ID: 1008942762

View in Genome Browser
Species Human (GRCh38)
Location 6:57064978-57065000
Sequence GAGCTTCAGCAGAAGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008942762_1008942765 20 Left 1008942762 6:57064978-57065000 CCTCATGACTTCTGCTGAAGCTC No data
Right 1008942765 6:57065021-57065043 CACTCAGTTGTTAGATTTTTGGG No data
1008942762_1008942764 19 Left 1008942762 6:57064978-57065000 CCTCATGACTTCTGCTGAAGCTC No data
Right 1008942764 6:57065020-57065042 TCACTCAGTTGTTAGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008942762 Original CRISPR GAGCTTCAGCAGAAGTCATG AGG (reversed) Intergenic
No off target data available for this crispr