ID: 1008942739

View in Genome Browser
Species Human (GRCh38)
Location 6:57064742-57064764
Sequence CTGGCAGATGTGGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008942734_1008942739 9 Left 1008942734 6:57064710-57064732 CCTTCTATTTATTGTCATAGAGA No data
Right 1008942739 6:57064742-57064764 CTGGCAGATGTGGCTTTTCTGGG No data
1008942733_1008942739 16 Left 1008942733 6:57064703-57064725 CCAAAAGCCTTCTATTTATTGTC No data
Right 1008942739 6:57064742-57064764 CTGGCAGATGTGGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008942739 Original CRISPR CTGGCAGATGTGGCTTTTCT GGG Intergenic
No off target data available for this crispr