ID: 1008932462

View in Genome Browser
Species Human (GRCh38)
Location 6:56954904-56954926
Sequence CCCACTCGCCGCGTCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932462_1008932467 0 Left 1008932462 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932462_1008932476 29 Left 1008932462 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
Right 1008932476 6:56954956-56954978 GGGCCCCGCGCATCGTCCTGCGG No data
1008932462_1008932468 8 Left 1008932462 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
Right 1008932468 6:56954935-56954957 GCGCCGCCGCCGCGGCCGCCCGG No data
1008932462_1008932469 9 Left 1008932462 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
Right 1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932462 Original CRISPR CCCACTCGCCGCGTCCCCGG CGG (reversed) Intergenic