ID: 1008932450

View in Genome Browser
Species Human (GRCh38)
Location 6:56954879-56954901
Sequence CTGCGCCCGGGGGCTGCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932450_1008932464 3 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932450_1008932466 6 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932466 6:56954908-56954930 CGGGGACGCGGCGAGTGGGGAGG No data
1008932450_1008932463 2 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932463 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
1008932450_1008932461 1 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932461 6:56954903-56954925 CCCGCCGGGGACGCGGCGAGTGG No data
1008932450_1008932467 25 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932450_1008932458 -6 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932450 Original CRISPR CTGCGCCCGGGGGCTGCGCA CGG (reversed) Intergenic