ID: 1008932457

View in Genome Browser
Species Human (GRCh38)
Location 6:56954892-56954914
Sequence GTCCCCGGCGGGGCTGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932457_1008932469 21 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG No data
1008932457_1008932466 -7 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932466 6:56954908-56954930 CGGGGACGCGGCGAGTGGGGAGG No data
1008932457_1008932464 -10 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932457_1008932467 12 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932457_1008932468 20 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932468 6:56954935-56954957 GCGCCGCCGCCGCGGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932457 Original CRISPR GTCCCCGGCGGGGCTGCGCC CGG (reversed) Intergenic