ID: 1008931596

View in Genome Browser
Species Human (GRCh38)
Location 6:56946136-56946158
Sequence GTGCAGAAACAGAGAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 455}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008931593_1008931596 19 Left 1008931593 6:56946094-56946116 CCAAGACAGGGAATATCAAGTTA 0: 1
1: 0
2: 1
3: 13
4: 124
Right 1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG 0: 1
1: 0
2: 2
3: 46
4: 455
1008931592_1008931596 20 Left 1008931592 6:56946093-56946115 CCCAAGACAGGGAATATCAAGTT 0: 1
1: 0
2: 0
3: 23
4: 254
Right 1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG 0: 1
1: 0
2: 2
3: 46
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008931596 Original CRISPR GTGCAGAAACAGAGAGAGCC AGG Intronic
900238827 1:1605253-1605275 GAGCAGAAACAGACAGAACCGGG - Intergenic
900349018 1:2226437-2226459 GTGAACACACAGAGAAAGCCTGG + Intergenic
900620941 1:3587702-3587724 GTGCAGGCTCAGAGATAGCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900985411 1:6070230-6070252 TTGCAAAAACAGATAAAGCCTGG - Intronic
901154658 1:7127405-7127427 GTGCAGATGAAGAGACAGCCTGG - Intronic
901713028 1:11130585-11130607 GGGCAGCAACAGTGAGAGCGAGG - Exonic
902116050 1:14122119-14122141 GTGCTGCAACAGGGAGACCCAGG + Intergenic
902443283 1:16445280-16445302 GTGCTGAAGCTGAGAAAGCCTGG - Intronic
902541523 1:17158969-17158991 GGGAAGCAGCAGAGAGAGCCAGG - Intergenic
903999108 1:27328253-27328275 GGGCAGATACAGAGAAAGCATGG + Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
904648528 1:31986917-31986939 GTGCAGGAACTGTGTGAGCCAGG - Intergenic
904852631 1:33470472-33470494 GTGCTGAACCAGAGAGAACCTGG + Intergenic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905822085 1:41000776-41000798 GTGCAGAAAGAGAGAGATTTGGG + Intronic
906221170 1:44080531-44080553 ATTAAGACACAGAGAGAGCCTGG - Intergenic
906684874 1:47756783-47756805 GGGTGGAAACAGAGAGAGGCAGG - Intergenic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907617135 1:55937063-55937085 GTGGACCAACACAGAGAGCCTGG - Intergenic
908011574 1:59783621-59783643 GGGGAGAAACAGAAAGCGCCAGG + Intergenic
908051897 1:60242270-60242292 GTGCAGACACAGAGAGGAGCTGG - Intergenic
908248025 1:62243222-62243244 GTGCTGGATCAGGGAGAGCCAGG - Intronic
909445378 1:75743224-75743246 GTGCAGAGAGGGAGAGAGCCAGG + Intronic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
911569233 1:99502715-99502737 GGCCAGATACAGAGAGAGGCAGG + Intergenic
911824556 1:102465057-102465079 GTGAAGAAAAAGGGAGAGACGGG - Intergenic
912464723 1:109864001-109864023 TGGCAGCATCAGAGAGAGCCTGG - Intergenic
912557968 1:110529934-110529956 CTCCAGAGACAGAGACAGCCAGG - Intergenic
912670298 1:111619112-111619134 TTGCAGAAACAGTGAAAGGCCGG - Intronic
912906019 1:113708264-113708286 GACCAGAAACAGAGAGATGCAGG + Intronic
913532569 1:119743146-119743168 GTGCAGATCCAGAGACACCCTGG - Intronic
914457609 1:147850742-147850764 GTGAAGACACAGAGAGAGACAGG + Intergenic
915326047 1:155081751-155081773 ACGCAGAAACCGAGAGAGGCAGG - Intronic
915583682 1:156831529-156831551 GTGAAGAGAATGAGAGAGCCTGG + Intronic
917711175 1:177687126-177687148 ATCCAGGAACAGAGGGAGCCAGG + Intergenic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
917850855 1:179062739-179062761 ATACAGAAAGAGAGAAAGCCAGG - Intronic
918132538 1:181642404-181642426 GTGGAGAATCAGAGAGGGACTGG + Intronic
920450839 1:206059977-206059999 GTCCAGAAAAAGAGATAACCAGG - Intronic
921033081 1:211351004-211351026 GGCCAGAGACAGAGAGAGCAGGG - Intronic
921274688 1:213507342-213507364 GGGCTGAAATAGAGAGACCCTGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921938716 1:220817968-220817990 GTGCAGACATAGATAGAGTCAGG - Exonic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
923350923 1:233105955-233105977 ATGCAGAAACACACAGACCCAGG - Intronic
924954674 1:248914838-248914860 GAGCAGAGCCAGAGAGAACCAGG - Intronic
1063062705 10:2574181-2574203 TTGCAGAGACACAGAGCGCCTGG - Intergenic
1064005019 10:11692457-11692479 GAGGAGAAACAGAGAAGGCCAGG - Intergenic
1064304958 10:14157254-14157276 GTGCAGAGACAGAGAAAGAGAGG - Intronic
1064625512 10:17257676-17257698 ATACAGAGACAGAGAGAGACAGG + Intergenic
1064930229 10:20617347-20617369 GTGCAGAATCAGAGAGAAAGGGG - Intergenic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1066466698 10:35657663-35657685 GTACAGAAAGTGCGAGAGCCTGG - Intergenic
1067385412 10:45813925-45813947 GAGAAGAAAGAGAGAGGGCCAGG + Intergenic
1067449734 10:46375021-46375043 GAGAAGAAAGAGAGAGGGCCAGG - Intergenic
1067737957 10:48873463-48873485 GAGCAGAAACAGAGTCACCCTGG - Intronic
1067776079 10:49165793-49165815 GTGTCTAAACAGAGAAAGCCGGG + Exonic
1068591826 10:58860892-58860914 ATGCAGAGAGAGAGAGAGCAGGG - Intergenic
1068658778 10:59602002-59602024 GTGCACTCAGAGAGAGAGCCTGG - Intergenic
1068798260 10:61108673-61108695 GTGCACAAACAGAGATAGTGTGG + Intergenic
1070131690 10:73660281-73660303 GAGAAGAAAGAGAGAGGGCCAGG + Intronic
1070686424 10:78486925-78486947 GTGCACAAAGGGAGAGACCCAGG + Intergenic
1070803243 10:79255626-79255648 ATGCAGAGACAGAGATAGGCAGG - Intronic
1071500248 10:86198332-86198354 TTGGGGAAACAGAGAGAGCTTGG - Intronic
1072204642 10:93192376-93192398 GAGGAGAAAGAGAGAGGGCCAGG + Intergenic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072953914 10:99872339-99872361 GTTCAGGAACAGAGGCAGCCAGG + Intergenic
1073080747 10:100859104-100859126 GAGCAGAAAGAGAGAGAGTGGGG - Intergenic
1073677563 10:105665662-105665684 GTGCAGAAACCAAGTGAGCTGGG + Intergenic
1074399480 10:113129932-113129954 CTGCTGGAACAGAGAGACCCCGG - Intronic
1074449115 10:113544899-113544921 AAGCAGAAACAGACAGAGCCAGG - Intergenic
1074449327 10:113546402-113546424 AAGCGGAAACAGACAGAGCCAGG + Intergenic
1074700501 10:116087925-116087947 GTGCAGAGAAAGCCAGAGCCAGG - Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075342310 10:121657005-121657027 ATGAAGACACAGAGAGGGCCGGG - Intergenic
1075527133 10:123196429-123196451 GTGCAGGAAAGGAGAGGGCCTGG + Intergenic
1075681427 10:124335607-124335629 GTGGAGATACAGGGAGAGCATGG + Intergenic
1076057451 10:127387139-127387161 GTGCTGCCACAAAGAGAGCCCGG - Intronic
1076068154 10:127464993-127465015 GTGCAGACCCCGAGAGAGCACGG + Intergenic
1076539481 10:131205018-131205040 GTGCAGCCCCAGAAAGAGCCGGG - Intronic
1076594623 10:131617911-131617933 GTGCAGGAACACAGGGAGCCTGG + Intergenic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1078091635 11:8268025-8268047 GTGCAGACACCCAGAGAGGCTGG + Intronic
1078876632 11:15405421-15405443 GTGTAGAGAGAGAGAGAGACAGG - Intergenic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079603668 11:22341341-22341363 CTGCAGAATGTGAGAGAGCCTGG + Intronic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1080797240 11:35576099-35576121 GTGGACAAACAGAGAGACACCGG - Intergenic
1080849436 11:36055468-36055490 GTTCAGAAACAGAGGGTTCCTGG + Intronic
1081340533 11:41921986-41922008 GAGCACAAACAAAGAGGGCCTGG - Intergenic
1081613455 11:44577125-44577147 AGTCAGAAACAGAGACAGCCTGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082805443 11:57446500-57446522 GTGCCGAGACAGAAAGAACCTGG + Intergenic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1083489040 11:63001250-63001272 GAGCAGAGAGAGAGAGAGACTGG - Intronic
1084179839 11:67440766-67440788 ATGCAGAAGCAGAGAGGGCTGGG + Intronic
1084521879 11:69668312-69668334 ATGCAGAAACAGACAGAACTGGG + Intronic
1085556085 11:77422950-77422972 GTAGAAAAACAGAAAGAGCCTGG + Intronic
1085690165 11:78657940-78657962 GTGCAGAAACAAAAAGATACTGG - Exonic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1087767995 11:102177186-102177208 GTGGAGGAATAGATAGAGCCTGG + Intronic
1088363951 11:109019432-109019454 GGGGAGAAACAGAGAGTGACTGG - Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1089270972 11:117300954-117300976 GTGAAGAAATGGAGACAGCCTGG - Intronic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089802138 11:121041498-121041520 GTGCTGAAAGCCAGAGAGCCAGG - Intronic
1089961644 11:122622212-122622234 TTTAAGAAACAGAGAGAGCAGGG + Intergenic
1090392367 11:126397084-126397106 GTGCAGAGATTGAGAGATCCTGG + Intronic
1090880037 11:130825235-130825257 TTACAGAAAGAGAGAGAGCTGGG - Intergenic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1091585166 12:1811729-1811751 GGGCAGAAAGAGAGAGGGCAAGG + Intronic
1091826389 12:3515916-3515938 GAGCAGCAAAAGACAGAGCCAGG - Intronic
1091987075 12:4919289-4919311 AAGCAGAAACAGATAGAACCAGG + Intronic
1092531410 12:9348674-9348696 GTGAAGGAGCAGAGAGAGTCAGG - Intergenic
1092818925 12:12335212-12335234 GTGAAGAAACAGGGAGTGGCGGG - Intronic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1094143471 12:27204632-27204654 GTGCAGAGAGAGAGAGAACCAGG + Intergenic
1095493322 12:42759104-42759126 TGGCAGCAACAGAGAGCGCCTGG - Intergenic
1095602521 12:44029608-44029630 TTGCAGAAAGAGAGAGAGAGAGG - Intronic
1096525483 12:52207657-52207679 GAGCTGAAACAGAGAGAGAGAGG + Intergenic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1098302176 12:69065890-69065912 GTAAATAAACAGAGAGAGCCTGG - Intergenic
1099348928 12:81540038-81540060 GTGGAAAAACAGAGAGAGAGAGG + Intronic
1100289690 12:93201989-93202011 GTGCACGGACAGGGAGAGCCTGG - Intergenic
1101623473 12:106415003-106415025 GTGAAGGAACAGAAAGAGTCTGG - Intronic
1101724296 12:107376277-107376299 GTGACAAAACAGAGAAAGCCTGG - Intronic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1102905792 12:116674333-116674355 GTGAGGACACAGAGAAAGCCGGG - Intergenic
1102932413 12:116872801-116872823 AGACAGAAACAGAGAGAGACAGG + Intronic
1104251896 12:127102584-127102606 ATGCTGAACCAGAGAGAGACAGG + Intergenic
1105039331 12:132949467-132949489 GTGCATAAAGAGTGAGGGCCAGG - Intronic
1105503797 13:20993069-20993091 GTGGAGATACAGAAAGACCCCGG + Intronic
1107413045 13:40175172-40175194 ATGCAAAAGCAGAGAGAGCTTGG - Intergenic
1108602907 13:52010212-52010234 GTGGACAGACAGAGAGAGGCTGG - Intronic
1109698686 13:65995964-65995986 ATGCAGAAACTGAGAGAACTTGG + Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1112716914 13:102197450-102197472 GTAAAGAAACTGAGAGAGTCAGG - Intronic
1112806660 13:103170295-103170317 GTGCAAAAACAGACATGGCCGGG - Intergenic
1112912489 13:104505188-104505210 GGGGAGAAACAGAGAGACACAGG - Intergenic
1112977114 13:105333998-105334020 GCGCAGAAAGAGAGAGAAGCTGG - Intergenic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1115772233 14:36676480-36676502 GTGCTGAGACAGGGAGACCCGGG - Exonic
1117012516 14:51485292-51485314 GAGAAGAAACACAGAGAGACAGG - Intergenic
1118383543 14:65237201-65237223 GGGGAGAGACAGAGAGAGACAGG + Intergenic
1118479992 14:66154939-66154961 ATACAGAAAGAGAGAGAGACAGG + Intergenic
1118850358 14:69578309-69578331 CTTCAGAATCAGACAGAGCCAGG - Intergenic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118888839 14:69889878-69889900 ATTCAGAACCAGAGAGACCCTGG - Intronic
1119113938 14:72000707-72000729 TTCCAGAAAAAGAAAGAGCCAGG + Intronic
1121265616 14:92600530-92600552 GTGCAGAGACACCAAGAGCCAGG - Intronic
1121281145 14:92699429-92699451 GGGCACAAACAGAGAGAAGCAGG + Intergenic
1121526065 14:94620392-94620414 GTGCAGGAGCAGAGAGAGTGAGG + Intronic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1122020945 14:98837448-98837470 GTGGAGAAAGAGTGTGAGCCTGG - Intergenic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1122530260 14:102420410-102420432 GTGAAGAACCAGCTAGAGCCAGG - Intronic
1123219457 14:106842707-106842729 GTGCCCAAAGAGAAAGAGCCCGG + Intergenic
1124710235 15:32003696-32003718 GTGCAGAAAAACACAGAGACAGG - Intergenic
1126794353 15:52247881-52247903 GTGGAGACACAGTGTGAGCCAGG - Intronic
1126937884 15:53731391-53731413 GTGCTGATACAGAGAAATCCAGG - Intronic
1127879352 15:63142790-63142812 GTGATGAGACAGAGAGTGCCAGG + Intronic
1128889530 15:71318319-71318341 GTGGAGACAGACAGAGAGCCAGG + Intronic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1132490636 16:228826-228848 GTACAGAACCAGAGCGGGCCAGG + Intronic
1132660104 16:1057533-1057555 GGGCAGAGGCAGCGAGAGCCGGG - Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132755975 16:1485735-1485757 GAACAGAGACAGAGAGAGCCTGG - Intergenic
1132878693 16:2151549-2151571 GTTCTGAAACAGACAGAACCAGG - Exonic
1132936636 16:2484502-2484524 GTGTAGAAGCAGAGAGGCCCCGG - Intronic
1134503822 16:14789660-14789682 GGGCAGATACAGAGAGTGCCAGG + Intronic
1134576750 16:15339239-15339261 GGACAGATACAGAGAGTGCCAGG - Intergenic
1134725692 16:16417250-16417272 GGACAGATACAGAGAGTGCCAGG + Intergenic
1134810081 16:17160095-17160117 GGGCAGAAACAGAAAGATCTGGG + Intronic
1134941742 16:18294608-18294630 GGACAGATACAGAGAGTGCCAGG - Intergenic
1135978305 16:27125924-27125946 ATGCAGAGAGAGAGAGAGCGTGG - Intergenic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1137554585 16:49462514-49462536 GAGCAGAGACAGAGAGAGAGAGG + Intergenic
1137598205 16:49738676-49738698 GCGGAGAAAGTGAGAGAGCCAGG + Intronic
1137780459 16:51094028-51094050 ATTCAGAAACAGAGAGAGAGAGG + Intergenic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1139581977 16:67879186-67879208 GTGGAGGCACAGAGAGGGCCAGG + Intronic
1139648056 16:68346431-68346453 GAGCAGAAAGCGGGAGAGCCTGG + Intronic
1140066317 16:71614506-71614528 GAGCAGCCTCAGAGAGAGCCAGG + Intergenic
1140240288 16:73193781-73193803 ATGCTGAAACACAGAGAGGCAGG - Intergenic
1141622016 16:85241368-85241390 GGGCAGAGACAGAGAGGGCCTGG - Intergenic
1141644682 16:85361103-85361125 GGGCAGAGACAGACAGAGACAGG + Intergenic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1141687809 16:85580317-85580339 GTGCAGAGAGGGAGAGAGCAAGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143020586 17:3915448-3915470 GTGCAGAATCAGAGGCAGCGTGG - Intronic
1143263017 17:5614312-5614334 GTCCAGAAAAACAGAGAGCAGGG - Intronic
1143573816 17:7778042-7778064 GCGCAGAAAAAGAGAGAGGTGGG - Intronic
1143649613 17:8255473-8255495 GTGCAGACACACAGAGGGCAAGG - Intronic
1143758766 17:9085926-9085948 GTGTAGTAGCAGTGAGAGCCAGG - Intronic
1143767410 17:9146657-9146679 GTGCTGAGACAGAGTGAGGCGGG + Intronic
1144029101 17:11304008-11304030 GTGCAGAAACAGTGAGGCCTGGG - Intronic
1144056419 17:11545881-11545903 GTGCCAAAAGAAAGAGAGCCAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144336152 17:14270635-14270657 GTGCAGAAACAGAGAACAACTGG + Intergenic
1146469764 17:33114859-33114881 GTGGAAAAACTGAGAGAGGCTGG - Intronic
1147578550 17:41616268-41616290 GCAGAGAAACAGAGAGAGCAGGG + Intergenic
1148547356 17:48528561-48528583 TTGCAGGTACAGAGAGAACCCGG + Exonic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1150432768 17:65131681-65131703 GGGCAGGAGGAGAGAGAGCCAGG + Intergenic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151140735 17:71989811-71989833 GTACAGCAATAGAGAGAGACAGG - Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151906920 17:77054800-77054822 GTGAACACACAGACAGAGCCTGG + Intergenic
1152178586 17:78803586-78803608 GGGCAGACACAGAGACAGCCTGG - Exonic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152241440 17:79163362-79163384 TTGGAGAAACTGAGAGATCCCGG + Intronic
1152408469 17:80110454-80110476 CTGCAGAACCAGAGAGCGTCAGG - Intergenic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1153675440 18:7452530-7452552 GTGCAGAGAGAGCTAGAGCCGGG + Intergenic
1154168014 18:12030318-12030340 GGGGACAGACAGAGAGAGCCAGG - Intronic
1155075156 18:22348414-22348436 GAGCAGAAAGAGAGAGAGTTTGG - Intergenic
1155357387 18:24966420-24966442 GTGCAGTGATAGAAAGAGCCTGG + Intergenic
1155446258 18:25915873-25915895 GTGCAGAAAACAAGAGAGCTTGG - Intergenic
1156406649 18:36789015-36789037 GTGCAGAGACCTAGAGAGGCTGG + Intronic
1160332103 18:78003327-78003349 GTCCAGAGTCAGAGAGAACCAGG - Intergenic
1161166009 19:2787883-2787905 GTGCAGACAGAGAGACACCCTGG + Intronic
1161243228 19:3234580-3234602 GTGCAGAAGCTGAGAAACCCTGG + Intronic
1161267074 19:3369341-3369363 ATGCAGAGATAGAGAGAGACAGG - Intronic
1161501464 19:4618347-4618369 ATACAGAAGCAGAGAGACCCAGG - Intergenic
1161524872 19:4748043-4748065 ATGCAGAGAGAGAGAGAGCCAGG - Intergenic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162825329 19:13247842-13247864 GTGCAGCCACAGAGAGACCCTGG - Intronic
1162954007 19:14088583-14088605 GGACAGGAACAGAGAGAGCCGGG + Intronic
1163435894 19:17294831-17294853 GTGCAGAAAGAGACACTGCCCGG + Exonic
1163525799 19:17820762-17820784 GGCCAGAAACAGAGTGAGGCAGG - Intronic
1163638809 19:18450298-18450320 GTGCAGGAACATAGGGTGCCAGG + Intronic
1163752527 19:19086131-19086153 GTGCTAAAACAAAGAAAGCCTGG - Intronic
1164245881 19:23428503-23428525 AGACAGAAACAGAGAGAGACAGG - Intergenic
1164776995 19:30860628-30860650 GTGCAGGAACAGAGAGGGGTAGG + Intergenic
1165072335 19:33262626-33262648 GTGCAGATACAGAGAGGGGCTGG - Intergenic
1166167832 19:41004637-41004659 GGAGAGAAACACAGAGAGCCAGG + Intronic
1167566816 19:50261927-50261949 GTGCTAAAACAGAGAAAGCCCGG + Intronic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1167611959 19:50512053-50512075 CTGCAGAACTAGTGAGAGCCCGG + Intronic
1167750855 19:51379466-51379488 GTGCAGAAACTGAGAAGGTCAGG + Intergenic
1168249436 19:55133363-55133385 GTGGAGAAACAGAGAGATTCAGG + Intronic
925729707 2:6910382-6910404 GTGTAGAAAGAGAGAGAGAGAGG + Intergenic
926061676 2:9808571-9808593 GTGCAGAAAAGGAGATACCCTGG - Intergenic
926219209 2:10924045-10924067 GTGCAGAAGCAAAGAGTGCCCGG - Intergenic
926589953 2:14730000-14730022 GTGCAGAAATGGGTAGAGCCAGG - Intergenic
926910575 2:17849064-17849086 ATTCAGAAAGAGAGAGAGACAGG + Intergenic
927566534 2:24118204-24118226 GAACAGAGACATAGAGAGCCAGG - Intronic
927715287 2:25347966-25347988 GGGAAGAAAGAGAGAGAGCAGGG - Intergenic
928177456 2:29044516-29044538 GTGCTGAAATGGGGAGAGCCCGG + Intronic
928230253 2:29492543-29492565 GTGCAGAAACAGCTAGGCCCTGG - Intronic
928275861 2:29899433-29899455 GAGTAGAAAGACAGAGAGCCTGG + Intronic
929559474 2:42946777-42946799 GAGCAGAAACAGAGCAAGCGCGG + Intergenic
931995736 2:67837635-67837657 GTGAAGGCACAGAGAGAACCAGG - Intergenic
932775144 2:74524053-74524075 GTGCATATACCCAGAGAGCCTGG - Exonic
933180355 2:79219771-79219793 GAGGAGAAACAGTGAGTGCCTGG + Intronic
933250799 2:80026225-80026247 TTGCAGAAAAACAGAGAGGCCGG + Intronic
934005679 2:87760910-87760932 GAGAAGAAAAAGAGAAAGCCAGG - Intronic
934843402 2:97645904-97645926 GTGCAGAAAGAGGCAGAGCTGGG + Intergenic
935052504 2:99535827-99535849 GTGCTGGAACACAGAGAGCAGGG - Intergenic
935529574 2:104216038-104216060 GTACAGAGACAGAGAGAGGGGGG - Intergenic
937235067 2:120426189-120426211 GGACAGAGACAGAGAGAGCCAGG - Intergenic
937743263 2:125380716-125380738 GTGGAGAACCAGAGAGACCAGGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937763727 2:125635117-125635139 ATGCAGAAACAGGGATAGCCAGG - Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
941140711 2:161777623-161777645 AGGCAGAAAGAGAGAGAGCTTGG + Intronic
942311355 2:174660031-174660053 TGGGAGAAACAGAGAGATCCAGG + Intronic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
942509106 2:176677024-176677046 GTTCAGAGACAGAGGGAGCGGGG + Intergenic
942841879 2:180371804-180371826 GTGCAGAAACTCAGAGAGGCAGG - Intergenic
943642240 2:190372214-190372236 TTGCAGAGACAGGGAGAGACAGG + Intergenic
944102828 2:196046921-196046943 GTCCTGAAACAGTGAGACCCAGG + Intronic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
947416624 2:229903245-229903267 GAGCAGAAACACACAGAGCCTGG + Intronic
947420445 2:229937616-229937638 CTGCTGAAGCAGGGAGAGCCAGG - Intronic
947747616 2:232517085-232517107 GAGAAGAAAGAGGGAGAGCCTGG + Intergenic
948635959 2:239337761-239337783 TTCCAGGAACAGAGCGAGCCAGG + Intronic
948848388 2:240693894-240693916 GAGGAGAGACAGAGAGAGACAGG - Intronic
948859536 2:240746191-240746213 GACCAGAGTCAGAGAGAGCCAGG + Intronic
1169130430 20:3163992-3164014 TTGCTGAAACTGACAGAGCCTGG - Exonic
1169251424 20:4064124-4064146 ATCCAGAAACAGAGAGGGCTTGG + Intergenic
1170833153 20:19860723-19860745 GTGCTAAAACAGAGAGAGAGGGG - Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1172945980 20:38689766-38689788 TTGCAGATAAAGAGAGATCCAGG - Intergenic
1173476832 20:43365572-43365594 GTGGAGAAAGGGACAGAGCCTGG - Intergenic
1174592083 20:51654094-51654116 GTGCAGAAAGAGAGAGGGGGAGG - Intronic
1175433552 20:58926228-58926250 GTACAGGAACAGACAGAGCCTGG + Intergenic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179569200 21:42268087-42268109 GTGCAGAGACTGCCAGAGCCAGG - Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180083744 21:45498245-45498267 GAGCAGAAGCCCAGAGAGCCAGG + Intronic
1180746553 22:18093121-18093143 GTGCAGATACATACAGAGACTGG + Exonic
1180942071 22:19666052-19666074 GTGAAGACAGGGAGAGAGCCAGG + Intergenic
1181915825 22:26279133-26279155 GTGCAGTCACAGACAGAGCATGG - Intronic
1182020175 22:27075117-27075139 AGGCAGAGACAGAGAGAGACAGG + Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183356871 22:37364382-37364404 GTGCAGAGCAAGAGAGAGACTGG + Intergenic
1183392431 22:37553045-37553067 GTGTGCAAACAGTGAGAGCCAGG - Intergenic
1183480438 22:38061497-38061519 ATGAAGAGACAGAGAAAGCCGGG - Intronic
1184588220 22:45462139-45462161 GTGGAGACACACAGAGAGTCTGG + Intergenic
1184920273 22:47600841-47600863 GTGCAGAGACTGAGAGGGGCAGG - Intergenic
1184920867 22:47604865-47604887 GCACAGGAACAGAGAGAACCTGG + Intergenic
1185147851 22:49149019-49149041 GTGCAGGCAGAGAGAGAACCCGG + Intergenic
1185155279 22:49189976-49189998 GAGCAGAAGCAGTGAGTGCCAGG + Intergenic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950644946 3:14371525-14371547 ATGCAGAAACAGAGACACACAGG - Intergenic
951494982 3:23316282-23316304 GTGCAGTAGCACAGAGAACCAGG - Intronic
951987841 3:28640675-28640697 GTTCAGAAACAGAGAGGGACTGG - Intergenic
952528457 3:34238716-34238738 GGGCAGAAGCAGAGACAACCAGG + Intergenic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
953076225 3:39572959-39572981 AGGCAGAAAGAGAAAGAGCCTGG - Intergenic
953341411 3:42137254-42137276 GGGAAGAAACAGAAATAGCCTGG - Intronic
955939528 3:64134436-64134458 GTGCCGAGACTGAGAAAGCCTGG - Intronic
956458913 3:69451912-69451934 GTGCAGAAAGAGAGACAAGCAGG + Intronic
956791020 3:72680133-72680155 TTTCTGAAACAGAGAGAGCTTGG + Intergenic
956850954 3:73227917-73227939 GTACAGAAAGAGAGAGAGGGAGG - Intergenic
958489884 3:94758897-94758919 GTACAGAAGCAGAGAGAGATCGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959942148 3:112091334-112091356 GTTCAAAAACAAACAGAGCCTGG - Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
962432156 3:135329605-135329627 GTGAGGAAACAGGGAGATCCTGG - Intergenic
963322132 3:143820502-143820524 GTGCAGAAAATGAGAAGGCCTGG - Intronic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
965270448 3:166611031-166611053 ATACAGAGACAGAGAGAGACAGG + Intergenic
966815941 3:183889938-183889960 GCTCAGAAACAGAGAGGTCCTGG + Intergenic
968038564 3:195569257-195569279 ATCCAGAAACAGAAAGACCCTGG + Intronic
968537464 4:1143395-1143417 CTGCAGAAGCAGAGATATCCAGG - Intergenic
971765008 4:30819272-30819294 ATGCAGCAACACAGAGAGCCAGG - Intronic
971998133 4:33993824-33993846 GGGCAGAAAAAGAGACAGCAAGG + Intergenic
972000782 4:34029847-34029869 GAACAGAAATAAAGAGAGCCTGG + Intergenic
972134883 4:35879679-35879701 GTGCAGAGACGGAGAAAGCATGG + Intergenic
972426409 4:38937369-38937391 GTCAAGACACAGAGAGAGACTGG - Intronic
973051622 4:45606248-45606270 GTGCAAAAGGAGAGAGAACCTGG - Intergenic
973926980 4:55748739-55748761 GTAAAGAAACAGAGAGAGAGAGG + Intergenic
973958081 4:56083013-56083035 GTGCAGAATTAGAGAGAGAAGGG + Intergenic
974919059 4:68214500-68214522 GTGCAGGAACGGAGAGTGCAAGG - Intergenic
976144950 4:82033070-82033092 TTGCAGAAACAGATAGTGGCTGG - Intronic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979018437 4:115464609-115464631 GTGCAGAACCAGTTAGAGACTGG + Intergenic
979780298 4:124643626-124643648 TTGCAGACTCAGAGAAAGCCAGG - Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
982352352 4:154429600-154429622 GGGCAGAAACTGGGAGAGCTGGG - Intronic
983082679 4:163406392-163406414 GGGCACAAAGAGAAAGAGCCTGG + Intergenic
984556916 4:181225612-181225634 GAGAAGAAAAAGAGAGAGACAGG - Intergenic
984598279 4:181696831-181696853 GTGCTGAAATGCAGAGAGCCCGG - Intergenic
984863084 4:184257178-184257200 ATGAAGAAAAACAGAGAGCCTGG + Intergenic
987090478 5:14504895-14504917 GTTCAGCACCAGAGACAGCCTGG - Intronic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988778216 5:34496284-34496306 GTCCTGAAAGAGAGGGAGCCAGG - Intergenic
989156058 5:38346050-38346072 GTGCAGGAAAAGAGACAGACGGG + Intronic
989356927 5:40553939-40553961 TTACAGAAACAGAGAAAGACAGG - Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990669808 5:58115437-58115459 GGGCAGAAACAAAGAGGGCCTGG - Intergenic
992181822 5:74205022-74205044 GTAAGGAAACAGAGAGAGCAGGG - Intergenic
993474870 5:88352009-88352031 GGGCAGAAAAACAGAGAGACTGG - Intergenic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
996787899 5:127260279-127260301 GTAGAGAAACACAGAGAACCTGG - Intergenic
997105120 5:131009233-131009255 GTTCAGAGACAGAGAGGGCAGGG + Intergenic
997650785 5:135517683-135517705 GTGGAGAAAGAGAGAGAGAGTGG - Intergenic
998391730 5:141791271-141791293 GTGAAGAAAGTGGGAGAGCCCGG - Intergenic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003585889 6:7389320-7389342 GTGCAGAGGGAGGGAGAGCCAGG - Exonic
1004015878 6:11731572-11731594 GTGCAGAAAGCGTGAGAGCAAGG - Intronic
1004443940 6:15680462-15680484 GTCCAGTAAAAGAGAGATCCAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1006508467 6:34506880-34506902 GTGAAGAATGAGGGAGAGCCAGG - Intronic
1006729903 6:36228989-36229011 GAGCAGAAACAGGCAGAGGCTGG + Exonic
1007396053 6:41578483-41578505 CTGCAGCAACAGAGATGGCCTGG - Intronic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1007705866 6:43790916-43790938 GTGGAGAGACAGAGAGAGATAGG + Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008652598 6:53578144-53578166 AGGCAGAAACAGAGTTAGCCGGG - Intronic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009474459 6:64071968-64071990 TTGAAGAAACATATAGAGCCGGG + Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1011390454 6:86846808-86846830 TTGCAGAAATGGAGAGAGCAAGG - Intergenic
1011715715 6:90103274-90103296 GTGTGGGAGCAGAGAGAGCCAGG + Intronic
1012024681 6:93973540-93973562 GTGCAGACACACAGAGACACAGG + Intergenic
1014112118 6:117630055-117630077 GTGCAGAAAGTTAGAGAGCAAGG - Intergenic
1014279854 6:119429692-119429714 AGGCAGAGACAGAGAGAGGCTGG + Intergenic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1017631652 6:156401876-156401898 TTGCAGCAACAGGGAGAGTCAGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019705058 7:2493654-2493676 GAACAGAAACAGAGAGAGCAGGG - Intergenic
1019822847 7:3258652-3258674 GATCAGAAACAGAGACATCCAGG + Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1021425147 7:20491086-20491108 GAGCAGAAGAAGAGAGAGACGGG - Intergenic
1022762502 7:33370783-33370805 GTACAGAAACAGAAAGGGGCAGG - Intronic
1022955914 7:35379889-35379911 CTCCAGAAACAGGGAGAGCTGGG + Intergenic
1023138819 7:37080781-37080803 GGGCTGAAGCAGAGAGAACCAGG - Intronic
1023141916 7:37110285-37110307 GTGCAGATACAAATACAGCCAGG - Intronic
1023603216 7:41901245-41901267 TTGCAGAAAGAGAGACAGACGGG - Intergenic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1024742215 7:52366589-52366611 GTGTAGAGACAGAGAGAGACAGG - Intergenic
1024905515 7:54374561-54374583 TCCCAGAAACAGAGTGAGCCAGG - Intergenic
1025200580 7:56958926-56958948 GGGCAGAAAGAGAGGGAGACAGG + Intergenic
1025633941 7:63304949-63304971 GTGGAAAAAGAGAGAGAACCGGG - Intergenic
1025648756 7:63443219-63443241 GTGGAAAAAGAGAGAGAACCGGG + Intergenic
1025671364 7:63618006-63618028 GGGCAGAAAGAGAGGGAGACAGG - Intergenic
1026100273 7:67378574-67378596 AGGCTGAAACAGAGAGAGGCTGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027148556 7:75715944-75715966 GAGAGGGAACAGAGAGAGCCAGG + Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1029591570 7:101510537-101510559 CTGCAGAGACAGGGCGAGCCTGG + Intronic
1033280781 7:140004958-140004980 GTACAGGCACAGAGAGGGCCAGG - Intronic
1033681599 7:143600838-143600860 GTGCAGAAGGAGAGAGACACGGG + Intergenic
1033703293 7:143860975-143860997 GTGCAGAAGGAGAGAGACACGGG - Intronic
1033947808 7:146743787-146743809 TGGCAGAAACAGAAACAGCCTGG + Intronic
1034398422 7:150845710-150845732 GTGAAGATACAAAGAGCGCCTGG + Intronic
1034424748 7:151008724-151008746 GTGCAGAGAAAGAGCCAGCCGGG + Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1034896097 7:154877526-154877548 GCGGAGAGACGGAGAGAGCCTGG - Intronic
1035158663 7:156934933-156934955 TTTCAGAAAGAGAGAGGGCCAGG + Intergenic
1035533919 8:376742-376764 CAGCAGAAACAGAGAGTGTCTGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035771377 8:2149680-2149702 GTGCAGAGATAGAGAGACCCAGG + Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036121327 8:6020800-6020822 GTGCAGAATGAGACAGAGACAGG - Intergenic
1037475124 8:19249534-19249556 GTGAAGAAGCGGAGACAGCCGGG + Intergenic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1038522728 8:28247242-28247264 GGCCAGAAATCGAGAGAGCCAGG - Intergenic
1038616360 8:29099157-29099179 GGGGAGAAACAGAGAGGGCGGGG + Exonic
1038686345 8:29722049-29722071 TTTCAGAACCAGAGAGATCCAGG + Intergenic
1039635145 8:39156739-39156761 GTGCAGATACAGGGAGAGGGTGG - Intronic
1040394897 8:46988006-46988028 GTACAGAAAGTAAGAGAGCCAGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041474716 8:58250456-58250478 GGGCAGACAGAGAGAAAGCCAGG + Intergenic
1042996957 8:74711213-74711235 GTGCAGATGCACAGAGAGCCAGG - Intronic
1043692578 8:83173914-83173936 GGGCAGTAACAGACAAAGCCTGG - Intergenic
1044189206 8:89294784-89294806 GTGCAGAGAAAGAGAGAGAGAGG - Intergenic
1046240278 8:111481120-111481142 ATGCAGAGAGAGAGAGAGCATGG - Intergenic
1046320045 8:112561658-112561680 GGGAAGAAACAGAGAAAGACTGG - Intronic
1047028194 8:120847567-120847589 GTGAAGAAAGCGAGAGAGCAGGG - Intergenic
1047338330 8:123956828-123956850 GAGCAGAAAGTGAGACAGCCTGG - Intronic
1048386145 8:133914191-133914213 GTTGGGAAGCAGAGAGAGCCAGG - Intergenic
1048449190 8:134517478-134517500 GTGCTGCAACAGAGAGTTCCTGG + Intronic
1048943448 8:139423196-139423218 ATGCAGTAACAGAGAGATTCAGG + Intergenic
1049339852 8:142106261-142106283 ATGCAGAAACAGAGGGACACAGG + Intergenic
1049541112 8:143209441-143209463 CATCAGAATCAGAGAGAGCCGGG + Intergenic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1050090734 9:2015328-2015350 GTACAGAAACAGAGGGAGAGAGG - Exonic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052364617 9:27598018-27598040 GGACAGGAACAGAGAGAACCAGG - Intergenic
1052889985 9:33690038-33690060 GTGGCTCAACAGAGAGAGCCAGG - Intergenic
1053307322 9:36993971-36993993 GTGCACAAACAGAGAGGGTGGGG + Intronic
1054821661 9:69527590-69527612 GAGCACAAACAGTGAGAGCCAGG - Intronic
1054971952 9:71098390-71098412 GTGTGGAAACAGAGCAAGCCAGG + Intronic
1055092015 9:72372400-72372422 GTGAAAAAACAAAGAGTGCCCGG - Intergenic
1056157948 9:83858126-83858148 GTGCAGAGGAACAGAGAGCCAGG - Intronic
1056352599 9:85765964-85765986 GTGCAGAGGAACAGAGAGCCAGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1057177642 9:93011308-93011330 GTGCAGCAAGAGTGAGGGCCAGG + Intronic
1058407025 9:104688306-104688328 GTACAAAAAAACAGAGAGCCAGG + Intergenic
1059860508 9:118455522-118455544 GAGCAGAAAGAGAGAGAGAGAGG + Intergenic
1061275400 9:129567155-129567177 TTGCAGCAACAGAGAAAGGCTGG - Intergenic
1061632083 9:131878786-131878808 GGGCAGAATCACAAAGAGCCAGG - Intronic
1061754688 9:132804353-132804375 GAGCAGAAACAGGGGGATCCTGG + Intronic
1061889662 9:133611385-133611407 AGGCAGAAAGAGAGAGAGCCAGG + Intergenic
1061921419 9:133784517-133784539 GTGCAGAATCCGAGAGGGCCTGG + Intronic
1062262300 9:135668941-135668963 GGCCCTAAACAGAGAGAGCCTGG - Intergenic
1062324282 9:136004863-136004885 GTGCAGAATCACAAAGGGCCGGG + Intergenic
1062466981 9:136685877-136685899 TTGCAGAAACAGGGAGTTCCTGG - Intronic
1185545412 X:939879-939901 GAGGAGACACAGAGAGAGACAGG - Intergenic
1185825575 X:3245938-3245960 GTTCAGAAACAGAGAGGCTCTGG - Intergenic
1186545290 X:10442770-10442792 GTGCAGAAGTAGAGAGAACTCGG + Intergenic
1187219413 X:17309052-17309074 GTGCTGAAACGGAGAGACCAGGG - Intergenic
1187414250 X:19078894-19078916 GGGGAGAAAAAGAGAGAGGCAGG + Intronic
1189530526 X:41877167-41877189 TTGAAGAAACAGAGAGGGACGGG - Intronic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190495786 X:51027457-51027479 GTGGAGAAACAGTGAGTGTCAGG - Intergenic
1190510139 X:51166141-51166163 GTGGAGAAACAGTGAGTGTCAGG + Intergenic
1190942616 X:55056880-55056902 TTCTAGAAACAGAGAGAGGCAGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1194046131 X:89005736-89005758 ATGATGACACAGAGAGAGCCTGG + Intergenic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1197949683 X:131880978-131881000 GTGGAGAGAGAGAGAGAGACAGG + Intergenic
1198329174 X:135605879-135605901 GGACAGAGGCAGAGAGAGCCAGG - Intergenic
1198337371 X:135679700-135679722 GGACAGAGGCAGAGAGAGCCAGG + Intergenic
1198361823 X:135903114-135903136 GGTCAGAGGCAGAGAGAGCCAGG - Intronic
1200021677 X:153216605-153216627 GTGGAGTAACAGAGAGTCCCAGG + Intergenic
1200032204 X:153305964-153305986 GTGAAGAAACAGAGATGGACAGG - Intergenic
1201253617 Y:12086107-12086129 GTTCAGAAACAGAGAGACTCTGG + Intergenic