ID: 1008932467

View in Genome Browser
Species Human (GRCh38)
Location 6:56954927-56954949
Sequence GAGGAGCAGCGCCGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932465_1008932467 -3 Left 1008932465 6:56954907-56954929 CCGGGGACGCGGCGAGTGGGGAG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932452_1008932467 15 Left 1008932452 6:56954889-56954911 CCCCCGGGCGCAGCCCCGCCGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932454_1008932467 14 Left 1008932454 6:56954890-56954912 CCCCGGGCGCAGCCCCGCCGGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932450_1008932467 25 Left 1008932450 6:56954879-56954901 CCGTGCGCAGCCCCCGGGCGCAG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932456_1008932467 13 Left 1008932456 6:56954891-56954913 CCCGGGCGCAGCCCCGCCGGGGA No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932447_1008932467 30 Left 1008932447 6:56954874-56954896 CCCGTCCGTGCGCAGCCCCCGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932457_1008932467 12 Left 1008932457 6:56954892-56954914 CCGGGCGCAGCCCCGCCGGGGAC No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932460_1008932467 1 Left 1008932460 6:56954903-56954925 CCCGCCGGGGACGCGGCGAGTGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932449_1008932467 29 Left 1008932449 6:56954875-56954897 CCGTCCGTGCGCAGCCCCCGGGC No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932462_1008932467 0 Left 1008932462 6:56954904-56954926 CCGCCGGGGACGCGGCGAGTGGG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data
1008932459_1008932467 2 Left 1008932459 6:56954902-56954924 CCCCGCCGGGGACGCGGCGAGTG No data
Right 1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932467 Original CRISPR GAGGAGCAGCGCCGCCGCCG CGG Intergenic
No off target data available for this crispr