ID: 1008932459

View in Genome Browser
Species Human (GRCh38)
Location 6:56954902-56954924
Sequence CACTCGCCGCGTCCCCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932459_1008932469 11 Left 1008932459 6:56954902-56954924 CCCCGCCGGGGACGCGGCGAGTG No data
Right 1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG No data
1008932459_1008932468 10 Left 1008932459 6:56954902-56954924 CCCCGCCGGGGACGCGGCGAGTG No data
Right 1008932468 6:56954935-56954957 GCGCCGCCGCCGCGGCCGCCCGG No data
1008932459_1008932467 2 Left 1008932459 6:56954902-56954924 CCCCGCCGGGGACGCGGCGAGTG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932459 Original CRISPR CACTCGCCGCGTCCCCGGCG GGG (reversed) Intergenic
No off target data available for this crispr