ID: 1008932475

View in Genome Browser
Species Human (GRCh38)
Location 6:56954954-56954976
Sequence GCAGGACGATGCGCGGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008932475_1008932485 11 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932485 6:56954988-56955010 ACCTCAGCATCCCAGAAGCCGGG No data
1008932475_1008932487 20 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932487 6:56954997-56955019 TCCCAGAAGCCGGGCGCACGTGG No data
1008932475_1008932492 26 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932492 6:56955003-56955025 AAGCCGGGCGCACGTGGGTCGGG No data
1008932475_1008932484 10 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932484 6:56954987-56955009 GACCTCAGCATCCCAGAAGCCGG No data
1008932475_1008932489 21 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932489 6:56954998-56955020 CCCAGAAGCCGGGCGCACGTGGG No data
1008932475_1008932491 25 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932491 6:56955002-56955024 GAAGCCGGGCGCACGTGGGTCGG No data
1008932475_1008932493 27 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932493 6:56955004-56955026 AGCCGGGCGCACGTGGGTCGGGG No data
1008932475_1008932495 30 Left 1008932475 6:56954954-56954976 CCGGGCCCCGCGCATCGTCCTGC No data
Right 1008932495 6:56955007-56955029 CGGGCGCACGTGGGTCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008932475 Original CRISPR GCAGGACGATGCGCGGGGCC CGG (reversed) Intergenic