ID: 1008942762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:57064978-57065000 |
| Sequence | GAGCTTCAGCAGAAGTCATG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008942762_1008942765 | 20 | Left | 1008942762 | 6:57064978-57065000 | CCTCATGACTTCTGCTGAAGCTC | No data | ||
| Right | 1008942765 | 6:57065021-57065043 | CACTCAGTTGTTAGATTTTTGGG | No data | ||||
| 1008942762_1008942764 | 19 | Left | 1008942762 | 6:57064978-57065000 | CCTCATGACTTCTGCTGAAGCTC | No data | ||
| Right | 1008942764 | 6:57065020-57065042 | TCACTCAGTTGTTAGATTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008942762 | Original CRISPR | GAGCTTCAGCAGAAGTCATG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||