ID: 1008932442

View in Genome Browser
Species Human (GRCh38)
Location 6:56954868-56954890
Sequence GGCTGCGCACGGACGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932442_1008932455 -1 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932455 6:56954890-56954912 CCCCGGGCGCAGCCCCGCCGGGG No data
1008932442_1008932463 13 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932463 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
1008932442_1008932461 12 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932461 6:56954903-56954925 CCCGCCGGGGACGCGGCGAGTGG No data
1008932442_1008932451 -3 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932451 6:56954888-56954910 GCCCCCGGGCGCAGCCCCGCCGG No data
1008932442_1008932466 17 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932466 6:56954908-56954930 CGGGGACGCGGCGAGTGGGGAGG No data
1008932442_1008932458 5 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG No data
1008932442_1008932453 -2 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932453 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
1008932442_1008932464 14 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932442 Original CRISPR GGCTGCGCACGGACGGGGGC GGG (reversed) Intergenic