ID: 1008945197

View in Genome Browser
Species Human (GRCh38)
Location 6:57089811-57089833
Sequence GTATTTGTTTGGTTTTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1186
Summary {0: 1, 1: 0, 2: 6, 3: 119, 4: 1060}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008945197 Original CRISPR GTATTTGTTTGGTTTTGGTA TGG (reversed) Intronic
901339897 1:8487564-8487586 GTATTTGTTTGTTTTGAGAAAGG - Intronic
901753088 1:11423791-11423813 GTTTTTGTTTGTTTTTGAGAAGG - Intergenic
901826874 1:11867726-11867748 ATTTTTGTTTTGTTTTGTTATGG - Intergenic
901883157 1:12205624-12205646 GTTTTTGTTTGTTTTTGAGATGG + Intronic
903097360 1:20990167-20990189 TTATTTGTTTGTTTTTGAGATGG - Intronic
903424880 1:23246161-23246183 TTATTTGTTTGTTTTTGAGACGG - Intergenic
903513601 1:23894878-23894900 GTATTTGTTTGGAGATGGGAGGG - Intronic
903581710 1:24376023-24376045 GTTTTTGTTTTGTTTTGAGATGG + Intronic
903605693 1:24573588-24573610 GTTTTTGTTTCTTTTTTGTAGGG - Intronic
904090880 1:27944351-27944373 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
904297536 1:29530839-29530861 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
904573660 1:31487400-31487422 ATATTTGTTTTGTTTTCGTGTGG - Intergenic
904664714 1:32110879-32110901 TTATTTGTTTGTTTTTGAGAGGG - Intronic
904743018 1:32693085-32693107 GTTTTTGTTTGTTTTTGAGATGG + Intronic
905054905 1:35085033-35085055 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
905973660 1:42159552-42159574 TTGTTTGTTTGTTTTTGGCAGGG + Intergenic
906043767 1:42811132-42811154 GTTTTTGTTTTGTTTTGAGACGG - Intronic
906335467 1:44926263-44926285 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
906349677 1:45047496-45047518 TTTTTTGTTTTGTTTTGGTATGG + Intronic
906503438 1:46359253-46359275 TTGTTTGTTTGTTTTTGGGATGG - Intronic
906630622 1:47364296-47364318 TTGTTTGTTTTGTTTTGGTTTGG + Intronic
907019181 1:51048820-51048842 GAAGTTTTTTGGTTTTTGTAAGG - Intergenic
907031491 1:51176791-51176813 TTATTTGTTTGTTTTTGAGATGG + Intergenic
907671253 1:56476851-56476873 GTGTTTGTTTGTTTTTGAGAAGG - Intergenic
907883520 1:58572970-58572992 TTGTTTGTTTGTTTTTGGTGGGG + Intergenic
908089764 1:60673771-60673793 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
908185898 1:61653143-61653165 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
908224624 1:62043706-62043728 TTTTTTGTTTGGTTTTGGTTTGG + Intronic
908623066 1:66007456-66007478 TCATTTGTTTGGTTTTGGTTGGG - Intronic
909183230 1:72450664-72450686 TTATTTGTTTGTTTTTGAGATGG - Intergenic
909590370 1:77341888-77341910 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
909886868 1:80952360-80952382 GTTTTGTTTTGGTTTTGGTAGGG - Intergenic
910565924 1:88642908-88642930 GTGTTTGTTTTGGTTTGGTTTGG + Intergenic
910724037 1:90319728-90319750 CTTTTTGTCTGGTTTTAGTATGG + Intergenic
910969960 1:92845993-92846015 TTATTTGTTTTGTTTTGTTTTGG - Intronic
910999100 1:93143823-93143845 GAATTTAATTGGTTTTAGTAGGG + Intergenic
911869019 1:103068108-103068130 GTCTTTGTCAGGTTTTGATAGGG - Intronic
912297436 1:108484190-108484212 GTTTTTGTGTGGTTTTGGGAGGG - Intergenic
912425008 1:109580004-109580026 GTATTTTTTTTGTTTTGAGACGG + Intronic
912912501 1:113776382-113776404 AGTTTTGTTTGGTTTTGGTTTGG + Intronic
913220079 1:116652992-116653014 GTTTTTGTTTGCTTTTGGCATGG - Intronic
913354444 1:117903154-117903176 GTGTTTGTTTGGTTTTTTTTTGG + Intronic
914264303 1:146024984-146025006 TTGTTTGTTTGTTTTTGGTATGG - Intergenic
915297869 1:154934306-154934328 TTCTTTGTTTTGTTTTGGTTTGG + Intronic
915810265 1:158901585-158901607 GTTTTTGTTTGTTTTTGTTAAGG - Intergenic
916037675 1:160935463-160935485 TTTTTTGTTTTGTTTTGATATGG - Intergenic
916277281 1:163008417-163008439 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
916360866 1:163966751-163966773 GTCTTTGTCTGGTTTTGGTCAGG - Intergenic
916814641 1:168339505-168339527 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
917344971 1:174021002-174021024 GTTTTTGTTTTGTTTTGCGACGG - Intronic
917439456 1:175054244-175054266 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
917546304 1:175972339-175972361 GTATTTTTCTGCTTTTGGTCAGG + Intronic
917561339 1:176160218-176160240 GTAATTATCTGCTTTTGGTATGG + Intronic
918232142 1:182545694-182545716 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
918343835 1:183589477-183589499 TTTTTTGATTGGTTGTGGTAAGG - Intronic
918438945 1:184546428-184546450 TTTTTTGTTTGGTTTTGAGATGG - Intronic
918452021 1:184668127-184668149 GTTTTTGTTTGGTTTTGAGATGG - Intergenic
918530688 1:185517845-185517867 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
918662746 1:187109204-187109226 TTATTTCTTTGCTTTTGTTATGG + Intergenic
919574767 1:199294286-199294308 GTTTTTGTTTTGTTTTGTTTGGG + Intergenic
919968027 1:202548949-202548971 TTATTTTCTTGGTTTTGGCAGGG - Intronic
920591123 1:207220216-207220238 GCTTTTGTTTTGCTTTGGTAAGG + Intergenic
921082774 1:211756244-211756266 GGATTTTTTTTGTTTTGGTTTGG - Intronic
921424686 1:214987994-214988016 TTATTTGTTTGGTTTTTCTGGGG - Intergenic
921558818 1:216631964-216631986 GTGTTTATTTGCTTATGGTACGG - Intronic
921563597 1:216688499-216688521 ATTTTTGTTTTGTTTTTGTATGG - Intronic
921758615 1:218886547-218886569 TTATTTTTTTGGTTTTATTAGGG + Intergenic
921803048 1:219423401-219423423 GAATGTGTTTCGTTTTGCTATGG + Intergenic
923133315 1:231096129-231096151 GTATTTTTTTGGTTTATGTTTGG + Intergenic
923317752 1:232797590-232797612 TTTTTTGTTTTGTTTTGGGATGG - Intergenic
923344066 1:233034204-233034226 TTGTTTGTTTGTTTTTGGGACGG - Intronic
923677236 1:236090579-236090601 TTTTTTTTTTGGTTTTGGTGGGG - Intergenic
923978419 1:239292034-239292056 TTATGTGTGTGTTTTTGGTAGGG - Intergenic
924015354 1:239715341-239715363 TTATTTGTTTTGTTTTGAGAAGG + Intronic
924273170 1:242356046-242356068 GTATTTGGTTGTTGTTGGTTTGG + Intronic
924393289 1:243587442-243587464 ATTTTTGTGTGCTTTTGGTAGGG - Intronic
924534630 1:244924272-244924294 GTATTTGTTTCTTTTTGAGAAGG + Intergenic
1062979445 10:1709789-1709811 GTAGTTGTCTGGTTGAGGTAAGG - Intronic
1063787059 10:9396789-9396811 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1063856612 10:10261631-10261653 GTTTTTGTTTTGTTTTGACATGG + Intergenic
1064275994 10:13905378-13905400 TTCTTTGTGTGGTTTTGGGAAGG + Intronic
1064291201 10:14035405-14035427 TTATTTGTTTGTTTTTGAGATGG - Intronic
1064299720 10:14112690-14112712 TAATTTTTGTGGTTTTGGTACGG + Intronic
1064569528 10:16678159-16678181 GGGTTTGTTTTGTTTTGTTAGGG - Intronic
1064680134 10:17802904-17802926 GTTTTGCTATGGTTTTGGTAAGG + Intergenic
1064739497 10:18418078-18418100 TTATTTGTTTGTTTTTGAGATGG + Intronic
1065300010 10:24312611-24312633 TTTTTTGTTTGGTTTTGAAATGG - Intronic
1065413073 10:25452005-25452027 CTTTTTGTTTTGTTTTGGTTTGG + Intronic
1065475164 10:26128677-26128699 GTTTTTGTTTGTTTTTACTATGG - Intronic
1065574769 10:27106065-27106087 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1066128715 10:32368541-32368563 TTGTTTGTTTTGTTTTGGTTTGG + Intronic
1066185559 10:33007110-33007132 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1066240234 10:33526638-33526660 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1066711549 10:38240604-38240626 GTATTTGGTTGTTGTTGGTTTGG - Intergenic
1067176204 10:43948599-43948621 GTTTTTTTTTTTTTTTGGTATGG + Intergenic
1067397832 10:45939677-45939699 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1067543514 10:47175316-47175338 GTATCTGTTTGATTTTCCTATGG + Intergenic
1067859445 10:49829653-49829675 GTCTTTGTTTTGTTTTGTTGGGG - Intronic
1067866152 10:49908771-49908793 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1067894434 10:50163674-50163696 ATATTTGTTTCTTATTGGTAAGG + Intergenic
1067954409 10:50776587-50776609 ATATTTGTTTCTTATTGGTAAGG - Intronic
1068271901 10:54738573-54738595 ATGTTTGTCTGGTTTTGGTATGG - Intronic
1068341828 10:55714228-55714250 GTATTATTTTAGATTTGGTAAGG - Intergenic
1068470394 10:57454617-57454639 GTATTTGTCTGTTTTTGTCAAGG + Intergenic
1068783020 10:60942766-60942788 GTGTTTGTTTGGTCTTAGCAAGG - Intronic
1069281630 10:66661637-66661659 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1070230617 10:74562940-74562962 GTGTTTGTTTTATTTTGGTTTGG + Intronic
1070230619 10:74562951-74562973 ATTTTGGTTTGGTTTTGGTTTGG + Intronic
1070298185 10:75183168-75183190 GTTTTTGTTTTGTTTTGAGACGG + Intergenic
1070394621 10:76001228-76001250 GTGTTTGTTGTGTTTTGCTAGGG - Intronic
1070830407 10:79414802-79414824 GGTTTTTTTTGGTTTTGGTTTGG - Intronic
1070872351 10:79767579-79767601 TCATTTGTTTGTTTTTGGTTAGG - Intergenic
1070973951 10:80589963-80589985 GGATTTGTTTTATTTGGGTATGG + Intronic
1071321123 10:84459513-84459535 GTTTTGGTTTGGTTTTGGGGGGG + Intronic
1071639272 10:87289750-87289772 TCATTTGTTTGTTTTTGGTTAGG - Intergenic
1071655965 10:87448199-87448221 TCATTTGTTTGTTTTTGGTTAGG + Intergenic
1071827628 10:89340977-89340999 GTAATTGTGTGGTTTGTGTATGG + Intronic
1071866955 10:89745516-89745538 TTATTTGTTTGTTTTTGAGATGG - Intronic
1073827961 10:107347763-107347785 GTTTTTGTTTTTTTTTGGAACGG + Intergenic
1073915540 10:108398801-108398823 ATTTTAGTTTGGTTTTGGTTTGG + Intergenic
1074218005 10:111406957-111406979 GTATTTGTTTTATTTTGAGAAGG - Intergenic
1074243191 10:111659832-111659854 GTAGTTGTTTGGTGTTTGTGTGG - Intergenic
1074323380 10:112423962-112423984 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1074325708 10:112448594-112448616 ATTTTTGTTTAGTTTTGTTAGGG + Intronic
1074472605 10:113741127-113741149 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1074614671 10:115055898-115055920 ATATTTGTTTTGTTTTGAGAAGG + Intergenic
1075036305 10:119071263-119071285 TTATGTCTTTGGTTTTGTTAGGG - Intronic
1075335098 10:121603049-121603071 GTTTTTGTTTTGGTTTGGTTCGG + Intergenic
1075840912 10:125502395-125502417 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
1075997712 10:126892010-126892032 GTATGTGTGTGGTTTTGGTGTGG - Intergenic
1076650572 10:131984017-131984039 GTATTTGTTTGCTTTTACTTGGG - Intergenic
1077387042 11:2274788-2274810 GTTTTTGTTTGTTTTTGAGACGG + Intergenic
1077765176 11:5151360-5151382 TTTTTTGTTTTGTTTTGATATGG + Exonic
1078157675 11:8812817-8812839 TTTTTTGTTTGTTTTTGGTGAGG - Intronic
1078723596 11:13906944-13906966 GTTTTGGTTTGGTTTGGGTTGGG - Intergenic
1078786008 11:14493140-14493162 GTTTTTGTTTTGTTTTGAGATGG - Intronic
1078805671 11:14699115-14699137 TTATTTGTTCAGTTTTGGAATGG - Intronic
1078917450 11:15793162-15793184 GTTTTTGTTTTGTTTTGTTATGG + Intergenic
1078934995 11:15942163-15942185 GTATTTGTTTGGTGTTCATTTGG - Intergenic
1079006988 11:16798441-16798463 GTATCTATTTGCTTTTGGGAGGG + Intronic
1079030142 11:16980588-16980610 GTTTTTGTTTGGTTTGGTTTGGG + Intronic
1079051143 11:17160820-17160842 GTTTTGGTTTGGTTTTGTTAAGG - Intronic
1079051144 11:17160831-17160853 TTGTTTGTTTTGTTTTGGTTTGG - Intronic
1079395017 11:20054557-20054579 TTATTTGGTTGATATTGGTAGGG + Intronic
1079424111 11:20324147-20324169 TTATTTGTTTGGTTTTGAGACGG + Intergenic
1079552798 11:21721288-21721310 GTGTGTGTATGTTTTTGGTAAGG + Intergenic
1079694072 11:23456635-23456657 GTTTTTGTTTGTTTTTGAGACGG - Intergenic
1079703758 11:23587016-23587038 GTATGTGTGTGTTTTTGGAAAGG + Intergenic
1079751512 11:24204910-24204932 GTTTTTTTTTGGTTTGGGTTTGG + Intergenic
1080569051 11:33539656-33539678 CTTTTTGTTTTGTTTTGCTATGG + Intergenic
1081292392 11:41342708-41342730 ATATTTGTTTGTTTTTGAGATGG - Intronic
1082614514 11:55342092-55342114 GTATTTTTTTGTTTTTAGTCTGG + Intergenic
1082838041 11:57666197-57666219 GTTTTTGTTTTGTTTTGAGACGG + Intergenic
1082994206 11:59236417-59236439 ATAGTTGTTTGGTTTTGAGAGGG - Intergenic
1083576913 11:63798584-63798606 TTTTTTGTTTGTTTTTGATATGG + Intergenic
1083906077 11:65671716-65671738 GTATCTGTTTGGTTCTGTTCTGG + Intergenic
1083971748 11:66081424-66081446 TTGTTTGTTTTGTTTTGGTTGGG - Intronic
1084017830 11:66396840-66396862 GGTTTTATTTGGTTTTGGTGGGG + Intergenic
1084696573 11:70759179-70759201 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1084986669 11:72880050-72880072 GTTTTTGTCTTGTTTTGGTTTGG - Intronic
1085092911 11:73734128-73734150 GTTTTTGTTTGTTTTTGAGACGG + Intronic
1085714553 11:78860913-78860935 GGTTTTGTTTTGTTTTTGTAAGG - Intronic
1086201387 11:84206860-84206882 GTATTTGTTTGTTTTAGATTTGG - Intronic
1086214067 11:84356145-84356167 GTTTGTTTTTGGTTTTGGTGGGG + Intronic
1086390230 11:86356161-86356183 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1086929589 11:92678180-92678202 ATGTTTGATTGGTTTTGGGAGGG + Intronic
1087097628 11:94334848-94334870 TTGTTTGTTTGTTTTTGCTATGG + Intergenic
1087384564 11:97453969-97453991 ATATTTGCTTGGATTTTGTATGG + Intergenic
1087408060 11:97754226-97754248 GTTTTTGTTTGTTTTTGATATGG + Intergenic
1087792136 11:102417410-102417432 GTATTTGTATGTTTGTGGTGGGG - Intronic
1088043459 11:105418069-105418091 TGTTTTGTTTGGTTTTGGTTTGG + Intergenic
1088189134 11:107207312-107207334 TTTTTTGTTTTGTTTTGGTGAGG - Intergenic
1088273759 11:108062843-108062865 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1088651318 11:111959912-111959934 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1088864477 11:113834572-113834594 GCTTTTGTTTTGTTTTGGTTTGG + Intronic
1089156791 11:116408926-116408948 TTGTTTGTTTGTTTTTTGTAGGG + Intergenic
1089737313 11:120558598-120558620 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1089920092 11:122201444-122201466 TTGTTTGTTTGTTTTTGGTCTGG - Intergenic
1090360394 11:126168463-126168485 TTATTTGTTTGGTTTTGAGAAGG + Intergenic
1090741438 11:129664909-129664931 GTCTTTGTCTAGTTTTGGTCAGG + Intergenic
1091162562 11:133438640-133438662 GTATGTCTTTGGTTTTAGTGAGG + Intronic
1091333002 11:134745285-134745307 TCATTTGTTTGTTTTTGGTGGGG + Intergenic
1091425568 12:385513-385535 GAGTTTGTTTTGTTTTGGTTTGG - Intronic
1091474277 12:755967-755989 GTTTTTGTTTGTTTTTGAGACGG - Intronic
1091537042 12:1420899-1420921 TTGTTTGTTTGGTTTTGGTTTGG + Intronic
1091847027 12:3665000-3665022 GTGTTTGTTTGTTTTTGAGACGG - Intronic
1091884656 12:4007559-4007581 GTGTTTGTTTTGTTTTGAGATGG + Intergenic
1092258964 12:6942274-6942296 TTGTTTGGTTGGTTTTGGTTGGG - Exonic
1093323898 12:17749034-17749056 TTATATGTTTGGTATTAGTATGG - Intergenic
1093410559 12:18860299-18860321 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
1093468258 12:19473248-19473270 GTATTTGTTTGCTTATGGAAAGG + Exonic
1093479726 12:19592093-19592115 TTATTGTTTTGGTTTTGGTCTGG - Intronic
1093500392 12:19805699-19805721 GTATTTGTTTCTTTTTTGTTGGG - Intergenic
1093535022 12:20212578-20212600 GTGTTTGTTTGCTTTTGGTGGGG - Intergenic
1094046680 12:26174919-26174941 TTTTTTGTTTGTTTTTGGTCTGG + Intronic
1094073450 12:26445887-26445909 GTGTTTGTTTGGTTTTGAAAGGG + Intronic
1094247307 12:28313670-28313692 GTATTTATTTCCTTTTGTTATGG - Intronic
1095337432 12:41045779-41045801 TTATTTATTTTGTTTTGGTCTGG - Intronic
1095354477 12:41255436-41255458 GTTTTGTTTTGTTTTTGGTAAGG + Intronic
1095800500 12:46267202-46267224 GTATTTATTTGCGTTTGGAAGGG - Intronic
1095899664 12:47314913-47314935 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1096245985 12:49986799-49986821 GCTTTTGTTTTGTTATGGTAGGG - Intronic
1096370079 12:51062041-51062063 GTTTTTGCTTGGTTTTAGTTTGG - Exonic
1097309055 12:58098748-58098770 TTATTTGTTTGATTGGGGTAGGG - Intergenic
1097459695 12:59845786-59845808 CTTTTTGTTTTGTTTTGCTAGGG - Intergenic
1097629752 12:62045758-62045780 TAATTTGATTGATTTTGGTAAGG - Intronic
1097964497 12:65564471-65564493 GTAGTGGTATGGTTTTGGGAAGG - Intergenic
1098569196 12:71969396-71969418 GTATTTCTTTGAATTTGTTATGG - Intronic
1098661906 12:73105298-73105320 ATTTTTGTTTGATTTTTGTAAGG - Intergenic
1098984323 12:76994732-76994754 GTTTTGTTTTGGTTTTGCTATGG - Intergenic
1099053594 12:77810174-77810196 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
1099122044 12:78702671-78702693 TGTTTTGTTTGGTTTTGGTTTGG - Intergenic
1099125571 12:78752353-78752375 TTATTTGTTTGTTTTTGAGATGG - Intergenic
1099272348 12:80526378-80526400 CTATTAGTGTGGTTTTTGTATGG + Intronic
1099276494 12:80582846-80582868 GTTTTTGTTTTGTTTTGACAAGG - Intronic
1099449373 12:82790393-82790415 TAATTTGTTTGGCTTTGGTTTGG + Intronic
1099468254 12:83014343-83014365 GTTTTTGTTTTGTTTTGAGATGG + Intronic
1099474328 12:83089558-83089580 CTATTTGTTTGGTTTAGTTTCGG - Intronic
1099545849 12:83978527-83978549 GTTTTTTTCTGTTTTTGGTAGGG + Intergenic
1099587793 12:84543808-84543830 GTATTTGGTTTGTGTTTGTATGG + Intergenic
1099614152 12:84913079-84913101 GAATTTGTTTTGTTTTGCTTTGG - Intronic
1099671971 12:85706001-85706023 GTTTTTGTTTGGTTTGGTTTTGG + Intergenic
1100118366 12:91337940-91337962 GTTTTTGTTTTGTTTTGATTTGG - Intergenic
1100184178 12:92121070-92121092 CTATTTGTTTTGTTTTGTTTTGG + Intronic
1100186752 12:92146949-92146971 GTTTTTTTTTTTTTTTGGTAGGG - Intergenic
1100264551 12:92962863-92962885 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1100273363 12:93047473-93047495 GTCGTTGATTGGTTTAGGTATGG - Intergenic
1100633811 12:96415015-96415037 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1100794330 12:98164394-98164416 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1100949288 12:99827890-99827912 GTATTTGTATGTTATTTGTATGG - Intronic
1101049197 12:100843541-100843563 GTGCTTGTTTGATATTGGTAAGG - Intronic
1101359864 12:104015990-104016012 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1101425413 12:104584059-104584081 ATAATTGTTTGGTTTTTGTTGGG + Intronic
1101758629 12:107641184-107641206 GTTTGTGTTTGGTTTTGGTGGGG - Intronic
1102289722 12:111689367-111689389 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1103259684 12:119575788-119575810 GTTTTGTTTTGGTTTTTGTAAGG + Intergenic
1103424313 12:120818640-120818662 GTAGTTGCTTGGTTTTGGGGTGG - Intronic
1103660260 12:122508950-122508972 GTTTTTTTTTTGTTTTGATACGG - Intronic
1105050569 12:133046664-133046686 GTATTGGTTTGTTTTTGAGATGG + Intronic
1105266167 13:18818051-18818073 TTTTTTGTTTTGTTTTTGTATGG - Intergenic
1105489868 13:20877718-20877740 ATATTTGTTTGGATTAGGTTTGG - Intronic
1106330895 13:28738678-28738700 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1106379015 13:29218118-29218140 GTTTTGGTTTGGTTTTGGCGGGG - Intronic
1107003234 13:35576100-35576122 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1107109541 13:36681487-36681509 GTTTTTGTTTCATTTTGGTTTGG + Intronic
1107187406 13:37540177-37540199 ATTTTTGTTTTGTTTTGTTAAGG - Intergenic
1107291856 13:38863818-38863840 TTATTTTTTTGTTTTTTGTAGGG + Intronic
1107504699 13:41021877-41021899 GTTTTTGTTTTGTTTTGTTGTGG - Intronic
1107905205 13:45055108-45055130 GTATTTTTTTTTTTTTGATAGGG - Intergenic
1108088104 13:46817369-46817391 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1108289555 13:48945208-48945230 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1108537936 13:51405557-51405579 GTTTTTGTTTTGTTTTGGCTTGG + Intronic
1109491370 13:63104832-63104854 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1109625445 13:64967900-64967922 GTTGTTGTTTGGTTTTGAGACGG - Intergenic
1109665825 13:65535176-65535198 ATTTTTGTCTGGTTTTAGTATGG + Intergenic
1109811837 13:67523097-67523119 GTATTTGTGTGTTTTTGTTTTGG - Intergenic
1109895999 13:68691121-68691143 GTTTTTGTTTGGGTTGGGTTTGG - Intergenic
1110296576 13:73873430-73873452 TTTTTTGTTTAGTTTTGGTATGG + Intronic
1110629347 13:77689209-77689231 TTCTTTGTTTGTTTTTAGTAAGG - Intergenic
1110883303 13:80600268-80600290 GTTTTTGTTTGGATTTGCTGTGG + Intergenic
1110883968 13:80609140-80609162 TTATTTGTTTGTTTTTGAGATGG - Intergenic
1111142551 13:84139350-84139372 ACATTTGTATGGTTTTGTTAGGG + Intergenic
1111163748 13:84429948-84429970 GTATTTGGTTGGTTTTCTAAGGG - Intergenic
1111326811 13:86708724-86708746 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1111585638 13:90280480-90280502 GTATTTATTTGTTTTGGGAATGG - Intergenic
1111754124 13:92371160-92371182 CTTTTTGTTTTGTTTTGGTTTGG - Intronic
1111799257 13:92961534-92961556 GTATTTCATTGCTTTGGGTATGG + Intergenic
1112115109 13:96343745-96343767 GTTTTTGTTTGGTTTTGAGATGG + Intronic
1112273905 13:97997978-97998000 TTTTTTGTTTGGTTTTGAGACGG + Intronic
1112277316 13:98033401-98033423 TTATTTGTTTAGTTTTGAGACGG - Intergenic
1112351884 13:98642267-98642289 GTGTTTGTTTGTTTTTGAGACGG - Intergenic
1113172271 13:107517947-107517969 GTTTTTGTTTGTTTTTGAGATGG - Intronic
1113407487 13:110055077-110055099 TTATTTGTTTTGTTTTTGCAAGG - Intergenic
1113719049 13:112538976-112538998 GTCTTTGATTAGTTTTGGTGAGG - Intronic
1113969732 13:114179806-114179828 GTTTTTGTTTGTTTTTGAGAGGG + Intergenic
1113983268 13:114294255-114294277 TTTTTTGTTTGGTTTTGGTGGGG + Intronic
1114179445 14:20353244-20353266 GTTTTTGTTTTTTTTTGATACGG + Intronic
1114385074 14:22245860-22245882 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1114838056 14:26227544-26227566 GTTTTATTTTGCTTTTGGTAAGG - Intergenic
1115202810 14:30872520-30872542 CTATTTTTTTCTTTTTGGTAAGG - Intergenic
1115281155 14:31664934-31664956 GTATTAGTTTAGTCTTGGGAGGG + Intronic
1115317743 14:32043617-32043639 GTGTTTGTTTTGTTTTTGGAGGG + Intergenic
1115326532 14:32145479-32145501 GTTTTTGTTAGTTTTGGGTATGG + Intronic
1115780514 14:36763578-36763600 GTATTTGGGTGGTGGTGGTAGGG + Intronic
1115785586 14:36821844-36821866 ATTTTTGTTTTGTTTTGGTTTGG - Intronic
1115813577 14:37137003-37137025 GTTTTTGTTTTGTTTTGAGATGG + Intronic
1115996094 14:39197439-39197461 GCATGTGTTTGGTAGTGGTAAGG + Intergenic
1116254273 14:42530494-42530516 GTTTTGGTTTAGTTTTGGTCAGG + Intergenic
1116365302 14:44053871-44053893 GTATTTGTTTTGGTTTGGGTTGG + Intergenic
1116558994 14:46352865-46352887 GTATTTGTTTTGCTTTAGTGTGG - Intergenic
1116674001 14:47881334-47881356 GTTTTTGTTTTGTTTTGGTGTGG - Intergenic
1117102358 14:52363607-52363629 TTTTTTGTTTGTTTTTGGTTTGG + Intergenic
1117691008 14:58305977-58305999 TTATTTGTTTAAATTTGGTAAGG + Intronic
1118082585 14:62378294-62378316 GTTTTTGTTTGTTGTTAGTATGG + Intergenic
1118418175 14:65567180-65567202 TTATTTGTTTGGTCTAGGAAAGG + Intronic
1118428995 14:65696550-65696572 TTGTTTGTTTGTTTTTTGTATGG + Intronic
1118693135 14:68359373-68359395 GCATTTTTTTGGTTTTGTTTTGG + Intronic
1118841050 14:69511872-69511894 GTCTCTATTAGGTTTTGGTAAGG + Intronic
1119003028 14:70900158-70900180 GTATTTTTTTTTTTTTGGTAGGG + Intergenic
1119321564 14:73734410-73734432 GTTTTTGTTTTGTTTTGAAAAGG + Intronic
1119357838 14:74021684-74021706 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1119458135 14:74774408-74774430 GTATTTTTTTTGTTTTGAGACGG + Intronic
1120301848 14:82717493-82717515 TTATTTATTCGTTTTTGGTATGG + Intergenic
1120345967 14:83290860-83290882 TTGTTTGTTTGGTTTTGGTAAGG + Intergenic
1120525279 14:85569924-85569946 GTATTTGTAAGATGTTGGTATGG + Intronic
1120703788 14:87726569-87726591 TTATTTGTTTGCTGGTGGTAGGG + Intergenic
1120777195 14:88451171-88451193 GTTTTTGTTTCGTTTTGAGATGG + Intronic
1120914028 14:89694673-89694695 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1121028149 14:90631971-90631993 GGTTTTGTTTCGTTTTGTTAGGG + Intronic
1121123633 14:91392288-91392310 GCTTTTGTTTTGTTTTGGCAGGG - Intronic
1121350217 14:93167554-93167576 GTTTTTGTTTTTTTTTGATACGG + Intergenic
1121679483 14:95780785-95780807 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1121883174 14:97518369-97518391 GTATTGGTTTGGTTCTGGCCTGG + Intergenic
1121900573 14:97690023-97690045 GTTTTTGTTTCGTTTTGAGACGG - Intergenic
1122463411 14:101915045-101915067 GTTTTTGTTTTGGTTTGGTTTGG + Intronic
1122471258 14:101968257-101968279 TTTTTTGTTTGTTTTTGGTGGGG + Intronic
1122525498 14:102380681-102380703 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1122912009 14:104834800-104834822 TTGTTTGTTTGGTTTTGAGATGG - Intergenic
1123738994 15:23216747-23216769 ATATTTCTTTGGTTGTAGTAAGG + Intergenic
1123815400 15:23973203-23973225 GTATTTCTGTGTTTTTTGTATGG + Intergenic
1123883924 15:24704616-24704638 TTATTTGTTTGCTTTTGTTTTGG + Intergenic
1123914493 15:25008756-25008778 TTGTTTGTTTTGTTTTTGTATGG + Intergenic
1123926752 15:25120875-25120897 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1124089599 15:26586001-26586023 TTGTTTGTTTGTTTTTGCTACGG + Intronic
1124290214 15:28445717-28445739 ATATTTCTTTGGTTGTAGTAAGG + Intergenic
1124293024 15:28471851-28471873 ATATTTCTTTGGTTGTAGTAAGG - Intergenic
1124442572 15:29697941-29697963 TTTTTTGTTTGTTTTTGGCAGGG - Intergenic
1124656041 15:31508351-31508373 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1124811424 15:32942900-32942922 TTATTTGTTTGTTTTTGGTGGGG - Intronic
1125491579 15:40152672-40152694 CTATTTTTTTAGTTTTTGTAGGG + Intergenic
1125631205 15:41148676-41148698 GTATTTGTTTGTTTTTGAGACGG + Intergenic
1125691573 15:41600303-41600325 GTATTTGTTTGTTTGAGATAGGG - Intergenic
1126246445 15:46511454-46511476 TTGTTTGTTTGTTTTTGGGAAGG - Intergenic
1126333312 15:47557663-47557685 GTATTTGCTGGGTTTTGGTTAGG + Intronic
1126921263 15:53527719-53527741 ATTTTTGTTTGGCTTTGGTCTGG - Intronic
1127171646 15:56309533-56309555 ATCTTTGTCTGGTTTTGGTATGG + Intronic
1127211254 15:56777087-56777109 TTATTTGTTTGTTTTTGAGATGG - Intronic
1127211471 15:56779004-56779026 GTTTTTGTTTTGTTTTTGTGTGG + Intronic
1127224218 15:56913336-56913358 GTCTTAGTGTGGTTTTGGGAAGG + Intronic
1127385372 15:58462557-58462579 TTATTTCTTTGGCTTTGGTCTGG - Intronic
1127464925 15:59234651-59234673 ATTTTTGTTTGTTTTTGGTAGGG - Intronic
1127540695 15:59935953-59935975 GTATTTGTGTGAAATTGGTAAGG + Intergenic
1127548226 15:60010080-60010102 GTTTTTGTTTTGTTTTTGTTTGG - Intronic
1127905297 15:63371860-63371882 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1127932046 15:63603464-63603486 TGCTTTGTTTGGTTATGGTAAGG + Intergenic
1128485149 15:68078061-68078083 TGTTTTGTTTGTTTTTGGTAAGG + Intronic
1128620471 15:69144949-69144971 TTCTTTGTTTTGTTTTGGTTGGG - Intergenic
1129208417 15:74051209-74051231 TTGTTTGTTTGCTTTTAGTATGG - Intergenic
1129282163 15:74494235-74494257 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1129520281 15:76181565-76181587 TTGTTTGTTTGTTTTTGGTGAGG + Intronic
1129643602 15:77409064-77409086 GTGTTTGTTTGTTTTTGAGATGG - Intronic
1129756506 15:78102264-78102286 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1129900305 15:79143148-79143170 GTATTAGATAGGTTTTGGGAGGG - Intergenic
1129989447 15:79949476-79949498 GTGTTTGTTTTGTTTTGAGATGG + Intergenic
1130073968 15:80672944-80672966 GTTTTTGTTTTGTTTTTGGATGG + Intergenic
1130418891 15:83721735-83721757 TTGTTTGTTTGTTTTTGGGATGG + Intronic
1130756651 15:86771518-86771540 GTATTTCTTCTGGTTTGGTATGG + Intronic
1130810626 15:87374331-87374353 GTATCTGTCAGGTTTTGGTATGG - Intergenic
1131067920 15:89445873-89445895 GTATTTGTGTGGTGGTGGCAGGG + Intergenic
1131166637 15:90146484-90146506 GTTTTTGTTTTGTTTTGAAATGG - Intergenic
1131207124 15:90459676-90459698 TTGTTTGTTTGTTTTTGGTTTGG + Intronic
1131383518 15:91983633-91983655 GCATTTGTTTGGTTGTGGTGTGG + Intronic
1132070499 15:98772852-98772874 GAATATGTTTGCTTTTGATAGGG + Intronic
1132476299 16:139927-139949 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1132820262 16:1863388-1863410 GTTTTTGTTTGTTTTTGAGACGG + Intronic
1133105991 16:3509830-3509852 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1133650058 16:7804331-7804353 GTTTTTGTTTTGTTTTTTTATGG + Intergenic
1133652777 16:7828792-7828814 GTATTTGTTTCTTATTGTTATGG + Intergenic
1133752410 16:8735239-8735261 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1134141728 16:11725878-11725900 GTCTTTGTTTTGTTTTGAGATGG + Intronic
1134208503 16:12256937-12256959 GTATTAGTTTTCTTTTGGTGTGG + Intronic
1134427714 16:14167694-14167716 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1134777059 16:16862631-16862653 TTTTTTGTTTGTTTTTGGGATGG + Intergenic
1135104243 16:19633740-19633762 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1135287638 16:21207899-21207921 GTTTTTGTTTGTTTTTGTTTTGG - Intronic
1135679956 16:24447949-24447971 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
1135726115 16:24854971-24854993 GTGTTTGTTTGTTTGTGGCAAGG + Intronic
1135810526 16:25582622-25582644 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1136414127 16:30093264-30093286 TTGTTTGTTTGGTTTTGAGAGGG + Intronic
1136497609 16:30653668-30653690 TTATTTGTTTGTTTTTGAGATGG + Intronic
1136641326 16:31568273-31568295 ATGTTTCTTTGGTGTTGGTAAGG + Intergenic
1136708524 16:32211903-32211925 ATATTTCTTTGGTTGTAGTAAGG - Intergenic
1136759382 16:32717509-32717531 ATATTTCTTTGGTTGTAGTAAGG + Intergenic
1136808724 16:33152877-33152899 ATATTTCTTTGGTTGTAGTAAGG - Intergenic
1136999976 16:35221440-35221462 GTATTTATTTATTTTTGGTGGGG + Intergenic
1137223409 16:46478601-46478623 GTATTTGTTTCTTTTTGTTTTGG + Intergenic
1137227470 16:46528422-46528444 TTTTTTGTTTTGTTTTGGGAGGG - Intergenic
1137251664 16:46745736-46745758 GTTTTTGTTTGTTTTTGAGACGG - Intronic
1137317260 16:47338402-47338424 TTGTTTGTTTGGTTTTGAGAAGG - Intronic
1138579728 16:57932910-57932932 TTATTTGTTTGCTTTTGAGAAGG + Intronic
1138791811 16:59913292-59913314 GGCTTTGTTTGGTTTTGCTCTGG + Intergenic
1138869951 16:60870369-60870391 GTAGTTCTTTGGTTTTGATAGGG - Intergenic
1139423050 16:66860904-66860926 TTATTTATTTATTTTTGGTAGGG - Intronic
1139535012 16:67566579-67566601 GTATTTGTTTGTTTTGGAGATGG + Intronic
1139759120 16:69170129-69170151 GTTTTTGTTTGTTTTGGGGATGG + Intronic
1139803661 16:69545258-69545280 TTATTTTTTTATTTTTGGTAGGG + Intergenic
1139843176 16:69898705-69898727 GTTTTTGTTTGTTTTTGAGACGG + Intronic
1140259659 16:73366576-73366598 TTTTTTTTTTGGTTTTGGTTTGG - Intergenic
1140501188 16:75434905-75434927 GGGTTTGTTTTGTTTTGGTTTGG + Intronic
1140501189 16:75434916-75434938 GTTTTGGTTTGGTTTTGAAACGG + Intronic
1140673413 16:77301862-77301884 GTATTGATTTGGTTTTGGATGGG - Intronic
1141349890 16:83285070-83285092 GTTTTTGTTTTATTTTGGAACGG + Intronic
1142321214 16:89384213-89384235 GTTTTTGTTTGTTTTTGAGATGG - Intronic
1142419088 16:89959480-89959502 GTTTTTGTTTGTTTTTGGTTTGG + Intronic
1203061536 16_KI270728v1_random:977818-977840 ATATTTCTTTGGTTGTAGTAAGG + Intergenic
1142773137 17:2114263-2114285 TTTTTTGTTTTGTTTTGGGATGG - Intronic
1142798680 17:2329829-2329851 TTCTTTGATCGGTTTTGGTAAGG - Intronic
1142880857 17:2881823-2881845 TTATTTGTTTGTTTTTGAGACGG + Intronic
1143070917 17:4292335-4292357 TTGTTTGTTTGGTTTTGGTTTGG - Intronic
1143080628 17:4378584-4378606 TTATTTGTTTGTTTTTGAGACGG - Intergenic
1143154796 17:4829664-4829686 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
1143318315 17:6050017-6050039 TTATTTGTTTGTTTTTGAGATGG + Intronic
1143326659 17:6103461-6103483 ATGTTTGTTTGGCTTTGATAGGG + Intronic
1143650420 17:8260613-8260635 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1143934994 17:10474463-10474485 ATCTTTATTTGGTTTTGGTATGG + Intergenic
1143998826 17:11033699-11033721 TTGTTTGTTTGTTTGTGGTAAGG - Intergenic
1144097578 17:11915514-11915536 GTGTTTGTTTGTTTTTGAGATGG - Intronic
1144532389 17:16052011-16052033 GTTTTTGTTTTGTTTTGAGATGG + Intronic
1144602049 17:16625178-16625200 CTATTTGTTTTGTTTTGTTTTGG + Intronic
1144731236 17:17527666-17527688 CTGTTTGTTTTGTTTTGGAATGG + Intronic
1144752826 17:17661682-17661704 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1145067460 17:19771525-19771547 GCTTTTGTTTTGTTTTGGGAGGG - Intronic
1145210301 17:21008094-21008116 GTAAGTGTATGTTTTTGGTAGGG - Intronic
1146039431 17:29437066-29437088 TTGTTTGTTTGTTTTTGATATGG + Intronic
1146144631 17:30402573-30402595 GTTTTCGTTTTGTTTTGGTTTGG - Intronic
1146251525 17:31349099-31349121 TTGTTTGTTTGTTTTTTGTAGGG + Exonic
1146387701 17:32392063-32392085 TTTTTTGTTTTGTTTTGTTATGG + Intergenic
1146497127 17:33332884-33332906 TTATTTGTTTTGTTTTGAGATGG - Intronic
1146701360 17:34963121-34963143 TTGTTTCTTTGGTTTTTGTATGG + Exonic
1147292783 17:39457289-39457311 TTGTTTGTTTGTTTTTGGTAGGG + Intergenic
1147371913 17:39998144-39998166 GTACTTGTGTGGCTTTGGTAAGG + Intergenic
1147806834 17:43137874-43137896 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
1147957597 17:44145076-44145098 TTTTTTGTTTGTTTTTGCTACGG - Intronic
1148010115 17:44472698-44472720 TTATTTGTTTGTTTTTGAGATGG + Intronic
1148023248 17:44567627-44567649 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1148130521 17:45259989-45260011 GTCTTTGTTAGGTTTTGATAGGG + Intronic
1148487190 17:47998057-47998079 GGGTTTGTTTGGGTTTGGTTTGG + Intergenic
1148949662 17:51299742-51299764 GTATGTGTGTGTTTCTGGTACGG + Intergenic
1149612746 17:57969573-57969595 TTGTTTGTTTGTTTTTGATATGG - Intergenic
1149826522 17:59833968-59833990 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1150476749 17:65481354-65481376 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1150596409 17:66609760-66609782 GCTTTTGTTTGGTTTTGGCAAGG + Intronic
1151059891 17:71079854-71079876 GCTTTTGTTTTGTTTTGGTTTGG - Intergenic
1152167558 17:78720321-78720343 TTATTTGTTTGTTTTTGAGATGG + Intronic
1152451714 17:80385725-80385747 GTGTTTGTTTGTTTTTGAGATGG + Intronic
1152464863 17:80460310-80460332 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1152650405 17:81489965-81489987 GCATTTCTTTGGTTTTTGGAGGG - Intergenic
1152761641 17:82111098-82111120 GTTTTTGTTTTGTTTTGGGACGG + Intronic
1152765277 17:82133888-82133910 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1152959628 18:71541-71563 TTTTTTGTTTGTTTTTGATACGG - Intronic
1153546333 18:6209462-6209484 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1153557619 18:6332532-6332554 GAATCTCTTTGGTTTTGGTTAGG - Intronic
1153604405 18:6817312-6817334 TTGTTTGTTTGTTTTTGGAATGG - Intronic
1153660645 18:7322799-7322821 GTGTGTGTTTTGTTTTGGTTTGG - Intergenic
1153839474 18:8993096-8993118 TTCTTTGTTTGTTTTTGATATGG - Intergenic
1153867877 18:9289666-9289688 TTGTTTGTTTTGTTTTGGTTTGG + Intergenic
1154006538 18:10534140-10534162 TTGTTTGTTTGTTTTTGGGATGG - Intronic
1154363619 18:13686784-13686806 TTGTTTGTTTGTTTTTGGAAAGG - Intronic
1155133574 18:22964139-22964161 GTCTTTGTTTGTTTTTGAGATGG + Intronic
1155329769 18:24703332-24703354 GTCATTGTTTGGTCATGGTAAGG - Intergenic
1155350269 18:24899440-24899462 GTATTTATTTGGTGTGAGTAGGG - Intergenic
1155460259 18:26071875-26071897 ATTTTTGTTTTGTTTTGGTCTGG - Intronic
1155482651 18:26305963-26305985 ATATTTGTTAGAATTTGGTAAGG + Intronic
1155691100 18:28623587-28623609 TTCTTTGTTTTGTTTTGGTTTGG + Intergenic
1155854421 18:30815195-30815217 TGATTTATGTGGTTTTGGTATGG - Intergenic
1156037760 18:32784736-32784758 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1156110259 18:33717727-33717749 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1156682900 18:39612564-39612586 GTTTTTGTTTTGTTTTGGTCTGG + Intergenic
1156735795 18:40257411-40257433 GAATTTGTTTTATTTCGGTATGG - Intergenic
1156812861 18:41273817-41273839 ATGTTTGTTTTGTTTTCGTATGG + Intergenic
1157279933 18:46340183-46340205 GTATTTATTAGTTTCTGGTATGG + Intronic
1158316286 18:56214384-56214406 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
1158934241 18:62349761-62349783 GTTTTTGTTTGGTTTTTTGATGG + Intronic
1159086879 18:63802657-63802679 GTATTTGTTTTGTTTTGACTTGG + Intronic
1159104734 18:63993121-63993143 GTATTTTTTTAGTTTTTTTAAGG + Intronic
1159170536 18:64760699-64760721 GGATTTGTTGGGCTTTTGTATGG - Intergenic
1159320601 18:66842566-66842588 GTCTTTGGTAGGTTTTGGTATGG - Intergenic
1159464149 18:68759002-68759024 GTTTTTGTTTTTTTTAGGTAGGG - Intronic
1159531216 18:69657897-69657919 GTGGTTGTTTGGTTTTGGGTGGG + Intronic
1159565524 18:70043707-70043729 TTGTCTGTTTGGTTTTGGTTTGG - Intronic
1159875919 18:73811009-73811031 TTATTTGTAGGGTTTTGGTCAGG + Intergenic
1160177799 18:76610145-76610167 TTATTTGTTTGTTTTTGACATGG - Intergenic
1160191750 18:76720331-76720353 GTGTTTGTTTGTTTTTGAGATGG - Intergenic
1160205310 18:76826622-76826644 GTATTTTTTTTTTTTTAGTACGG - Intronic
1160241487 18:77127337-77127359 TTATTTGTTTTGGTTTGGTTTGG - Intronic
1161670734 19:5607254-5607276 GTTTTTGTTTGTTTTTGAGACGG - Intronic
1161681852 19:5683978-5684000 TTGTTTGTTTGTTTTTGATACGG + Intronic
1161795857 19:6386448-6386470 TTATTTGTTTTGTTTTGAGACGG + Intronic
1162092535 19:8290180-8290202 CTATTTTTTTTTTTTTGGTAGGG + Intronic
1162136830 19:8560565-8560587 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1162711247 19:12596656-12596678 GAATTTGTTTGTTTTTGACACGG - Intronic
1163365615 19:16874416-16874438 GATTTGGTTTGGTTTTGGTTTGG + Intronic
1163365653 19:16874657-16874679 GGTTTGGTTTGGTTTTGGTTTGG + Intronic
1163365714 19:16875055-16875077 GGTTTGGTTTGGTTTTGGTTTGG + Intronic
1163394079 19:17048932-17048954 GTCTTTGTTTGGTTTTAGACAGG - Intergenic
1163452939 19:17389959-17389981 GTTTTGGTTTGGTTTTGAGATGG - Intergenic
1163803128 19:19379982-19380004 TTGTTTGTTTGTTTTTGATACGG + Intergenic
1163891701 19:20022345-20022367 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1163932672 19:20412330-20412352 TGTTCTGTTTGGTTTTGGTAGGG - Intergenic
1163984411 19:20931556-20931578 GTTTCTGTTTGGATTTGGTAGGG + Intronic
1164015407 19:21252422-21252444 GTATTTGTGTATTTTTAGTAAGG - Intronic
1164021561 19:21311866-21311888 GTTTCTGTTTGGGTTTGGTAGGG - Intronic
1164140196 19:22453359-22453381 TGTTCTGTTTGGTTTTGGTATGG + Intronic
1164423226 19:28116165-28116187 TTGTTTGTTTTGTTTTGGTTTGG + Intergenic
1164439541 19:28262771-28262793 GTTTTTGTTTGTTTTTTGTTTGG + Intergenic
1164774055 19:30837041-30837063 TTATTTGTTTGTTTTTGAGACGG - Intergenic
1164802448 19:31088822-31088844 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1164899653 19:31907517-31907539 GTGTTTGTTTGTTTTTGAGATGG - Intergenic
1165195326 19:34098100-34098122 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
1165304123 19:34993165-34993187 GTTTTTGTTTTTTTTTGGTGGGG - Intergenic
1165854840 19:38873525-38873547 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1166791093 19:45398946-45398968 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1166961429 19:46498398-46498420 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1167057731 19:47123146-47123168 TTGTTTGTTTGTTTTTGATAAGG - Intronic
1167404936 19:49300331-49300353 GTTTTTGTTTTGTTTTGAGACGG - Intronic
1167532517 19:50026867-50026889 GTTTTATTTTGGTTTTGGTTGGG + Intronic
1167568750 19:50273644-50273666 GTCTTTGTTTTGTTTTGAAACGG + Intronic
1168243922 19:55100599-55100621 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1168396352 19:56052214-56052236 TGTTTTGTTTGGTTTTGGTGGGG + Intronic
1168402044 19:56090815-56090837 GTTTTTGTTTTGTTTTGAGATGG - Intronic
1168701972 19:58445815-58445837 TTGTTTGTTTGTTTTTGGTGAGG - Intergenic
925243340 2:2354551-2354573 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
925508683 2:4599468-4599490 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
925559124 2:5168937-5168959 GTAATTGTTTGATTTTGGTGTGG - Intergenic
925661143 2:6204234-6204256 GTTTTTGTTTTGTTTGAGTAGGG - Intergenic
926463400 2:13161784-13161806 GTATTTATAAAGTTTTGGTAAGG + Intergenic
927257717 2:21054709-21054731 GTTTTTGTTTTGTTTTGAGACGG + Intergenic
927288874 2:21385016-21385038 GTTTTTGTTTGGGTGTGGTAGGG - Intergenic
927906576 2:26862922-26862944 GTTTTTGTTGGGTTTTGTTCAGG + Intronic
928010110 2:27599552-27599574 GTTTTTGTTTTGTTTTTGTATGG + Intronic
928071773 2:28224093-28224115 GTATTTTTGTTGTTTTGGTTTGG - Intronic
928351393 2:30559162-30559184 GTATTGGTTTTCTTTTGGGAGGG + Intronic
928466804 2:31529769-31529791 GTTTTTGTTTTGTTCTGTTAAGG + Intronic
929122272 2:38493530-38493552 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
929400683 2:41577980-41578002 TTATTTGTTTGTTTTTGAGACGG + Intergenic
929513439 2:42584543-42584565 GTATTTTTTTTTTTTTGGGATGG + Intronic
929848182 2:45555030-45555052 GTCTTTGATTGGTTGGGGTAAGG - Intronic
930012060 2:46944885-46944907 GTAATTGTTAGATTTTTGTAAGG - Intronic
930090271 2:47526726-47526748 GTTTTTGTTTGTTTTTGAGACGG - Intronic
930204838 2:48577613-48577635 TTGTTTGTTTGTTTTTTGTAGGG + Intronic
930213737 2:48671193-48671215 TTCTTTGTTTTGTTTTGGTTTGG + Intronic
930531718 2:52596710-52596732 GTACTTTATTGGTTGTGGTAAGG - Intergenic
930734564 2:54763583-54763605 GCATTTGTGTGGTTTTTGGATGG + Intronic
931276939 2:60752506-60752528 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
931282897 2:60809249-60809271 GTCTTTGTTTGGTGTTCGTGGGG + Intergenic
931283754 2:60815776-60815798 TTGTTTGTTTGTTTTTGGGATGG + Intergenic
931338900 2:61379206-61379228 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
931396205 2:61890223-61890245 GTTTTTGTTTGTTTTTGAGACGG + Intronic
931396404 2:61891721-61891743 GTTTTTGTTTTGTTTTGAGATGG - Intronic
931442798 2:62303311-62303333 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
931494794 2:62792440-62792462 TTTTTTGTTTAGTTTTGGAATGG + Intronic
931730357 2:65147795-65147817 ATTTTTGTTTTGTTTTGGTTTGG + Intergenic
932383336 2:71306431-71306453 GTGTTTTTTTGTTTTTGCTATGG + Intronic
932753402 2:74387488-74387510 TTGTTTGTTTGTTTTTGGTGGGG - Intronic
932901373 2:75704687-75704709 TTGTTTGTTTGGTTTTGAGATGG + Intronic
933373681 2:81450732-81450754 TTGTTTGTTTGTTTTTGATAAGG - Intergenic
933723911 2:85415394-85415416 GTTTTTGTTTTGTTTTGCTTAGG + Intronic
933757891 2:85654641-85654663 ATATTTGTTTTGTTTTGTTTTGG - Intergenic
934569351 2:95358962-95358984 AAATTTGTTTGGTTTTTGAAAGG - Intronic
934673294 2:96230812-96230834 TTGTTTGTTTGTTTTTGGTGGGG + Intergenic
934705829 2:96479481-96479503 ATTTTTGTTTTGTTTTGTTATGG + Intergenic
934900909 2:98159238-98159260 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
935177078 2:100658170-100658192 GTTTTTGTTTCGTTTTAGTTTGG - Intergenic
935312069 2:101794094-101794116 TTATCTGATTGGTTTTGGGAAGG + Intronic
935516572 2:104047555-104047577 TTATTTGTTTGGGTCTTGTACGG + Intergenic
935705362 2:105851902-105851924 GGTTTTGTTTTGTTTTGGTTTGG + Intronic
936127074 2:109797617-109797639 TTTTTTGTTTGTTTTTGTTATGG + Intronic
936217623 2:110573869-110573891 TTTTTTGTTTGTTTTTGTTATGG - Intronic
936426767 2:112428442-112428464 TTTTTTGTTTGTTTTTGTTATGG - Intronic
936586246 2:113760885-113760907 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
936636402 2:114263834-114263856 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
936640424 2:114305391-114305413 GTTGTTGTTTGGTTTTGTTTTGG + Intergenic
937184385 2:120026371-120026393 TTGTTTGTTTGTTTTTGATACGG + Intronic
938086722 2:128406640-128406662 GGACTTGTTTGGATTTGGAAAGG + Intergenic
938939703 2:136159012-136159034 GTTTTAGTTTTGTTTTGGTTTGG - Intergenic
939345016 2:140953093-140953115 TTGTTTGTTTGTTTTTGATATGG + Intronic
939533955 2:143401194-143401216 GTCTTTGTTTTGTTTAGGTGGGG + Intronic
939629006 2:144512743-144512765 CTATTTGTTTTATTTTGGTCTGG - Intronic
939798264 2:146675330-146675352 GATTTTGTTTTGTTTTGGTTTGG - Intergenic
939831687 2:147079990-147080012 TTTTTTGTTTGGTTTTGCTATGG - Intergenic
939939684 2:148334673-148334695 ATTTTAGTTTGGTTTTGGAAAGG + Intronic
939986389 2:148833500-148833522 GTCTTTGTTTGGTGGTGGTGGGG - Intergenic
940221853 2:151361057-151361079 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
940439203 2:153694101-153694123 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
940725465 2:157331158-157331180 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
940761050 2:157739738-157739760 GTATTTGTATGGAATTTGTAAGG - Intronic
941062099 2:160858584-160858606 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
941408126 2:165118072-165118094 GTATTTTTTTGTTATTGGGAAGG + Intronic
941695039 2:168542113-168542135 GTGTTTGTTTGTTTTTGTTTGGG + Intronic
941946593 2:171105356-171105378 AAATTTGTATGGTTTTTGTATGG - Intronic
942484300 2:176423156-176423178 GGATTTTTTTGTTTTTGGTCTGG + Intergenic
942801235 2:179878718-179878740 ATATTTGTTTTGTTTTGAGATGG + Intergenic
943023879 2:182606174-182606196 TTATTTGTTTGTTTTTGAGATGG + Intergenic
943576556 2:189637688-189637710 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
943588424 2:189767208-189767230 GTCTATGTGTGGTTTTGGCAGGG + Intergenic
945214927 2:207423264-207423286 GTACTTGTAAGGTATTGGTAGGG - Intergenic
945346287 2:208721269-208721291 AGATTTTTTTGTTTTTGGTAGGG + Intronic
945802951 2:214456380-214456402 GTGATTGTTTGGTTTTTGTTTGG + Intronic
945894891 2:215470724-215470746 GTTTTTGTTTGTTTTTGAGATGG - Intergenic
946840191 2:223812224-223812246 GTTTTTGTTTTGTTTTGAGATGG + Intronic
946890283 2:224268858-224268880 GTTTTTGTTTGCTTTTGAGATGG + Intergenic
946993158 2:225359075-225359097 GAATTTTTGTGGTTTTGGTAGGG + Intergenic
947048937 2:226020384-226020406 GTGTTTGTTTTGTTTTGGGATGG - Intergenic
947133290 2:226952271-226952293 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
947314019 2:228835448-228835470 TTGTTTGTTTGTTTTTGTTATGG + Intergenic
947336853 2:229095124-229095146 GTGTTTGTGTGGTTTAGGTTAGG - Intronic
947431544 2:230032948-230032970 TTTTTTGTTTGTTTTTGATATGG + Intergenic
947551849 2:231052253-231052275 TTTTTTGTTTGTTTTTGATACGG - Intergenic
948168552 2:235882051-235882073 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
948435333 2:237949722-237949744 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
948951285 2:241253501-241253523 CTATCTCTTTGGTTTTGGTGTGG - Intronic
949064875 2:241983912-241983934 CTGTTTGTTTGGTTTTAGTGGGG + Intergenic
1168872459 20:1142225-1142247 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1169117517 20:3075475-3075497 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
1169237946 20:3947186-3947208 GTTTTTGTTTGTTTTTGAGACGG - Intronic
1169597634 20:7218723-7218745 TTGTTTGTTTGCTTTTGCTATGG - Intergenic
1169849426 20:10033708-10033730 GTATTTCTTTAGCTATGGTATGG + Intronic
1169857712 20:10122022-10122044 TTATTTGTTTTCTTTTGGTTTGG + Intergenic
1170030600 20:11939948-11939970 TTATTTGCTTGGTTTTTGTTTGG - Intergenic
1170160708 20:13307386-13307408 GTTTTTTCTTGGTGTTGGTATGG - Intergenic
1170213088 20:13864642-13864664 GTATCTGTTTTGTTTTGGTTTGG + Intronic
1170667057 20:18395381-18395403 GTCATTGTTTTGTTTTGGTTTGG - Intronic
1170670401 20:18427546-18427568 GTATTCGTTTGGTTTTCAAAAGG + Intronic
1170956866 20:20988954-20988976 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
1171499472 20:25582247-25582269 TTGTTTGTTTGTTTTTGATATGG - Intronic
1171890255 20:30705800-30705822 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
1172075003 20:32289175-32289197 GTATTTGTTTGGTACTGGTCTGG + Intronic
1172125491 20:32622984-32623006 AATTTTGTTTGGTTTTGGTTTGG + Intergenic
1172317647 20:33968696-33968718 TTATTGGTTTGGTTTGGGTTGGG - Intergenic
1172322727 20:34009199-34009221 GGATTTGTTTTGTTTTGTTTTGG + Intronic
1172439032 20:34952437-34952459 GTATTTTTTTTTTTTTGATATGG + Intronic
1172745888 20:37208397-37208419 ATATTTTTTTGGTTTTGTTTTGG + Intronic
1173271189 20:41536734-41536756 GTATTTTTTTGTTTTGGGTCAGG + Intronic
1173610214 20:44361682-44361704 GGTTTTGTTTTGTTTTGGTTTGG - Intronic
1173782558 20:45768752-45768774 TTGTTTGTTTGGTTTTGGTTTGG + Intronic
1173797908 20:45875504-45875526 TTATTTGTTTGCTTTTGAGATGG + Intronic
1174156710 20:48520367-48520389 TTATTTGTTTGTTTTTGAGATGG - Intergenic
1174381457 20:50158210-50158232 TTGTTTGTTTGTTTTTGATATGG - Intergenic
1174480362 20:50826999-50827021 TTGTTTGTTTGTTTTTGGTGGGG - Intronic
1174605006 20:51754941-51754963 GTATTTTTTTTTTTTTAGTAGGG - Intronic
1174719253 20:52793885-52793907 GTTTTGGTTTGGTTTTTGTTGGG + Intergenic
1174778605 20:53368312-53368334 TGGTTTGTTTGGTTTTGATACGG + Intronic
1174779392 20:53374648-53374670 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1174951737 20:55049796-55049818 GTTTTTGTGTGGTTTTGGTATGG - Intergenic
1175204805 20:57303292-57303314 TTATTTGTGTGGTTGTGATATGG + Intergenic
1175234503 20:57500848-57500870 GTTTTTGTTTGGTTTTGGTTTGG - Intronic
1176853444 21:13940772-13940794 GTGTTTGTTTTGTTTTGTTTGGG - Intergenic
1177572563 21:22905803-22905825 TTATTTGTTTGGCTTTGTGAAGG + Intergenic
1177684090 21:24414736-24414758 TTATTTGTTTTGTTTTATTAAGG - Intergenic
1177685588 21:24433762-24433784 TTATTTATTTATTTTTGGTAGGG - Intergenic
1177849978 21:26334223-26334245 TTATTTGGTTGATTTTGGTGAGG - Intergenic
1178330867 21:31689928-31689950 GTTTTTGTTTCGTTTTGAGATGG - Intronic
1178489572 21:33040714-33040736 GTTTTGGTTTGGTTTTGGTGTGG - Intergenic
1178797958 21:35763252-35763274 GTAAATGTTTGGATTTGGTATGG - Intronic
1179340485 21:40503781-40503803 GTATTTGTTTGATTTGGTTTTGG + Intronic
1179806129 21:43838491-43838513 GTAATTTTTTTGTTTTGGTTTGG - Intergenic
1180216814 21:46328946-46328968 GTATTTGTTTGGTTGAGATGGGG + Intronic
1180821377 22:18831013-18831035 GTTTTTGTTTGCTTTTGGCATGG - Intergenic
1181191601 22:21145032-21145054 GTTTTTGTTTGCTTTTGGCATGG + Intergenic
1181207596 22:21265478-21265500 GTTTTTGTTTGCTTTTGGCATGG - Intergenic
1181873629 22:25922890-25922912 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1182209229 22:28660499-28660521 GTTTTTGTTTTGTTTTGATTTGG + Intronic
1182497658 22:30721237-30721259 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1182884391 22:33760926-33760948 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1183595680 22:38808661-38808683 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1183871970 22:40746630-40746652 GTGTTTGTTTGTTTTAAGTAGGG + Intergenic
1183963965 22:41430200-41430222 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1184106517 22:42370449-42370471 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1185378743 22:50496407-50496429 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1203219323 22_KI270731v1_random:29938-29960 GTTTTTGTTTGCTTTTGGCATGG + Intergenic
1203271502 22_KI270734v1_random:56889-56911 GTTTTTGTTTGCTTTTGGCATGG - Intergenic
949200477 3:1372400-1372422 GTATTTGTATGGTTTTTCAATGG + Exonic
949340052 3:3019716-3019738 GTATTTGTGTGTATATGGTAGGG + Intronic
949384323 3:3482774-3482796 GTATTTTTTTGGCTTGGGTAGGG - Intergenic
949915231 3:8956628-8956650 GTTTTTGTTTTGTTTTGTTTGGG - Intronic
949920761 3:8998513-8998535 GTATTTATGTGTTTGTGGTATGG + Intronic
949937836 3:9130673-9130695 GTGTTTGTTTTGTTTTAATATGG - Intronic
949955653 3:9266631-9266653 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
950651267 3:14408809-14408831 TTGTTTGTTTGTTTTTGGGACGG + Intronic
951392523 3:22123885-22123907 GTTTTTGTTTTGTTTTTGTTTGG - Intronic
951415731 3:22419275-22419297 GTTTTTGTTTAGTTTTGGCTAGG + Intergenic
951596748 3:24326704-24326726 GAAATTGTTTGGCCTTGGTATGG + Intronic
951713542 3:25611899-25611921 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
951853456 3:27169014-27169036 GTTTTTGTTTGGTTTTGAAGGGG + Intronic
952621290 3:35346228-35346250 GTATCTGTATGTATTTGGTAGGG - Intergenic
952765193 3:36946999-36947021 GGTTTGGTTTGGTTTTGGTTTGG + Intergenic
952872220 3:37911055-37911077 CTTTTTGTTTGTTTTTTGTAAGG - Intronic
952961340 3:38591641-38591663 CTATTTTTTTTTTTTTGGTAAGG - Intronic
953360874 3:42295239-42295261 GAATTTGGTAGGTTTTGTTAGGG - Intergenic
953721623 3:45360830-45360852 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
953817113 3:46168122-46168144 GTCTTTGTTTTGTTTTGAGATGG + Intronic
953972613 3:47358933-47358955 TTATTTGTTTGTTTTTGAGATGG + Intergenic
954056780 3:48032658-48032680 GTTTTTGTTTGTTTTTGAGAAGG - Intronic
954821989 3:53337733-53337755 GTAGTTGTTTGATTCAGGTATGG + Intronic
954865572 3:53726629-53726651 GTGTTTGTTTGTTTTTGAGATGG - Intronic
955101501 3:55854374-55854396 GTTTTGTTTTGGTTTTGGTTTGG + Intronic
955425230 3:58781941-58781963 GTCATTGTCTGATTTTGGTATGG - Intronic
955714706 3:61816525-61816547 GTGTTTGTTTGTTTTTGAGAGGG - Intronic
955738921 3:62068644-62068666 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
955813078 3:62811888-62811910 GTATTTATTTGGCTTTAATATGG + Intronic
955814181 3:62824580-62824602 TTGTTTGTTTTGTTTTTGTAAGG - Intronic
955987991 3:64595074-64595096 ATTTTTGTTTTGTTTTGGTTTGG - Intronic
956029998 3:65027386-65027408 GTGTTTTTTTGGTTTTTGTTCGG - Intergenic
956560497 3:70569488-70569510 TTATTTGTTTGTTTTTGAGATGG + Intergenic
957061124 3:75482128-75482150 TTGTTTGTTTGTTTTTGGGATGG + Intergenic
957355185 3:79074427-79074449 TTATTTGTTTGTTTTTGAGATGG + Intronic
957487577 3:80882618-80882640 GTATCTGTTTGCTTCTGGGAAGG + Intergenic
957525436 3:81373368-81373390 TTGTTTGTTTGTTTTTGGTAAGG + Intergenic
958449132 3:94251576-94251598 GTTTTTGTTTGGTTTTGGTTTGG + Intergenic
958767123 3:98382392-98382414 GTATTGATTTGGATTTGGCATGG - Intergenic
958879455 3:99653383-99653405 GTTTTGGTTTGGTTTGGGTGGGG + Intronic
958915158 3:100041666-100041688 GTATGTATTTGGTTTGGGGAAGG + Intronic
959026243 3:101242967-101242989 GTTTTTGTTTTGTTTTGTTTGGG - Intronic
959072237 3:101713646-101713668 TTTTTTGTTTTGTTTTGATACGG + Intergenic
959085113 3:101844048-101844070 GTATTTGTCAGTTTTTGGTTTGG - Intronic
959102232 3:102023809-102023831 GTGTTTGTTTTGTTTTGAGAAGG + Intergenic
959329244 3:104981663-104981685 TTATTTGTTTGTTTTTGAAATGG + Intergenic
959849079 3:111067357-111067379 GTTTTTGTTTTGTTTTGTTCTGG + Intergenic
959855367 3:111148558-111148580 GTTTTGTTTTGGTTTTGGTCTGG + Intronic
960120707 3:113946892-113946914 GGGTTTGTTTTGTTTTGGTAAGG + Exonic
960464974 3:117986459-117986481 TTATTTATTTTGTTTTGGTTAGG - Intergenic
960650717 3:119945573-119945595 TTACTTGTCTGGTTTTGGTTTGG - Intronic
960685739 3:120291500-120291522 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
960815789 3:121670942-121670964 CTATGTTTTTGTTTTTGGTATGG - Intronic
961909882 3:130303413-130303435 GTATCTGTTTGGTTTTATAAAGG - Intergenic
962402470 3:135072377-135072399 GTGTTTGTTTGTTTTTGAGATGG - Intronic
962486572 3:135849162-135849184 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
963319289 3:143795728-143795750 GGATTTGTTTTGTTTTGTTTTGG - Intronic
963409604 3:144910405-144910427 ATATTTGTTTAGCTTTGCTAAGG - Intergenic
963683244 3:148407843-148407865 GTCTTTGTTTTGTTTTGTTTTGG + Intergenic
963692617 3:148523662-148523684 GTCTTTGTCTGGTTTTTGTCAGG - Intergenic
963757386 3:149249826-149249848 GTATTTATTTGTGTTTGGTATGG - Intergenic
963895782 3:150683755-150683777 GTTTTTGTTTTGTTTTGAGATGG - Intronic
964040158 3:152252014-152252036 GTATCTGTTTGTTACTGGTATGG + Intronic
964160433 3:153639469-153639491 CTTTTTGTTTTGTTTTGGTTTGG - Intergenic
964478554 3:157119894-157119916 TTTTTTGTTTGTTTTTGGAATGG + Intergenic
965183939 3:165438719-165438741 GTTTTTATTTGGTTTTGTTTTGG + Intergenic
965249243 3:166321134-166321156 TTATTTGTTTGGGTTTGGTTTGG - Intergenic
965679516 3:171235745-171235767 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
965703590 3:171483447-171483469 TTATTTGTTTTGTTTTTATATGG + Intergenic
965949128 3:174282285-174282307 GTATTTTGTTCCTTTTGGTAAGG + Exonic
966225077 3:177589540-177589562 GAGTTTGTTTGTTTTTGGTGAGG + Intergenic
966267142 3:178060034-178060056 GTTTTTGTTTTGTTTTGTTTCGG + Intergenic
966786268 3:183625450-183625472 TTTTTTGTTTTGTTTTGGGATGG - Intergenic
967066491 3:185921757-185921779 GTTTTTGTTTTGTTTTGAGACGG - Intronic
967093466 3:186155195-186155217 GTTTTTGTTTGGTTTTGAGATGG + Intronic
967431297 3:189388788-189388810 GTTTTTGTTTGTTTTTGAGATGG - Intergenic
967513021 3:190335046-190335068 GTGTTTGTTTGCTTTTGAGATGG + Intronic
967795507 3:193594390-193594412 GTTTTTGTTTTGTTTTGAGACGG + Intronic
968121001 3:196125950-196125972 TTATTTGTTTGTTTTTGAGATGG + Intergenic
968220570 3:196935830-196935852 GAATTTATTTGGTATTTGTAAGG - Exonic
968248912 3:197186746-197186768 TTATTTGTTTGTTTTTGAGACGG + Intronic
968377894 4:59192-59214 TGCTTTGCTTGGTTTTGGTAGGG + Intronic
968436282 4:591709-591731 TTTTTTGTTTGGTTTTGAGACGG - Intergenic
968719014 4:2185739-2185761 TTATTTGTTTGTTTTTGAGATGG - Intronic
968967994 4:3779006-3779028 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
969070891 4:4537890-4537912 GAATTTGTTTGGTTTCTGAATGG - Intronic
969747833 4:9087990-9088012 GTTTTTGTTTGTTTTTGACATGG - Intergenic
969927115 4:10595100-10595122 GTTTTTGTTTTGGTTTGGTTTGG - Intronic
970825804 4:20272751-20272773 TTGTTTGTTTAGTTTTGGTTTGG - Intronic
970841056 4:20470080-20470102 ATAGTTATTTGGGTTTGGTATGG + Intronic
970927239 4:21467055-21467077 GTGTTTGTTTTGGTTTGGTTTGG - Intronic
971078690 4:23180935-23180957 GTCTTTGTTTTGTTTTGAGATGG - Intergenic
971321655 4:25610800-25610822 TTATTTGTTTGTTTTTGAGACGG + Intergenic
971323691 4:25626742-25626764 GTTTTTGTTTGTTTTTGAGACGG + Intergenic
971737574 4:30475403-30475425 GCATTTCTTTTGTTTTGGTTTGG - Intergenic
971765767 4:30829127-30829149 TTTTGTGTTTGGTTTTGGAAGGG + Intronic
971903217 4:32691122-32691144 TTTTTTTTTTGGTTTTGGTTTGG + Intergenic
972496659 4:39640688-39640710 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
972497146 4:39644702-39644724 GGATTTTTTTTGTTTTGGTTTGG + Intergenic
972527130 4:39925180-39925202 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
972528886 4:39943797-39943819 TTGTTTGTTTGTTTTTGATACGG - Intronic
972529927 4:39952324-39952346 GTTTTTGTTTTGTTTTGAGACGG - Intronic
972544676 4:40069111-40069133 GTTTTTGTTTGTTTTTGAGATGG - Intronic
972611753 4:40662268-40662290 GTGTTTGTTTGTTTTTGAGACGG + Intergenic
972635261 4:40878353-40878375 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
973094645 4:46181176-46181198 GCATTTGTTAGTTTTTGGGAGGG - Intergenic
973209706 4:47602264-47602286 TTATTTGTTTGTTTTTGAGACGG - Intronic
973306372 4:48657173-48657195 GTTTTTGTTTTGTTTTGAAATGG + Intronic
973551972 4:52044594-52044616 GTTTTTGTTTGTTTTTGAGACGG - Intergenic
973823303 4:54681966-54681988 GTTTTTGTTTGTTTTTGAGATGG - Intronic
974014561 4:56637025-56637047 GTATTTATGTGTTTTTGTTATGG - Intergenic
974366068 4:60950845-60950867 GTATTTATTTGGTCTGTGTAAGG - Intergenic
974376732 4:61087831-61087853 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
974416355 4:61612110-61612132 TTATTTGTTTGTTTTTTATATGG - Intronic
974486895 4:62517099-62517121 TTGGTTGTTTGGTTTTCGTAAGG + Intergenic
975026755 4:69558638-69558660 GTTTTTGTTTGGTTTTCTTTAGG + Intergenic
975041136 4:69745024-69745046 GTAATTGTAGGGTTTTGATAGGG + Intronic
975366867 4:73539719-73539741 GTTTTTGTTTGGTTTTTGTTTGG - Intergenic
976861763 4:89674147-89674169 GTATTTGTGTGGTTTTGAATGGG - Intergenic
976885970 4:89984532-89984554 TTGTTTGTTTGTTTTTGGTTAGG + Intergenic
976903733 4:90209906-90209928 TTATATGTTTTGTTTTGGTTTGG + Intronic
977063984 4:92289985-92290007 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
977093261 4:92706103-92706125 GTTTTTCTTAGGTTTTGGTCTGG - Intronic
978253401 4:106661401-106661423 TTTTTGTTTTGGTTTTGGTATGG - Intergenic
978326785 4:107566599-107566621 GTATTTATTTAGTTTTGAGACGG - Intergenic
978402295 4:108343631-108343653 TTATTTGTTTGTTTTTGAGATGG + Intergenic
978430157 4:108625368-108625390 TTGTTTGTTTGTTTTTGGTTTGG + Intronic
978694629 4:111562768-111562790 GTATTCTTTTGGTTTTAGTCTGG + Intergenic
978832591 4:113106685-113106707 GTTTTTGTTTTGTTTTGTTTGGG + Intronic
978925877 4:114243284-114243306 GTATTCCATAGGTTTTGGTATGG + Intergenic
979001389 4:115225342-115225364 GTCTTTTGTTGGTTTTGGTGAGG - Intergenic
979291946 4:118988233-118988255 GTATTTGTTCTATTTTGGTTTGG + Intronic
979661253 4:123258245-123258267 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
979801691 4:124917535-124917557 AGAATGGTTTGGTTTTGGTAGGG + Intergenic
980074371 4:128278565-128278587 GTGTTTGTTTGTTTTTGAGAAGG - Intronic
980216661 4:129860643-129860665 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
980690032 4:136283784-136283806 TTCTTTGTCTGGTTTTGGTTAGG - Intergenic
981446102 4:144840104-144840126 TTCTTTGTTTAGTTTTGGGAGGG - Intergenic
981584991 4:146290879-146290901 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
981754298 4:148124228-148124250 GGTTTGGTTTGGTTTTGGGATGG - Intronic
982035206 4:151339205-151339227 GTTTTTGTTTGTTTTTGTTTTGG - Intergenic
982170492 4:152656566-152656588 GTGTTTCTTTGGTGTTGGTTAGG - Intronic
982204365 4:152986055-152986077 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
982751303 4:159165757-159165779 TAATTTGTTTAGTTTTTGTAGGG + Intronic
982984145 4:162183390-162183412 GCATTTGTTTTATTTGGGTATGG + Intergenic
982995100 4:162333948-162333970 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
983804785 4:171981190-171981212 ATATTGGTTTGGTGTTGGTGGGG + Intronic
983804847 4:171982300-171982322 TTGTTTGTTTGTTTTTGATACGG + Intronic
984410954 4:179397273-179397295 GTTTTTGTTTTGTTTTGAGACGG - Intergenic
984810939 4:183796383-183796405 GTGTTTGTTTTGTTTTGTTTTGG - Intergenic
984828467 4:183949691-183949713 TTGTTTGTTTGATTTTGATACGG - Intronic
985064401 4:186105936-186105958 GTGTTTGTTTGGTTTTCTTAAGG + Intronic
985983548 5:3491388-3491410 GGGTTTGTTTGTTTTTGGTTTGG + Intergenic
986008417 5:3687702-3687724 GATTTTGTTTTGTTTTGGTATGG + Intergenic
986065981 5:4234560-4234582 TTATTTGTTTAGTTTTGGCGGGG - Intergenic
986097434 5:4573658-4573680 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
986282074 5:6331540-6331562 TTATTTGTTTGTTTTTGAGATGG + Intergenic
986857464 5:11887444-11887466 GTTTTTGTTTGATTTTAGTGGGG - Intronic
986969294 5:13313595-13313617 TTGTTTGTTTGTTTTTGGTTAGG - Intergenic
987499598 5:18691679-18691701 GTTTTTGTTTGTTTTTGAGACGG + Intergenic
987723851 5:21671789-21671811 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
988479957 5:31621247-31621269 TTATTTGTTTGTTTTTGAGACGG - Intergenic
988643098 5:33063319-33063341 GTATTTGTTTGGTTATATTTGGG - Intergenic
988782798 5:34538604-34538626 ATATTGGTTTTGTTTTGGAAGGG + Intergenic
988960403 5:36365233-36365255 GTTTTGGTTTGGTTTTGAGACGG + Intergenic
989054349 5:37352352-37352374 TTGTTTGTTTGTTTTTGATAAGG - Intronic
989594396 5:43142681-43142703 TGATTTGTTTGGGTTTGGTTTGG + Intronic
989640194 5:43576766-43576788 GTTTGTTTTTGTTTTTGGTAGGG - Intergenic
991071915 5:62492708-62492730 ATTTTTGTGTAGTTTTGGTAGGG + Intronic
991336833 5:65558113-65558135 TTGTTTGTTTGTTTTTGGTATGG - Intronic
991707368 5:69370365-69370387 GTTTTTGTTTTGTTTTGAGACGG + Intronic
991738211 5:69645674-69645696 TTATTTGTTTGTTTTTGTGATGG - Intergenic
992045615 5:72885716-72885738 GTAATGGTTTTGTTTTGGTTTGG + Intronic
992240625 5:74765993-74766015 GTTTTTGTTTTGTTTTGAGACGG - Intronic
992538686 5:77739771-77739793 TTGTTTGTTTGTTTTTGGTAAGG - Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
992806050 5:80339114-80339136 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
992921764 5:81531067-81531089 ATTTTTGTTTTGTTTTGGTTTGG - Intronic
992973749 5:82090076-82090098 GTTTTTGTTTGGTTTGGTTTTGG - Intronic
993035700 5:82755008-82755030 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
993143664 5:84067104-84067126 ATACTTGTTTGTTTTTGGTTTGG - Intronic
993456635 5:88134540-88134562 GTATTTGTTTGACTTTTGTCAGG - Intergenic
993717961 5:91294300-91294322 TTTTTTGTTTGTTTTTGATATGG - Intergenic
993719360 5:91307078-91307100 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
993790934 5:92210294-92210316 TTGTTTGTTTGTTTTTGGAAAGG + Intergenic
993982162 5:94556219-94556241 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
994152508 5:96464107-96464129 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
994260892 5:97657251-97657273 ATTTTTGTTTTGTTTTGTTAAGG + Intergenic
994524959 5:100894452-100894474 GTGTTTGTTTGCTTTTAGTTTGG - Intronic
994600871 5:101903310-101903332 GCTTTTGTTTGTTTTTAGTATGG + Intergenic
994641365 5:102413577-102413599 GTCTTTATTTGGTCTTTGTATGG + Intronic
994746536 5:103685358-103685380 TTATTTGTTTGTTTTTGAGATGG - Intergenic
994850068 5:105043677-105043699 GTTGTTGTTTTGTTTTGGTTTGG + Intergenic
994894289 5:105682275-105682297 TTGTTTGTTTTGTTTTGGTGAGG + Intergenic
994985833 5:106932628-106932650 GTGTTTGTTTTGTTTTGGTTTGG + Intergenic
995052626 5:107723721-107723743 GAATTTGTTTATTTCTGGTAAGG - Intergenic
995350797 5:111173105-111173127 TTTTTTGTTTTTTTTTGGTATGG - Intergenic
995517382 5:112967597-112967619 TTATTTGTTTTGTTTTGAGATGG - Intergenic
995787790 5:115849094-115849116 GTATTTATTTGTTGTTTGTATGG + Intronic
995978198 5:118068389-118068411 GTATCTGTAGGGTTTTGGTGTGG - Intergenic
996024082 5:118624285-118624307 GTATTTGTTGGGGTTCGGAATGG + Intergenic
996281654 5:121736781-121736803 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
996380969 5:122862264-122862286 TTTTTTGTTTGGTTTTGTTAAGG + Intronic
996473802 5:123891802-123891824 GTCCTTGTCTGGTTTTTGTATGG - Intergenic
996669004 5:126094956-126094978 GAGTTTGTGTGGTTTTGATAGGG - Intergenic
996723891 5:126657063-126657085 TTATTTGTTTGTTTTTGAGACGG + Intergenic
996876795 5:128249418-128249440 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
996931291 5:128892018-128892040 TTATTTGTTTGGTTTTGTATTGG + Intronic
997050239 5:130371529-130371551 GTATTTGTTGGGTCTTGGACAGG - Intergenic
997086707 5:130807989-130808011 GTATTTGTTTGGTTTATATGGGG - Intergenic
998142295 5:139706932-139706954 TTATTTGTTTGTTTTTGAGATGG - Intergenic
998739210 5:145179684-145179706 GTTTTTGTTTTGGTTTGGTTTGG - Intergenic
998832899 5:146178613-146178635 GTATTTTTTTTTTTTTGGTGGGG - Intronic
999168927 5:149576238-149576260 TTATTTGTTTGCTTTTGAGACGG - Intronic
999613506 5:153396656-153396678 GTTTTTGTTTTGGTTTGGTTTGG - Intergenic
1000183786 5:158839382-158839404 GTTTTTGTTTTGTTTTGGTGGGG + Intronic
1000563058 5:162814320-162814342 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1000579386 5:163016648-163016670 GTGTGTGTTTTGTTTTGGTTTGG + Intergenic
1000609783 5:163361240-163361262 GTTTTTGTTTGTTTTTGTTTTGG + Intergenic
1000736597 5:164909993-164910015 GTATTTGTCTATTTATGGTAGGG - Intergenic
1002048353 5:176554657-176554679 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1002124630 5:177033526-177033548 GTTTTTGTTTTGTTTTGAGATGG + Intronic
1002284452 5:178153078-178153100 GTTTTTGTTTGTTTTTGAGATGG - Intronic
1002417552 5:179128394-179128416 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1002627585 5:180541774-180541796 GTATTTTTTTGTTTTTGAGATGG + Intronic
1002723373 5:181279799-181279821 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1004293505 6:14389533-14389555 TTGTTTGTTTTGTTTTGGTTTGG + Intergenic
1004373934 6:15075819-15075841 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1004586872 6:17011252-17011274 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
1005490390 6:26342426-26342448 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1005634901 6:27744097-27744119 GTTTTTGTTTGTTTTTGGTGGGG + Intergenic
1005637224 6:27763965-27763987 TTGTTTGTTTGGTTTTGAGACGG - Intergenic
1006297813 6:33177810-33177832 GTGTTTGCTTGGGTTTGGGATGG - Intronic
1006769529 6:36540901-36540923 TTATTTGTTTGTTTTTGAGAAGG + Intronic
1006770563 6:36549135-36549157 GTTTTTGTTTTGTTTTGAGACGG + Intergenic
1007499220 6:42282567-42282589 TTTTTTGTTTTGTTTTGGTTCGG - Intronic
1007681618 6:43637601-43637623 TTGTTTGTTTGTTTTTGATAGGG + Intronic
1007770423 6:44187513-44187535 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1008043749 6:46830546-46830568 GTATTTGCTTTCTTTTGTTATGG - Intronic
1008203041 6:48616083-48616105 GGATTTGTGTGGTTTTGAAAGGG - Intergenic
1008495610 6:52130522-52130544 TTGTTTGTTTGTTTTTGGTGTGG + Intergenic
1008820164 6:55622722-55622744 TTTTTTGTTTTGTTTTGGTCTGG + Intergenic
1008945197 6:57089811-57089833 GTATTTGTTTGGTTTTGGTATGG - Intronic
1009750963 6:67879031-67879053 GTGTTTTTATGATTTTGGTATGG + Intergenic
1009856108 6:69266055-69266077 TTATTTGTTTGTTTTTTGAAAGG + Intronic
1011004154 6:82625001-82625023 GTTTTTCTTTTGTTTTGGTTAGG + Intergenic
1011044236 6:83064607-83064629 GTTTTTGTTTTATTTTGGTAGGG + Intronic
1011138144 6:84121637-84121659 GTTTTTGTTTGTTTTTGAGACGG - Intergenic
1011542433 6:88446446-88446468 TTAATTGTTTTGTTTTGGTTTGG + Intergenic
1011610721 6:89147497-89147519 GCATTTGTTAGGTTTTTGTTTGG + Intronic
1011899761 6:92277449-92277471 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1012295117 6:97512748-97512770 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1012404875 6:98885107-98885129 GTGTTTGTTTGTTTTTGAGATGG + Intronic
1013165183 6:107583692-107583714 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1013220176 6:108071292-108071314 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1013648975 6:112174492-112174514 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1013674113 6:112437917-112437939 GGTTTTGTTTTGTTTTGGCAGGG - Intergenic
1014221761 6:118805232-118805254 TTATTTTTTTTTTTTTGGTAGGG - Intergenic
1014453434 6:121609393-121609415 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1014851748 6:126349030-126349052 CTATTATTTTGGTTTTGGGAGGG - Intergenic
1014950107 6:127544198-127544220 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1015138753 6:129905690-129905712 GTACTTGTCAGGTTTTTGTATGG - Intergenic
1015286554 6:131491831-131491853 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1015331586 6:131985809-131985831 TTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1016804353 6:148197852-148197874 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
1016819849 6:148337058-148337080 GTTTTTGTTTTGTTTTGTTTGGG + Intronic
1016871063 6:148817156-148817178 GTTTATTTTTGGTTTTGGTTTGG + Intronic
1017016422 6:150104626-150104648 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1017199587 6:151738136-151738158 TTGTTTGTTTTGTTTTGGTGTGG + Intronic
1017275569 6:152564018-152564040 ATATTTGTTTGTCTTTTGTAAGG - Intronic
1017561321 6:155631640-155631662 GTTTTGTTTTGGTTTTGGTTTGG - Intergenic
1017685782 6:156912867-156912889 GTTTTTGTTTTGTTTTGTTTGGG - Intronic
1017695426 6:157010327-157010349 GTTTTGGTTTGGTTTTGAGATGG + Intronic
1017745355 6:157442389-157442411 GAAGTTGTTTTGTTTTGGTTTGG - Intronic
1017839592 6:158210414-158210436 GGTTTTGTTTTGTTTTGATATGG + Intergenic
1017992452 6:159503369-159503391 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1018102061 6:160449222-160449244 GTTTTTGTTTGTTTTTGGCTTGG + Intronic
1018151992 6:160948410-160948432 GTTTTGTTTTGGTTTTGGTTTGG + Intergenic
1018183082 6:161241735-161241757 GTTTTTGTTTGTTTTTGAGATGG + Intronic
1018434021 6:163744912-163744934 GTATTTGTTGTGCTTTGGGATGG + Intergenic
1018783179 6:167087397-167087419 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1019495162 7:1334808-1334830 GTTTTTGTTTTGTTTTGAGACGG + Intergenic
1020030252 7:4927714-4927736 TTGTTTGTTTTGTTTTGGTTTGG - Intronic
1020167146 7:5816668-5816690 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1020204342 7:6103901-6103923 TTGTTTGTTTGTTTTTGGTGTGG - Intergenic
1021123213 7:16820581-16820603 GGCTTTGTTTTGTTTTGGTACGG + Intronic
1021254843 7:18378752-18378774 TGTTTTGTTTTGTTTTGGTATGG - Intronic
1021303095 7:18996578-18996600 TTGTTTGTTTTGTTTTGTTAGGG + Intronic
1021583736 7:22185572-22185594 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1022204807 7:28153477-28153499 TTTTTTGTTTGGTTTTGTTTTGG - Intronic
1022353664 7:29589461-29589483 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1022666731 7:32417982-32418004 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1022866124 7:34422855-34422877 GTATTTCTCAGGTTTTGGGATGG - Intergenic
1022918383 7:34985027-34985049 GTGTTGGTAAGGTTTTGGTAAGG - Intronic
1023168569 7:37367728-37367750 TTGTTTGTTTGTTTCTGGTAGGG - Intronic
1023489736 7:40726221-40726243 GTGATTGTTTGTTATTGGTAAGG - Intronic
1023776723 7:43615180-43615202 TTGTTTGTTTGTTTTTGATAGGG + Intronic
1024658168 7:51469684-51469706 ATATTTGTTAGCTTTTGGAAAGG - Intergenic
1025637332 7:63334156-63334178 GTTGTTGTTTGGTTTTGGTTTGG + Intergenic
1025645363 7:63413943-63413965 GTTGTTGTTTGGTTTTGGTTTGG - Intergenic
1025804829 7:64821092-64821114 TTGTTTGTTTGTTTTTGGGACGG + Intronic
1026161065 7:67869294-67869316 TTTTTTGTTTTGTTTTGATATGG - Intergenic
1026578064 7:71591059-71591081 CCATTTGTTTGGTTTTGAGACGG + Intronic
1026622754 7:71964670-71964692 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1026688217 7:72530790-72530812 TTGTTTGTTTTGTTTTGGTTTGG + Intergenic
1027224882 7:76237568-76237590 GTTTTTGTTTTGTTTTGAGATGG - Intronic
1027240300 7:76323239-76323261 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1027552666 7:79618822-79618844 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1027581887 7:80007010-80007032 GTTTTTGTTTTGTTTTGTTTAGG + Intergenic
1027733541 7:81904965-81904987 TTATTTGTTTTGTTTTGTTTTGG + Intergenic
1027913441 7:84282686-84282708 GTTTTTGTTTAGTTTTGGTGGGG - Intronic
1027947029 7:84760051-84760073 GTAATTGTTTGGTCTGGATATGG - Intergenic
1028033378 7:85947909-85947931 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
1028039907 7:86038567-86038589 ATATTTGTTTTGTTTTGTTTGGG + Intergenic
1028112582 7:86960253-86960275 GTTTTTGTTTGTTTTTGAGACGG + Intronic
1028583654 7:92432355-92432377 GTATTTGTAGGGTTGTTGTAAGG + Intergenic
1028626557 7:92883762-92883784 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1028702958 7:93804353-93804375 GTTTTGGTTTGGTTTTGCTCAGG - Intronic
1028859167 7:95628376-95628398 GTGTTTGTTTGGTGTTTGTTTGG + Intergenic
1029097036 7:98094752-98094774 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1029165567 7:98587461-98587483 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1029285427 7:99462461-99462483 GTTTTTGTTTGTTTTTGACACGG - Intronic
1029661606 7:101966062-101966084 GTGTTTGTTTTGTTTTGTTTTGG + Intronic
1029686017 7:102148536-102148558 TTGTTTGTTTGTTTTTGATACGG - Intronic
1029711584 7:102302924-102302946 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1029846834 7:103420460-103420482 GTTTTTGTTTGTTTTTGTTTTGG + Intronic
1030095008 7:105890978-105891000 GTGAATGTTTGGTTTTGATAAGG + Intronic
1030531230 7:110713669-110713691 GTTTTTGTTTGTTTTTGTTTTGG + Intronic
1030736714 7:113057508-113057530 GTGTTTGCTTGGTTTGGGTTTGG - Intergenic
1030916063 7:115315218-115315240 TTGTTTGTTTTGTTTTGGTATGG - Intergenic
1031410228 7:121432715-121432737 GTTTTTGTTTTGTTTTGACAAGG - Intergenic
1031536003 7:122933650-122933672 TTATGTTTTTGGTTCTGGTAGGG + Intergenic
1031748505 7:125537877-125537899 GTTTTTGTTTGTTTTTGAGATGG - Intergenic
1031850922 7:126861962-126861984 GTTTTTGTTTTGTTTTGTTTGGG + Intronic
1031869606 7:127077562-127077584 GTTTTTATTTTGTTTTGGTTAGG - Intronic
1032000361 7:128261195-128261217 TTATTTGTTTGGTTTAGTGATGG + Intergenic
1032031108 7:128484584-128484606 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1032168389 7:129563758-129563780 GAATTTGTTAGGTTATGGCAAGG - Intergenic
1032803319 7:135333835-135333857 GTTTTTGTTCGGTTATGGTGAGG + Intergenic
1032831778 7:135634569-135634591 GTTTTTGCTTGGTTTTGTTTTGG + Intronic
1032849106 7:135777652-135777674 GTACCTATTTGCTTTTGGTATGG - Intergenic
1033053320 7:138026979-138027001 GTAGTTATTGGGTATTGGTATGG - Intronic
1033079568 7:138282568-138282590 GTATTTATTAGGTATTGATATGG + Intergenic
1033090029 7:138377177-138377199 TTGTTTGTTTGGTTTTGAGATGG - Intergenic
1033158422 7:138976014-138976036 GTTTTTGCTTGGTTTTGTTTGGG - Intronic
1033175475 7:139119687-139119709 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1033346370 7:140528188-140528210 GTTTTTGTTTTGTTTGTGTAGGG - Intronic
1034056896 7:148044808-148044830 GTGTATGTTTTGTTTTGGTTCGG + Intronic
1034466794 7:151234493-151234515 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1034567471 7:151926839-151926861 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1034568585 7:151935861-151935883 GTGTTTGTTTGTTTTTGAGATGG + Intergenic
1034616890 7:152425571-152425593 GTGTTTGTTTGTTTTTGAGACGG - Intronic
1034861824 7:154602420-154602442 GTTTTTGTTTTGTTTTGAGATGG + Intronic
1034906722 7:154955029-154955051 GATTTTGTTTTGTTTTGGTGAGG - Intronic
1035348065 7:158220522-158220544 GTTTTTGTTTTGGTTTGCTAAGG - Intronic
1035547382 8:493779-493801 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1035653575 8:1287994-1288016 GTGTTTGTGTGGTTCTGTTAGGG + Intergenic
1035974433 8:4292119-4292141 ATATTTCTTTGTTGTTGGTATGG - Intronic
1036204662 8:6796180-6796202 GTTTTTGTTTGTTTTTGAGATGG - Intergenic
1038203312 8:25437671-25437693 GTATTTTTTTTGTTTTGAGATGG - Intronic
1038847691 8:31244742-31244764 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1039057363 8:33547650-33547672 GTGTGTGTTTGATTTGGGTATGG + Intergenic
1039465192 8:37780368-37780390 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1039631603 8:39118118-39118140 GTATTTGTTTGGATTTTCTCTGG - Exonic
1039695338 8:39904559-39904581 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1039929092 8:41967101-41967123 GGATTCCTTTGGTTTTTGTATGG - Intronic
1040059846 8:43094371-43094393 TTTTTTGTTTTGTTTTGGTTTGG - Intronic
1040059949 8:43095353-43095375 TTATTTGTTTTGTTTTGGTTTGG + Intronic
1040623811 8:49121387-49121409 GTTTTTTTTTTTTTTTGGTAGGG + Intergenic
1040676374 8:49756089-49756111 GTTTTTGTTTGTTTTTGAGATGG + Intergenic
1040897480 8:52383914-52383936 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1041207728 8:55515217-55515239 TAATATGTTTAGTTTTGGTAGGG - Intronic
1041239094 8:55833580-55833602 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1041360147 8:57044573-57044595 GGATTTGTTTTGTTTTTATATGG - Intergenic
1041841169 8:62273380-62273402 GTATTGTTTTTGTTTTGGAATGG - Intronic
1041948285 8:63471713-63471735 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1042358959 8:67860598-67860620 GTTTTTGTTTTGTTTTGTTTGGG + Intergenic
1043059583 8:75482670-75482692 GTTTTTGTTTTGTTTTGTTTTGG + Intronic
1043563911 8:81526655-81526677 GTTTTTGTTTGGTGTTGAGATGG + Intronic
1043671198 8:82886791-82886813 GTATTTTTTTGTTTATTGTAAGG - Intergenic
1043688673 8:83122929-83122951 GTATTTTTTTTTTTTTGGTGAGG + Intergenic
1043918448 8:85952262-85952284 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1043941677 8:86203275-86203297 TTATTTGTTTGTTTTTGCAATGG - Intergenic
1044045620 8:87427965-87427987 CTATTGGTTTGGTTTGGGTAGGG + Intronic
1044242657 8:89904408-89904430 GTATTTGCTATGTTTTGGTCTGG + Intronic
1044336643 8:90991690-90991712 GCTTTTGTTTAGTTTTGATATGG - Intergenic
1044522856 8:93219604-93219626 GTTTTGGTTTGGTTTTAGGATGG - Intergenic
1044522858 8:93219615-93219637 TTCTTTGTTTTGTTTTGGTTTGG - Intergenic
1045936937 8:107690794-107690816 ATATTTGTTTTGTTTTTGTTTGG - Intergenic
1046030379 8:108776159-108776181 GATTTTGTTGGGTTTTGGTATGG + Intronic
1046130764 8:109965215-109965237 TTCTTTGTTTTGTTTTGGTTTGG - Exonic
1046717458 8:117583457-117583479 GTATGTGCTTTGGTTTGGTAAGG + Intergenic
1046868588 8:119178178-119178200 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1046892962 8:119442910-119442932 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1047124613 8:121947380-121947402 TTATTTGTTTGGTTAGGGTTAGG - Intergenic
1047400793 8:124545526-124545548 GTATTTCTTTTGTTTTTGTTTGG + Intronic
1047433953 8:124818715-124818737 GTAGTTGTAAGGTTTGGGTAGGG - Intergenic
1047570749 8:126095910-126095932 TTATTTGTTTGTTTTTGAAATGG - Intergenic
1048470008 8:134697087-134697109 GTTTTGGTTTGTTTTTGGTTTGG + Intronic
1048619236 8:136113706-136113728 GTTTTTGTTTTGTTTTGAGATGG + Intergenic
1049090149 8:140508672-140508694 GGATTTGTTTGTTTTTGAGATGG + Intergenic
1050108857 9:2194245-2194267 GTATTTGTTTAGTTTTAGCCAGG + Intergenic
1050310472 9:4347702-4347724 TTGTTTGTTTGTTTTTGGTTTGG + Intronic
1050512363 9:6409379-6409401 TTGTTTGTTTGGTTTTGAGATGG - Intergenic
1051177029 9:14371102-14371124 TTGTTTGTTTTGTTTTGGTTTGG - Intronic
1051313400 9:15802092-15802114 GTCTTTGTCTGATTTTGATAAGG + Intronic
1051543386 9:18246810-18246832 GTATTTGTTTAATTTTGATGTGG - Intergenic
1051760117 9:20453554-20453576 GGTTTTGTTTTGTTTTGGTGGGG - Intronic
1051997159 9:23231864-23231886 GTTTTTGTTTTGGTTTGGTTTGG + Intergenic
1052162261 9:25278904-25278926 CTAGTGGTTTGGTTTTGTTAAGG - Intergenic
1052905680 9:33831662-33831684 TTATTTGTTTGTTTTTGAGACGG + Intronic
1052974212 9:34400004-34400026 GTGGTTGTTTGGATGTGGTAGGG - Exonic
1053333005 9:37233856-37233878 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1053370237 9:37555055-37555077 GTTTTTGTTTGTTTTTTGCAGGG + Intronic
1053510849 9:38686745-38686767 GCGTTTGTTTGGTTTTGGCTGGG - Intergenic
1053538767 9:38951868-38951890 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1053566241 9:39255490-39255512 TTATTTGTTTTGTTTTGTTTTGG - Intronic
1053658142 9:40241465-40241487 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1053791746 9:41691170-41691192 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1053832015 9:42093350-42093372 TAATTTGTTTTGTTTTGGTTTGG - Intronic
1054107524 9:61069242-61069264 TTATTTGTTTGTTTTTGAGATGG - Intergenic
1054130908 9:61363518-61363540 TTATTTGTTTTGTTTTGTTTTGG + Intergenic
1054180150 9:61903185-61903207 TTGTTTGTTTGTTTTTGGGATGG - Intergenic
1054358642 9:64090395-64090417 GTTTTTGTTTTGGTTTGGTTTGG - Intergenic
1054361578 9:64126648-64126670 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1054370263 9:64387740-64387762 GTTTTTGTTTTGGTTTGGTTTGG - Intronic
1054526456 9:66134756-66134778 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1054613333 9:67261883-67261905 TTATTTGTTTGTTTTTGAGATGG + Intergenic
1054677894 9:67877496-67877518 GTTTTTGTTTTGGTTTGGTTTGG - Intronic
1054837090 9:69687356-69687378 GTTTTTGTTTGTTTTTGAGACGG + Intergenic
1055263327 9:74465625-74465647 GGACTTGTTTGGTCTTAGTATGG - Intergenic
1055709338 9:79042495-79042517 GTATTTGTTTTGTTTTTGGGGGG + Intergenic
1055749375 9:79487814-79487836 GTATTGGTTTGGTTCTGATCTGG - Intergenic
1056134455 9:83618047-83618069 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1056596573 9:88012665-88012687 GTTTTTGTTTGTTTTTGAGATGG - Intergenic
1056910968 9:90700330-90700352 TTATTTGTTTGTTTTTGAGACGG + Intergenic
1058154265 9:101495843-101495865 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1058286456 9:103186198-103186220 GTTTTTGTTTTGTTTTAGTTTGG - Intergenic
1058446246 9:105057883-105057905 TTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1058487960 9:105461351-105461373 GTTTTTCTTTTTTTTTGGTACGG - Intronic
1058759110 9:108112753-108112775 TTATTTTTTTTGTTTTGGTTTGG + Intergenic
1058860556 9:109114076-109114098 GTTTTTGTTTTGTTTTGTTTTGG - Intronic
1059516118 9:114897270-114897292 TTTTTTCTTTTGTTTTGGTATGG + Intronic
1059773742 9:117453413-117453435 TTTTTTGTTTGGTTTTGAGATGG - Intergenic
1059784062 9:117561585-117561607 GTAACTGTATGGTTTTGGTGAGG - Intergenic
1059915908 9:119099947-119099969 TTATTTGTTTTGTTTTGGTTTGG + Intergenic
1061038187 9:128125046-128125068 GCAGGTGTTTGGTTTTGGTACGG + Intronic
1061084701 9:128392212-128392234 GGATTTGTTTTGTTTAGGTAGGG + Intergenic
1061831193 9:133296269-133296291 TTGTTTGTTTGTTTTTGATACGG - Intergenic
1062660191 9:137626960-137626982 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1062743808 9:138197990-138198012 GTTTTTTTTTGCATTTGGTAGGG + Intergenic
1203571344 Un_KI270744v1:135055-135077 TGCTTTGCTTGGTTTTGGTAGGG - Intergenic
1185624097 X:1470513-1470535 GTTTTTGTTTTGTTTTGAGATGG - Intronic
1185719738 X:2372201-2372223 GAATTTTTCTGGTTCTGGTAAGG - Intronic
1185966964 X:4616948-4616970 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1186372037 X:8956602-8956624 TTTTTTGTTTGTTTTTGTTAAGG - Intergenic
1186474290 X:9845249-9845271 GTTTTTGTTTTGCTTTGTTAGGG + Intronic
1187458936 X:19467822-19467844 GTTTTTGTTTTGTTTTGAGACGG - Intronic
1187566302 X:20452713-20452735 GTTTTTGTTTTGTTTTGTTCTGG - Intergenic
1187880556 X:23843002-23843024 GTTTTTGTTTGTTTTTGAGATGG - Intronic
1188045504 X:25421810-25421832 CTTTTTGTTTGGTTTTGCTTTGG + Intergenic
1188161127 X:26804603-26804625 CTAGTTGTTTGCTTTTGGCAGGG - Intergenic
1188269811 X:28124952-28124974 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
1188448185 X:30279548-30279570 ATGTATGTATGGTTTTGGTAAGG - Intergenic
1188449837 X:30297210-30297232 GTTTTGTTTTGTTTTTGGTATGG + Intergenic
1188491388 X:30742065-30742087 GTTTTTGTTTTGTTTTTTTAAGG + Intergenic
1188558278 X:31436894-31436916 GTATGTGTTTGTTTTTGAAAAGG - Intronic
1188612858 X:32120712-32120734 GAATTTGTATGAGTTTGGTAAGG - Intronic
1188677563 X:32961137-32961159 GTTTTTGTTTCGTTTTGGTATGG + Intronic
1189300061 X:39945999-39946021 GTTTTTCTTTGGTTTTGGGGGGG + Intergenic
1189427190 X:40912140-40912162 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1189650543 X:43184323-43184345 GCATTTGGTTGGTATTTGTAGGG - Intergenic
1189703561 X:43736810-43736832 ATATTTGTTTTGTTTTGTTTTGG + Intronic
1190042057 X:47079362-47079384 TTTTTTGTTTTGTTTTGGTTTGG + Intronic
1190725125 X:53184790-53184812 GTCTTTATCTGGTTTGGGTAGGG + Intergenic
1190850421 X:54234849-54234871 GCTTTTGTTTTGTTTTGGTTTGG - Intronic
1191081134 X:56510809-56510831 GTATTTGTGTGGTTTTGGGTGGG - Intergenic
1191148960 X:57200240-57200262 GTATCTGTATGTTTTTGGTTTGG + Intergenic
1191801248 X:65082774-65082796 GTCTTTGTCTGGTTTTGGTAGGG - Intergenic
1192011128 X:67274172-67274194 GTATCTCATAGGTTTTGGTATGG + Intergenic
1192301077 X:69903821-69903843 GTTTTTGTTTTGTTTTGAGACGG + Intronic
1193370433 X:80690630-80690652 GTAATTTTTTTGTTTTGGTTGGG - Intronic
1193385440 X:80865800-80865822 GTATTATTTTGTTTATGGTAAGG + Intergenic
1193950889 X:87796740-87796762 GTTTTTGTTTTGGTTTGGTTTGG - Intergenic
1194697587 X:97074035-97074057 GATTTTGTTTTCTTTTGGTATGG + Intronic
1194822027 X:98521487-98521509 GTATTTGTTTGGCTCTAGCATGG + Intergenic
1194878231 X:99216900-99216922 GTTTCTGTTTTGTTTTGGTTTGG - Intergenic
1195123835 X:101785110-101785132 GTTTTTGTTTTGTTTTGTTTGGG - Intergenic
1195378111 X:104247358-104247380 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1195671380 X:107473020-107473042 GTTTTTGATTGGCTTGGGTAAGG - Intergenic
1195918412 X:109958280-109958302 GTTTTTGTTTTGTTTTGTTTTGG + Intergenic
1196084357 X:111668180-111668202 GTAATTGTTTGTTTTTGAGACGG - Intronic
1196143760 X:112294614-112294636 GTTTTTGTTTTGTTTTGTTTTGG - Intergenic
1196201173 X:112887409-112887431 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1196883499 X:120221936-120221958 GAATTTGTTTAGTGGTGGTAGGG + Intergenic
1196979686 X:121197555-121197577 GTTTTTGTTTTGTTTTGAAACGG - Intergenic
1197268695 X:124403150-124403172 GTTGTTGTTTGGTTTTGTTTGGG - Intronic
1197582528 X:128301675-128301697 GTATTTCTTTGGAATTGGTTGGG - Intergenic
1197688181 X:129466648-129466670 TTATTTGTTTGTTTTTGAGATGG - Intronic
1198024312 X:132690243-132690265 TTGTTTGTTTGTTTTTGGTATGG - Intronic
1198535448 X:137581535-137581557 TTGTTTGTTTGTTTTTGGTATGG + Intergenic
1198548085 X:137715080-137715102 GTCCTTGTCTGGTTTTGGTAAGG + Intergenic
1198610284 X:138391938-138391960 GTTTTTGTTTTGTTTTGAGATGG - Intergenic
1198740482 X:139836512-139836534 GTTTTTGTTTGTTTTTGTTTTGG - Intronic
1199064061 X:143392940-143392962 GTATTTGTTTGATTTTGTGTTGG + Intergenic
1199096284 X:143744486-143744508 GTTTTTGTTTGGTTTGGTTTTGG + Intergenic
1201359375 Y:13129765-13129787 GTTTTGGTTTGGTTTTGTTAAGG - Intergenic
1202097964 Y:21273266-21273288 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1202133267 Y:21634084-21634106 GTTTTTGTTTAGTTTGGGTTTGG + Intergenic
1202247894 Y:22838464-22838486 TTGTTTGTTTGTTTTTGGTGGGG + Intergenic
1202303837 Y:23446892-23446914 TTATTTTCTTGGTTTTGGCAGGG - Intergenic
1202400881 Y:24472212-24472234 TTGTTTGTTTGTTTTTGGTGGGG + Intergenic
1202469898 Y:25197874-25197896 TTGTTTGTTTGTTTTTGGTGGGG - Intergenic
1202566973 Y:26223699-26223721 TTATTTTCTTGGTTTTGGCAGGG + Intergenic
1202598397 Y:26567835-26567857 GTCTTTGTTTTGTTTTGTTTGGG - Intergenic