ID: 1008932452

View in Genome Browser
Species Human (GRCh38)
Location 6:56954889-56954911
Sequence CCCGGCGGGGCTGCGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932452_1008932468 23 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932468 6:56954935-56954957 GCGCCGCCGCCGCGGCCGCCCGG No data
1008932452_1008932467 15 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932452_1008932463 -8 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932463 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
1008932452_1008932466 -4 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932466 6:56954908-56954930 CGGGGACGCGGCGAGTGGGGAGG No data
1008932452_1008932461 -9 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932461 6:56954903-56954925 CCCGCCGGGGACGCGGCGAGTGG No data
1008932452_1008932464 -7 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932452_1008932469 24 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932452 Original CRISPR CCCGGCGGGGCTGCGCCCGG GGG (reversed) Intergenic
No off target data available for this crispr