ID: 1008932465

View in Genome Browser
Species Human (GRCh38)
Location 6:56954907-56954929
Sequence CTCCCCACTCGCCGCGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932465_1008932476 26 Left 1008932465 6:56954907-56954929 CCGGGGACGCGGCGAGTGGGGAG No data
Right 1008932476 6:56954956-56954978 GGGCCCCGCGCATCGTCCTGCGG No data
1008932465_1008932468 5 Left 1008932465 6:56954907-56954929 CCGGGGACGCGGCGAGTGGGGAG No data
Right 1008932468 6:56954935-56954957 GCGCCGCCGCCGCGGCCGCCCGG No data
1008932465_1008932469 6 Left 1008932465 6:56954907-56954929 CCGGGGACGCGGCGAGTGGGGAG No data
Right 1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG No data
1008932465_1008932467 -3 Left 1008932465 6:56954907-56954929 CCGGGGACGCGGCGAGTGGGGAG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932465 Original CRISPR CTCCCCACTCGCCGCGTCCC CGG (reversed) Intergenic
No off target data available for this crispr