ID: 1008932464

View in Genome Browser
Species Human (GRCh38)
Location 6:56954905-56954927
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932454_1008932464 -8 Left 1008932454 6:56954890-56954912 CCCCGGGCGCAGCCCCGCCGGGG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932435_1008932464 29 Left 1008932435 6:56954853-56954875 CCCTCCCCAGGCGCCCCCGCCCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932440_1008932464 16 Left 1008932440 6:56954866-56954888 CCCCCGCCCCCGTCCGTGCGCAG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932436_1008932464 28 Left 1008932436 6:56954854-56954876 CCTCCCCAGGCGCCCCCGCCCCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932442_1008932464 14 Left 1008932442 6:56954868-56954890 CCCGCCCCCGTCCGTGCGCAGCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932443_1008932464 13 Left 1008932443 6:56954869-56954891 CCGCCCCCGTCCGTGCGCAGCCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932457_1008932464 -10 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932438_1008932464 24 Left 1008932438 6:56954858-56954880 CCCAGGCGCCCCCGCCCCCGTCC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932447_1008932464 8 Left 1008932447 6:56954874-56954896 CCCGTCCGTGCGCAGCCCCCGGG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932445_1008932464 9 Left 1008932445 6:56954873-56954895 CCCCGTCCGTGCGCAGCCCCCGG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932452_1008932464 -7 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932444_1008932464 10 Left 1008932444 6:56954872-56954894 CCCCCGTCCGTGCGCAGCCCCCG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932456_1008932464 -9 Left 1008932456 6:56954891-56954913 CCCGGGCGCAGCCCCGCCGGGGA No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932437_1008932464 25 Left 1008932437 6:56954857-56954879 CCCCAGGCGCCCCCGCCCCCGTC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932441_1008932464 15 Left 1008932441 6:56954867-56954889 CCCCGCCCCCGTCCGTGCGCAGC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932449_1008932464 7 Left 1008932449 6:56954875-56954897 CCGTCCGTGCGCAGCCCCCGGGC No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932450_1008932464 3 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data
1008932439_1008932464 23 Left 1008932439 6:56954859-56954881 CCAGGCGCCCCCGCCCCCGTCCG No data
Right 1008932464 6:56954905-56954927 CGCCGGGGACGCGGCGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932464 Original CRISPR CGCCGGGGACGCGGCGAGTG GGG Intergenic