPR ACGCATAGATCAGCAAGTGG GGG Intronic
No off target data available for this crispr