ID: 1008952027

View in Genome Browser
Species Human (GRCh38)
Location 6:57172195-57172217
Sequence CCCCACGCGAAGGTTCCTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952027_1008952034 9 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952034 6:57172227-57172249 TACTTTTAGGTTGCATGAAGAGG 0: 1
1: 1
2: 0
3: 6
4: 139
1008952027_1008952037 14 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952037 6:57172232-57172254 TTAGGTTGCATGAAGAGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 73
1008952027_1008952035 12 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952035 6:57172230-57172252 TTTTAGGTTGCATGAAGAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 183
1008952027_1008952039 23 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952039 6:57172241-57172263 ATGAAGAGGCGGGGCCTCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 126
1008952027_1008952036 13 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952036 6:57172231-57172253 TTTAGGTTGCATGAAGAGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 139
1008952027_1008952041 27 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952041 6:57172245-57172267 AGAGGCGGGGCCTCGCGGGGCGG 0: 1
1: 2
2: 4
3: 66
4: 476
1008952027_1008952038 22 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952038 6:57172240-57172262 CATGAAGAGGCGGGGCCTCGCGG 0: 1
1: 0
2: 4
3: 23
4: 323
1008952027_1008952040 24 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952040 6:57172242-57172264 TGAAGAGGCGGGGCCTCGCGGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1008952027_1008952033 -4 Left 1008952027 6:57172195-57172217 CCGATAGGAACCTTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008952033 6:57172214-57172236 GGGGGGAGTTGGTTACTTTTAGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952027 Original CRISPR CCCCACGCGAAGGTTCCTAT CGG (reversed) Intergenic
900416292 1:2536376-2536398 CCACATGCATAGGTTCCTATGGG + Intergenic
904258878 1:29275667-29275689 CCTCACGTGAACGTTCCGATAGG - Exonic
924778626 1:247128323-247128345 CACCACGTGAAGGTTCCAAAGGG - Intronic
924783028 1:247170096-247170118 CACCACGTGAAGGTTCCAAAGGG + Intronic
1086690822 11:89787315-89787337 CCCCACGCACAGGGTCCTCTCGG - Intergenic
1086714978 11:90052340-90052362 CCCCACGCACAGGGTCCTCTCGG + Intergenic
1097041423 12:56158273-56158295 ACCCAGGCCACGGTTCCTATTGG + Exonic
1106243591 13:27928468-27928490 CCCCACGCGAGTCTTCCTGTGGG - Intergenic
1118906217 14:70025354-70025376 TCCCAAGCCCAGGTTCCTATGGG - Intronic
1138911523 16:61405418-61405440 CCACACTAGAAGGTTCCAATTGG + Intergenic
1141774133 16:86111010-86111032 ACCCAGGGGAAGGTTCCAATTGG + Intergenic
1146571668 17:33958311-33958333 CCCCACACAAAGTTTCCAATGGG - Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1176194739 20:63831732-63831754 GCCCACGCGCAGGTTCCTCGGGG + Intergenic
949837158 3:8281443-8281465 CCTCACGTGGAGGTTCCTGTGGG - Intergenic
991913770 5:71586639-71586661 ACCCACTAGAAGTTTCCTATTGG + Intergenic
1008952027 6:57172195-57172217 CCCCACGCGAAGGTTCCTATCGG - Intergenic
1018259296 6:161953443-161953465 CCCCACCCTAAATTTCCTATTGG - Intronic
1018942532 6:168319196-168319218 CCCCGCGCGCAGGTGCCTAGAGG - Intronic
1048151348 8:131897856-131897878 CACCAGGGGAAGGTTTCTATAGG + Intergenic
1050496728 9:6250684-6250706 CCTCACTCCAAGGTTCCTTTTGG + Intronic
1052169049 9:25371687-25371709 CCCCACCCCAAGGTTCTCATGGG - Intergenic