ID: 1008952489

View in Genome Browser
Species Human (GRCh38)
Location 6:57175875-57175897
Sequence GTTCCCATGTCCCCCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 32, 2: 86, 3: 216, 4: 573}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952489_1008952498 29 Left 1008952489 6:57175875-57175897 CCCAAAGAGGGGGACATGGGAAC 0: 1
1: 32
2: 86
3: 216
4: 573
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952489_1008952495 10 Left 1008952489 6:57175875-57175897 CCCAAAGAGGGGGACATGGGAAC 0: 1
1: 32
2: 86
3: 216
4: 573
Right 1008952495 6:57175908-57175930 AGCCAGTTGGTCAGAAGTTCTGG 0: 14
1: 54
2: 156
3: 288
4: 577
1008952489_1008952497 13 Left 1008952489 6:57175875-57175897 CCCAAAGAGGGGGACATGGGAAC 0: 1
1: 32
2: 86
3: 216
4: 573
Right 1008952497 6:57175911-57175933 CAGTTGGTCAGAAGTTCTGGAGG 0: 16
1: 29
2: 95
3: 185
4: 443
1008952489_1008952491 -3 Left 1008952489 6:57175875-57175897 CCCAAAGAGGGGGACATGGGAAC 0: 1
1: 32
2: 86
3: 216
4: 573
Right 1008952491 6:57175895-57175917 AACCCCAATTTGAAGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952489 Original CRISPR GTTCCCATGTCCCCCTCTTT GGG (reversed) Intronic
900745463 1:4357629-4357651 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
900845461 1:5096723-5096745 GTTCCCATAACCCCCTCCTCAGG - Intergenic
901385192 1:8903562-8903584 GTTCCCATGACCCCCTCTTTGGG - Intergenic
901886181 1:12224868-12224890 GTTCCCATGACCCCTCCCTTAGG + Intergenic
902585159 1:17434570-17434592 GTTCTCATGACCCCCTCTTTGGG - Intronic
903102212 1:21040476-21040498 GATCTCATGATCCCCTCTTTGGG - Intronic
903281348 1:22251760-22251782 CCATCCATGTCCCCCTCTTTGGG + Intergenic
903532648 1:24043564-24043586 GTTCCAATGTCACCTTCTTAAGG + Intergenic
904059392 1:27696156-27696178 GTCTCCATGATCCCCTCTTTGGG + Intergenic
904218284 1:28942383-28942405 GTTCCCACAACCCCCTCTTTGGG + Intronic
904544868 1:31261496-31261518 GTTTCCCTTTCCCCCTCGTTGGG + Intronic
904868254 1:33599694-33599716 GTTCCCATGCCCCTCTCATTGGG - Intronic
905280906 1:36848937-36848959 GGACACCTGTCCCCCTCTTTGGG - Intronic
905558647 1:38908582-38908604 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
905569212 1:38991036-38991058 GGTCCCATCCCCCCCGCTTTGGG - Intergenic
905692094 1:39950993-39951015 GTTCCCATGATCCCCTCTTTGGG + Intergenic
905810373 1:40908360-40908382 GGTCCCATGACCCCCTTTTTGGG - Intergenic
906433208 1:45772906-45772928 GTTCCCACATCTCCCTGTTTGGG - Intergenic
906470285 1:46124100-46124122 TATCCCATGTCTACCTCTTTGGG - Intronic
906482744 1:46210551-46210573 GTTCCTATGACCCCCTCCTTGGG + Intronic
906860883 1:49357939-49357961 GGTCCCATGTCCATGTCTTTAGG + Intronic
907035233 1:51210574-51210596 GTTCCCACAACCCCCACTTTGGG + Intergenic
907103236 1:51856458-51856480 GTTCCCACGACCTCCTCTTTGGG + Intronic
907169884 1:52452811-52452833 GTTCCTATGACGACCTCTTTGGG - Intronic
907801129 1:57766845-57766867 GTTCCCACGACCCCCTTTTCAGG + Intronic
908120944 1:60985323-60985345 GTCCCCATGGCACCCTGTTTAGG - Intronic
908420509 1:63954252-63954274 TTTCCCATCTCCCCCTCCCTGGG - Intronic
908560499 1:65301527-65301549 GTTCCCATGATCCCCTCTTTGGG + Intronic
908689697 1:66764444-66764466 TTTCCCATGTCTCTCTCTTTGGG - Intronic
908748970 1:67401449-67401471 GTTCCCACAGCCCCTTCTTTGGG - Intergenic
908908792 1:69047877-69047899 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
910035585 1:82783770-82783792 GCTCTCATGGCCCCCTCTTTGGG - Intergenic
910076009 1:83279895-83279917 GTTCCCATGACCCCCTCCTTCGG + Intergenic
910229265 1:84969229-84969251 GTTCCCATGACTCCCTCTTTGGG - Intronic
910589023 1:88909232-88909254 GTGCCCATTTCCCCATATTTGGG + Intergenic
910845682 1:91602498-91602520 TTTTCCATGTCACCCTCGTTGGG - Intergenic
910914858 1:92277881-92277903 ATTCCCAGGACCCCCTCCTTGGG - Intronic
911435967 1:97857750-97857772 ATTCCCATGACCACCTCTTTGGG - Intronic
911749463 1:101479999-101480021 GTTCCCATGATCCCCTCCTCAGG + Intergenic
911846974 1:102765922-102765944 GTTCCCATGACCCTCTCCTCAGG - Intergenic
912134933 1:106649205-106649227 GTTCCCATGACCCCCTCTTTGGG - Intergenic
913171872 1:116240502-116240524 GTTACCACAACCCCCTCTTTGGG - Intergenic
913670211 1:121090774-121090796 GTTACAATTTCCCACTCTTTTGG + Intronic
914021978 1:143878216-143878238 GTTACAATTTCCCACTCTTTTGG + Intergenic
914095985 1:144544685-144544707 GAACCCCTGTCTCCCTCTTTTGG + Intergenic
914660459 1:149786144-149786166 GTTACAATTTCCCACTCTTTTGG + Intronic
914698889 1:150112776-150112798 GTTCCCATGACCCCTTCCTCAGG + Intronic
915016716 1:152741158-152741180 GTTCCCATGACCCCCTCCTCAGG + Intronic
915864039 1:159478828-159478850 GTTGCCCTGTGACCCTCTTTGGG + Intergenic
916553806 1:165875625-165875647 GTTCCCATAACCCCCTCTTAGGG + Intronic
917543329 1:175936652-175936674 GTTCCCATGAACCCTTCTTTGGG - Intergenic
917995792 1:180437234-180437256 GTTCCCATGACCCCCTCTTTGGG - Intronic
918508404 1:185282911-185282933 GTTCCCATGACTCCCTCTTCAGG + Intronic
919183661 1:194117711-194117733 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
919193495 1:194253478-194253500 GTTCCCATGACCCTCTCTTTGGG - Intergenic
919493092 1:198229416-198229438 GTTCCCCTGACCCCCTCTCTGGG - Intronic
919539064 1:198827124-198827146 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
919678755 1:200412011-200412033 GTTCCCATGACCCCTTCCTTGGG - Intergenic
919715269 1:200769577-200769599 GTTCCCATGACCCCCTCTTTGGG + Intronic
919760015 1:201091904-201091926 GTTCCCTTGTCCCCCAGTTCTGG - Intronic
920056006 1:203192299-203192321 GTTCCCACATTCACCTCTTTAGG + Intergenic
920278266 1:204824654-204824676 GTTCCCTTGACCCCCTTTGTGGG + Intergenic
920553909 1:206889964-206889986 GTTCCCATGACACCGTCTTCTGG + Intergenic
920897723 1:210074689-210074711 GTTCCCTTGTCCCCCTCTCAGGG + Intronic
921068307 1:211638513-211638535 GTTCCCATGGCCCCCTCTTTGGG + Intergenic
921076090 1:211701223-211701245 GTTCCAATGGCCCCCTCCCTTGG - Intergenic
921162170 1:212480769-212480791 GTTCCCATGACCCCTTCCTCAGG - Intergenic
921510348 1:216020919-216020941 GTTCCCACAACCCCCTCTTCAGG - Intronic
921785965 1:219229792-219229814 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
922598648 1:226833410-226833432 GTTCCCATGGCTCCATCTTCAGG + Intergenic
922699999 1:227753726-227753748 GTTCCCTTGTCCCCCTCACAGGG + Intronic
922939451 1:229448804-229448826 GTTCCCACAACCCCCTCCTTGGG - Intronic
923206099 1:231760365-231760387 TGTCCCATCTCTCCCTCTTTGGG - Intronic
923228398 1:231960885-231960907 ATTCCCATGATCCCCTCCTTGGG + Intronic
923378391 1:233389891-233389913 GTTCCCAGGACCTCCTCCTTGGG - Intergenic
1062837467 10:645164-645186 GATGCCATGTCCTCATCTTTTGG - Intronic
1062871454 10:908435-908457 ATCCCCATGGCCCCCTCTTTGGG - Intronic
1064745550 10:18474986-18475008 GTTCCCATGGCCCCCTACTCAGG + Intronic
1064805713 10:19129244-19129266 GTTCCCATGACCCCCTTCTTAGG + Intronic
1065036022 10:21639407-21639429 GTTCCCACAGCCCCCTCCTTGGG + Intronic
1065053647 10:21820734-21820756 GTTCCCATGACCCCCTCTTTGGG + Intronic
1065186800 10:23176199-23176221 ATTTCCATGTCCCCCAATTTAGG + Intergenic
1065208088 10:23375862-23375884 GTTCCCACAACCCCCTCTTTGGG - Intergenic
1065468032 10:26046111-26046133 GTTCCCATGACCGTCTCCTTGGG - Intronic
1065778362 10:29143339-29143361 GTTCCCTTGTCCCCCTCCCAGGG - Intergenic
1065935805 10:30519585-30519607 GTTCCTATAACCCCTTCTTTGGG + Intergenic
1065990664 10:31006583-31006605 GTTCCCACAACCACCTCTTTGGG - Intronic
1066040327 10:31542947-31542969 GTTCCCACAACTCCCTCTTTGGG + Intergenic
1067315837 10:45161170-45161192 GTTCTCATGACTCCCTCTTTGGG - Intergenic
1067675479 10:48371810-48371832 GTTCCCATGATCCGCTCCTTGGG + Intronic
1067677165 10:48391794-48391816 GTTCCCATGCCCCTCTCTTTGGG + Intronic
1067870578 10:49957158-49957180 TTTCCCACAACCCCCTCTTTGGG + Intronic
1068134739 10:52940487-52940509 GTTCCCTTGTACCCCTCGCTGGG - Intergenic
1068429442 10:56912896-56912918 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1068607987 10:59026660-59026682 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1068834900 10:61542928-61542950 GGTCCCAAGATCCCCTCTTTAGG + Intergenic
1069175534 10:65284968-65284990 GTTCCCATGACCACCACTTTGGG - Intergenic
1069222699 10:65903943-65903965 GTTCCCTTATCCCCCTCTCAGGG - Intergenic
1069576491 10:69533700-69533722 GTTCCCATGAACCCGTCCTTGGG - Intergenic
1069663259 10:70137910-70137932 GTTCCCACGACCTCCTTTTTGGG + Intergenic
1070252492 10:74785119-74785141 GCTCCCATGACCCCATCTTTGGG - Intergenic
1071028196 10:81140347-81140369 GTTCCCATGTCCCCCTCACAGGG - Intergenic
1071078562 10:81783369-81783391 GTTCCCATAACCCCCTCCTTGGG + Intergenic
1071220487 10:83459368-83459390 GTTCCCTTGTCCCCCTTGTAGGG - Intergenic
1071310785 10:84341737-84341759 GTTCCCATGACCCCCTTCTTGGG + Intronic
1071617299 10:87087107-87087129 GTTCCCATGGCCCCCTCCTCAGG + Intronic
1071662486 10:87518704-87518726 GTTCCCATGACCTCTTCTTTGGG + Intronic
1071928365 10:90437175-90437197 GTTCCCATGCCCCTGTCTTTGGG - Intergenic
1072350915 10:94556005-94556027 GTTCCCACAAGCCCCTCTTTGGG - Intronic
1073160855 10:101393342-101393364 GTTACCATGATCCCCTCTGTGGG - Intronic
1073848722 10:107589121-107589143 GTTCCCATGACCCTCTCTTTGGG - Intergenic
1073998238 10:109340570-109340592 GGTCACATGTCACCTTCTTTTGG - Intergenic
1074265102 10:111893834-111893856 GTTCCCATGACCCCTGCTTTTGG - Intergenic
1074363213 10:112839027-112839049 CTGCCCATGGCCCCCTCCTTGGG - Intergenic
1075620507 10:123924352-123924374 GTTCCCATGACCCTCTCCTTAGG + Intronic
1075674681 10:124288060-124288082 GGTCCCATGGCACCCACTTTGGG - Intergenic
1075722160 10:124593550-124593572 ACTCCCATGTCCTCCTCTTGGGG + Intronic
1076563033 10:131379835-131379857 GTTCCCCTGTCCTTCCCTTTGGG + Intergenic
1076862154 10:133143010-133143032 GTTCCCATGATCCCCTCCTTGGG + Intergenic
1077338130 11:2014451-2014473 GTTCCCAGGAGCCCCACTTTAGG + Intergenic
1077663916 11:4091884-4091906 CTTCCCATGCCCCACTCTTGGGG - Exonic
1078346520 11:10554548-10554570 GTTCTCATGACCCCCTCTTTGGG - Intergenic
1078516321 11:12025761-12025783 GTTCCCATGGACCCCTCCTCAGG + Intergenic
1078604722 11:12765071-12765093 GTCACCATCTCCCCTTCTTTGGG + Intronic
1078863674 11:15276803-15276825 GTTCACACTTCCCCCTCTTGTGG - Intergenic
1079187867 11:18253686-18253708 GTTCCCATGACCCCCTCTTTGGG - Intergenic
1079406044 11:20146631-20146653 GTCCCCATCTCCCCCTCTGATGG + Intergenic
1079695289 11:23474778-23474800 GTTCTCATGACCCACTCTTCAGG - Intergenic
1079835316 11:25326773-25326795 GTTCCCATGACACCCTCTCTGGG - Intergenic
1080326473 11:31079473-31079495 ATTCTCATGACCCCCTCGTTGGG - Intronic
1080335970 11:31196488-31196510 GTTCCCATGACTCCCTCCTCAGG + Intronic
1080999938 11:37656280-37656302 GTTCCCTCGACCCCCTTTTTGGG - Intergenic
1081342622 11:41947117-41947139 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1081499527 11:43652588-43652610 GTTCCCATGACCCCCTGTTTGGG + Intronic
1081749505 11:45499755-45499777 GTTCCCATGATGGCCTCTTTGGG - Intergenic
1082262356 11:50086443-50086465 GTTCCCATGACCCTCTTCTTGGG - Intergenic
1082685328 11:56231555-56231577 TCTCCCATGACCCCCTCTTTGGG + Intergenic
1083039938 11:59676084-59676106 GTTCCCATGACCCCCTCTTTGGG - Intergenic
1083168153 11:60904549-60904571 GTTCCCATGACCTCCTTTTTGGG + Intronic
1083355521 11:62063371-62063393 GTTCCCACGGCCCCCTCTTTAGG + Intergenic
1083390419 11:62345647-62345669 GTTACCATGACCCCCTCCTCAGG + Intronic
1083543179 11:63528998-63529020 GTTCCCAGGACCTCCTCATTGGG - Intergenic
1083646972 11:64177490-64177512 GTTCCCATGACCCCCTCCTCAGG + Intergenic
1083703253 11:64495219-64495241 GTTCCCATGACCCCCTTTTTGGG + Intergenic
1083810834 11:65105785-65105807 GTTTCCATAACTCCCTCTTTGGG + Intronic
1084156471 11:67315875-67315897 GTTCCCACGATCCCCTCTTTCGG - Intergenic
1084192306 11:67504670-67504692 GGTCCCAAGTCCCCCACTCTCGG + Intronic
1084396495 11:68914375-68914397 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
1084737933 11:71117874-71117896 GTTCCCACCACCCCCTTTTTGGG - Intronic
1085354400 11:75822581-75822603 GTTCCTATGTTCCCCTCCTCAGG + Intronic
1085392231 11:76188344-76188366 GCTCCCATGCCCCACCCTTTAGG - Intronic
1085684138 11:78606191-78606213 GTTCCCTTGTCCCCCTCCCAGGG - Intergenic
1086345042 11:85887406-85887428 GTTCCCATGTCCCCCTATCAGGG + Intronic
1086575161 11:88331340-88331362 GTTCCCATAACCCCCTCTTTGGG + Intronic
1086737300 11:90322196-90322218 GTTTCCACAGCCCCCTCTTTGGG - Intergenic
1086956445 11:92938737-92938759 GTTCCCATGACCTCCTCCTTGGG - Intergenic
1087023734 11:93629172-93629194 GTTCCCAGGACACCCTCTTTGGG - Intergenic
1087233845 11:95696491-95696513 GTTCCCATGACCCTATCTTTGGG + Intergenic
1087333255 11:96810917-96810939 GTTCCCATGACTCCATCTTTTGG - Intergenic
1087363228 11:97187083-97187105 GATCCCATGGTCCCCTCTTTGGG + Intergenic
1087474979 11:98623412-98623434 GTTCCCTTGTCTCCCTCTCAGGG + Intergenic
1087781937 11:102310412-102310434 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1087791586 11:102411473-102411495 TTTCCCATAACCCCCTCCTTGGG - Intronic
1088103302 11:106177585-106177607 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1088238461 11:107750058-107750080 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1088253928 11:107885230-107885252 GTTCCCATGATCCCCTCCTCAGG - Intronic
1088345398 11:108818789-108818811 GTTCCAATGTACCCTTTTTTGGG + Intronic
1088784025 11:113164516-113164538 GTTCCCACAACCCCCTCCTTAGG + Intronic
1089970557 11:122689763-122689785 GTTACCACAACCCCCTCTTTTGG + Intronic
1090136212 11:124201363-124201385 GTTCCCTTGTCCCCCTCGAAGGG - Intergenic
1090492349 11:127175903-127175925 GTTCCCACGACCCCCTCCTTGGG - Intergenic
1090947315 11:131442567-131442589 TTTCCCATCTTCCCCCCTTTTGG + Intronic
1202821114 11_KI270721v1_random:69633-69655 GTTCCCAGGAGCCCCACTTTAGG + Intergenic
1091515892 12:1181219-1181241 TTTCCCATTCCCCCCTTTTTTGG + Intronic
1091577211 12:1749018-1749040 GCTCCCATGGCCCCCTCTTTGGG + Intronic
1091977527 12:4837375-4837397 GTTGCCATGACCCCCTCCGTGGG - Intronic
1092032861 12:5303565-5303587 GTTCCCATGGCCCCTTCTTAAGG + Intergenic
1092177108 12:6417596-6417618 GTTCCCATGACCCCCTCTTTGGG + Intergenic
1093089450 12:14904871-14904893 GTTCCCTTGTCCCCCTCGCAGGG - Intronic
1093923923 12:24890143-24890165 GTTCCCATGACCCCCTCTTCTGG - Intronic
1093927200 12:24920809-24920831 GTTGCCATGACCCCCTCTTCCGG + Intronic
1094461133 12:30697220-30697242 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1094603684 12:31932620-31932642 GTTCCCATGACCCCCTCTTTGGG + Intergenic
1094608675 12:31972220-31972242 ATTCCCATGTCCCGCTCCTTTGG - Intronic
1094742302 12:33303539-33303561 GTTCCCATGACCCCCTCTTTGGG - Intergenic
1095043693 12:37474432-37474454 GTTCTCCTGACCCCCTCTTTGGG + Intergenic
1095052788 12:37568927-37568949 GTTCCTACGACCCCCTCTTTGGG - Intergenic
1095475600 12:42584315-42584337 GTTTGCCTGTCTCCCTCTTTAGG - Intronic
1095579810 12:43784500-43784522 GTTCCTATGACCTCCTCTGTGGG + Intronic
1095685136 12:45024754-45024776 GTTCCCAAATCTCCCTCCTTAGG - Intronic
1095704628 12:45223172-45223194 GTTCCCACGACACCCTCCTTGGG - Intronic
1095730957 12:45506319-45506341 GTTCCCATGACCCCTTCTTTGGG - Intergenic
1096132214 12:49168598-49168620 GCTCCCATGACCCCTTCTTTGGG - Intergenic
1096171725 12:49476686-49476708 GTTCCCTTGTCCCCCTCACAGGG - Intronic
1096414365 12:51400961-51400983 GTTCCCTTGTCCCCCTCACAGGG + Intronic
1096581739 12:52590197-52590219 GCACCGAGGTCCCCCTCTTTGGG - Intronic
1097098986 12:56572923-56572945 TTTCCCAGGTGCCCTTCTTTGGG + Intronic
1097548846 12:61040933-61040955 TTTCCCATGGCCAACTCTTTAGG - Intergenic
1097729857 12:63116288-63116310 GTTTCTATGACCCCCTCCTTGGG + Intergenic
1098228393 12:68348207-68348229 GTCCCCCTGTCCCCATTTTTAGG + Intergenic
1098377716 12:69835728-69835750 GTTCCCTTGTCCCCCTCACAGGG + Intronic
1098825196 12:75287791-75287813 GTTCCCACCACCCCCTCCTTGGG - Intronic
1100247954 12:92783106-92783128 GTTTTCATGACACCCTCTTTGGG - Intronic
1100308229 12:93370869-93370891 GTTTCCATGACCCTCTCTTTGGG + Intergenic
1100432808 12:94545838-94545860 TTTCCCATTTCCCCTTCTTGTGG - Intergenic
1100445636 12:94657153-94657175 GTTCCCATGACCCCCTCTTTGGG - Intergenic
1101375210 12:104165523-104165545 GTTACCATGACCTCCTCCTTGGG - Intergenic
1101772824 12:107767289-107767311 ATTTCCATGACCCCCTCTTTGGG + Intergenic
1102163400 12:110787250-110787272 GTTCCCATGACCTCCTTTTTGGG + Intergenic
1102840618 12:116116580-116116602 GTTCCCACAGCCCCCTCCTTGGG - Intronic
1103752360 12:123173882-123173904 GTTCCCACAGCCCTCTCTTTGGG - Intronic
1103986291 12:124769691-124769713 GTTCCCACGACCCTGTCTTTGGG - Intergenic
1104448592 12:128852682-128852704 GTCCCCATGTTCCCCTCCTCGGG + Intergenic
1104682948 12:130763804-130763826 GTTCCCACAACCCCCTCTTTGGG - Intergenic
1104756778 12:131274264-131274286 GTGCCCGTGTCCGCCGCTTTGGG - Intergenic
1105950338 13:25224244-25224266 GTTCCTACGACCCCCTGTTTGGG - Intergenic
1106183020 13:27384252-27384274 GTTCCCCTGTCCCCCTCGCAAGG - Intergenic
1106319514 13:28624685-28624707 GTTCCCTTGTCCCCCTCACAAGG - Intergenic
1106613917 13:31309518-31309540 GTTCCCACAGCCCCTTCTTTGGG + Intronic
1106615161 13:31319839-31319861 CTTCCAATGTCCCCCTCTCAGGG + Intronic
1106688206 13:32084915-32084937 TATCCCATGTCCCCATGTTTAGG + Intronic
1107298517 13:38940751-38940773 GTTCCCATGACCCCATCTTTGGG + Intergenic
1107360027 13:39607746-39607768 GTTTGCATGACCCCTTCTTTGGG - Intergenic
1107540658 13:41386062-41386084 CTTCCCATGACTCCTTCTTTGGG + Intergenic
1107555044 13:41510240-41510262 GTTCCCATGACCGCCTCCTTGGG + Intergenic
1107697410 13:43013698-43013720 GTTCCCATGACCCTCTCCTCAGG - Intergenic
1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG + Intergenic
1109138454 13:58682968-58682990 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1109459577 13:62638480-62638502 GTTCCCATGAGCCCCTGTTTGGG + Intergenic
1112059076 13:95719048-95719070 ATTCCCATGACCCCTTCCTTGGG + Intronic
1112154044 13:96798039-96798061 GTTCCCACAACCCCTTCTTTGGG + Intronic
1112311965 13:98326456-98326478 CTTCCCATTTCCCCCTCCCTTGG + Intronic
1112608552 13:100932037-100932059 GTTCCCAAGACCCGCTCTTTGGG - Intergenic
1112727430 13:102320537-102320559 ATTCCCATTTCCTCCTGTTTTGG + Intronic
1113272071 13:108684995-108685017 GTTCCCATGACCCTCTTCTTGGG - Intronic
1113471562 13:110550371-110550393 GTTCCCACGACCCCCTCTTTGGG - Intronic
1114772597 14:25445156-25445178 GTTCCCATAACTCCCTCCTTGGG - Intergenic
1115262705 14:31470032-31470054 ATTCCCATGACCCTGTCTTTGGG - Intergenic
1115375033 14:32665327-32665349 GTTCCCATGACCCCTTCTTTGGG + Intronic
1116779266 14:49218165-49218187 TTTCCCAAGTCCCCTTCTTTAGG - Intergenic
1116882462 14:50185124-50185146 GTTCCCATGACCCCCTCCTTGGG - Intronic
1117060358 14:51956259-51956281 GTTCCCATGACTACCTCTTCAGG - Intronic
1117076592 14:52111056-52111078 GTTCCCAAGACCCCTTCTTCAGG + Intergenic
1117353987 14:54906055-54906077 GTTTCCACAACCCCCTCTTTGGG - Intergenic
1118604187 14:67491111-67491133 GTTCCCATGACCGCCTCCTTGGG + Intronic
1118830420 14:69426299-69426321 GTTCCCACAACCCCCTCTTTGGG + Intronic
1119836926 14:77759018-77759040 GTTCCCATGACCTCATCTTCAGG + Intronic
1119844253 14:77816718-77816740 GTTCCCACAACCCCTTCTTTGGG - Intronic
1120506379 14:85357878-85357900 GTTCCCATGACCCCCTTCTTGGG + Intergenic
1120945178 14:89988014-89988036 GTTCCCATGACCCTCTCTTTGGG + Intronic
1122321765 14:100859719-100859741 GTACCCATGTACCATTCTTTGGG - Intergenic
1122554269 14:102568631-102568653 GTTCCCACATCCCCCTCTTTGGG + Intergenic
1122871929 14:104642669-104642691 GCTTCCATGTGCCCCTCTGTGGG - Intergenic
1123700148 15:22908324-22908346 GTTCCCCGCTCACCCTCTTTGGG - Intronic
1124183748 15:27502682-27502704 GTTCTCACAACCCCCTCTTTGGG + Intronic
1124514464 15:30354760-30354782 GTTCCCACGCCCCCCTTCTTAGG - Intergenic
1124728456 15:32176005-32176027 GTTCCCACGCCCCCCTTCTTAGG + Intergenic
1124824938 15:33084352-33084374 GTTCCTATGACCCCCTCTTCGGG - Intronic
1124826206 15:33098390-33098412 GCTCCCACCTCCCCCTCTCTAGG + Intronic
1124836325 15:33199097-33199119 GTTCCCACGACTCCCTCTCTGGG - Intergenic
1125125158 15:36211380-36211402 GTTCCCATGACCCCATCTTGGGG + Intergenic
1125393980 15:39226971-39226993 GTTCCCACGACCCACTCCTTGGG + Intergenic
1125439717 15:39689064-39689086 GTTCCCATGATCCACTCTTCAGG + Intronic
1125776200 15:42216614-42216636 GTTCCCACATCTCCCTCTTGAGG - Intronic
1126136551 15:45397693-45397715 CTTCCCATGACCCCCTTCTTAGG - Intronic
1126202800 15:46006745-46006767 GTTCCCATGGCCTTCTCTTCAGG + Intergenic
1126278937 15:46919329-46919351 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1126291189 15:47081428-47081450 GTTCTCATGACCCCCTCTTTGGG - Intergenic
1126312552 15:47334333-47334355 GTTCCCATAAACCCCACTTTGGG - Intronic
1126323276 15:47447710-47447732 GTTCCCACTGCCCCCTCCTTGGG - Intronic
1126415996 15:48417922-48417944 GCTCCCCTGTCCCTCACTTTTGG + Intronic
1127533241 15:59865400-59865422 GTTCCCATGATCCCCTCTTTGGG - Intergenic
1127796401 15:62442055-62442077 GTTCCCATGACCCCATCCTTAGG - Intronic
1128046001 15:64618249-64618271 GTTCCCTTGTCCCCCTCACAGGG + Intronic
1128391298 15:67184556-67184578 GTGCCCATTTCCCCTACTTTAGG + Intronic
1128461205 15:67869100-67869122 GTTCCCACGCCCGTCTCTTTAGG - Intergenic
1128619692 15:69138226-69138248 GTTCCCATGACTCCCTCCTTGGG - Intergenic
1128987925 15:72234776-72234798 ATTCCCATGATCCCCTTTTTGGG - Intergenic
1129064487 15:72889584-72889606 GTCTCCATGATCCCCTCTTTAGG - Intergenic
1129091188 15:73152596-73152618 GTTCCCAGGACTCCCTCTCTGGG - Intronic
1129091942 15:73160579-73160601 GTTCCCATGATCCCCTTGTTGGG + Intronic
1129451007 15:75651425-75651447 GTTCTCATGACCCCCTCTGTGGG + Intronic
1129454777 15:75670781-75670803 CTTCCCAGGGCCCCATCTTTGGG + Intergenic
1130303187 15:82695729-82695751 GTTCCCATGCCACCCTCCTTGGG - Intronic
1130430528 15:83842525-83842547 GTTCCCTTATCCCCCTCTCAGGG - Intronic
1130712772 15:86300117-86300139 ATTCCCAGATACCCCTCTTTAGG + Intronic
1130975011 15:88767414-88767436 GTTCCTATGATCCCCTCCTTAGG + Intergenic
1131353345 15:91721725-91721747 GTTCCCAAAACCTCCTCTTTGGG + Intergenic
1131457757 15:92596706-92596728 GTTCCCATCTCCCCTTCTTCCGG + Intergenic
1132070915 15:98775837-98775859 GTTCCCATGTGATCCTTTTTGGG + Intronic
1132425233 15:101710369-101710391 GTTCCCATGACCCCATCCTTGGG - Intronic
1133354043 16:5123073-5123095 GTTCCCTTGTCCCCCTCGAAGGG + Intergenic
1133906071 16:10023822-10023844 GTGCCCATGTCCACCTCCCTGGG - Intronic
1134152602 16:11816899-11816921 GTTCCCACAACCCTCTCTTTGGG + Intergenic
1134164657 16:11920404-11920426 GTTCCCATGACCCCCTCCATGGG + Intergenic
1134299173 16:12974344-12974366 GTTTCCATGCCTCCTTCTTTGGG - Intronic
1134485037 16:14651234-14651256 GTTCCCATGATTCCCTCTTTGGG + Intronic
1134535935 16:15027219-15027241 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
1134599531 16:15522691-15522713 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
1134687294 16:16167826-16167848 GCTCCCATCTCTCCATCTTTAGG + Intronic
1134804687 16:17114272-17114294 GTTCCCACAACCCCCTCTTTGGG - Intronic
1135022777 16:18976796-18976818 GTTCCCATGACCCTCTCTTCAGG - Intergenic
1135069664 16:19340859-19340881 GTTCCCATGATGCCTTCTTTGGG - Intergenic
1135082965 16:19452132-19452154 GTTCCCACGACCTCCTCCTTTGG + Intronic
1135090743 16:19514157-19514179 GTTCCCACCTCCTCCTCCTTGGG + Intronic
1135412552 16:22246120-22246142 GTTCCCATGAACCCCTCCTTGGG + Intronic
1135900982 16:26459627-26459649 GCTCCTATGCCCCCCTCTTTGGG + Intergenic
1135955997 16:26956650-26956672 ATTCCCATGAACCCCTCGTTGGG + Intergenic
1136181739 16:28557543-28557565 GTTTCCATGACTCCCTCCTTGGG - Intronic
1137247405 16:46717061-46717083 GTTCCCAAGACCCCCTCTTTGGG - Intronic
1137281306 16:46979017-46979039 GTTCCCATGAACCCTTCCTTGGG - Intergenic
1137309836 16:47244261-47244283 GTTCCCATGACCCCCTCCTCGGG - Intronic
1137313020 16:47285463-47285485 GTTCCCATGACCCCCTCCTTTGG - Intronic
1137373646 16:47932327-47932349 GTTCCCATGAACCCCTCTGTGGG + Intergenic
1138367004 16:56488392-56488414 GTTCCCATGACCCCCTCTGTGGG + Intronic
1138464807 16:57181684-57181706 GTTCCCATGACCCCCTCCTTAGG + Intronic
1138808554 16:60121352-60121374 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1138956014 16:61971353-61971375 ATTCCCATGAGCCCCTCCTTGGG + Intronic
1139178010 16:64713329-64713351 GTTCCCACAACCCCCTCTTTGGG + Intergenic
1139660312 16:68416333-68416355 CTTCCCATCTCCCTCTCTCTGGG + Intronic
1139860120 16:70013568-70013590 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1140835333 16:78788725-78788747 GTTCCCATAACCCCCTCTTTGGG - Intronic
1140916125 16:79494853-79494875 GTTCCCAAGACTCCCTCCTTGGG + Intergenic
1141446350 16:84061172-84061194 ACTCCCATTTCCCCCACTTTTGG - Intronic
1141459156 16:84167105-84167127 GTTCCCATGACCCTCTCTTTGGG + Intronic
1143009629 17:3858813-3858835 GTTCCCACAACCCTCTCTTTGGG - Intergenic
1143292287 17:5840590-5840612 GTTCCCTTGTCCCCCTCAGAGGG + Intronic
1143398058 17:6618361-6618383 GTTCCCTTGACCCCCTCCTGGGG - Intronic
1143793435 17:9316725-9316747 GTTCCCAGGACCCCTTCCTTGGG - Intronic
1144230529 17:13198779-13198801 GTTCCCATGATCCCCTCTGTGGG + Intergenic
1144485771 17:15663080-15663102 GTGCCCTTGTCCTCCTCTCTTGG - Intronic
1145257533 17:21335031-21335053 GTTCCCATGGCCACATCCTTGGG + Intergenic
1145319107 17:21753004-21753026 GTTCCCATGGCCACATCCTTGGG - Intergenic
1145373305 17:22324862-22324884 GTTCCTACGACCCCCTCTTTGGG - Intergenic
1145923209 17:28626887-28626909 GTTCCCACAACCCCCTCCTTGGG - Intronic
1146161831 17:30564174-30564196 GGTCCCCTTTGCCCCTCTTTGGG - Intergenic
1146401271 17:32501843-32501865 GTTCCCAGGACCTCCTCTTTGGG - Intronic
1146860133 17:36290084-36290106 GTTCCCATGACCCCCTTCTTAGG - Intronic
1147090459 17:38094175-38094197 GTTCCCATGACCCCCTTCTTAGG - Intergenic
1147106754 17:38226351-38226373 GTTCCCATGACCCCCTTCTTAGG + Intergenic
1147738371 17:42655371-42655393 GTTCTCATGACCCCCTCTTTGGG - Intergenic
1148132365 17:45269885-45269907 GACCCCATGACCCCCTCCTTGGG - Intronic
1148422770 17:47562186-47562208 GTTCCCATGACCCCCTTCTTAGG - Intronic
1148996913 17:51718629-51718651 GTTCCCATGACCACTTTTTTGGG - Intronic
1149185539 17:53992859-53992881 GTTCTCATGACTCCCTCTTGAGG + Intergenic
1149268231 17:54951125-54951147 GTTCCCATGACTGCTTCTTTGGG + Intronic
1149727696 17:58913113-58913135 GTTCTCATGACTCCCTCTTCAGG - Intronic
1149882664 17:60308427-60308449 GTTCCCTTGTCCCCCTCACAGGG - Intronic
1150174182 17:63032942-63032964 GTGCCCATGGCTCCCTCCTTGGG + Intronic
1150883039 17:69052832-69052854 GTTCCCATAACCCGCTCCTTGGG + Intronic
1151247706 17:72807834-72807856 GTTCCCACGACCCCCTCGTCGGG - Intronic
1151341250 17:73472300-73472322 GTCGCCAGGTCACCCTCTTTTGG + Intronic
1151777285 17:76214050-76214072 GTTCCCATAACCCCCTCCTTGGG - Intronic
1152203283 17:78959536-78959558 GCTCCCATGACCCCCTCCTCAGG + Intergenic
1152335308 17:79697240-79697262 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1152406868 17:80102757-80102779 GTTCCCAGGACTCCCTCTTCAGG - Intergenic
1152413457 17:80143354-80143376 GTTCCCAGGATCCCCTCTTTAGG - Intronic
1152751247 17:82063406-82063428 GTGCCCATGTGTCCCTCTTGAGG + Intronic
1152776770 17:82206707-82206729 GTTCCCACAGCCCCCTCTTTGGG - Intronic
1152851242 17:82637607-82637629 GTTCCCGTGACCCCTTCTTTGGG + Intronic
1153566702 18:6426143-6426165 GTTCCCATGACCCCTTCCTCAGG - Intergenic
1153710557 18:7794428-7794450 GTTCCCTTGTCCCCCTCCCAGGG - Intronic
1153775273 18:8447823-8447845 GTTCCCATGACCCACTCTTTGGG + Intergenic
1153888927 18:9494488-9494510 GTTCCCATGACCCCTGCCTTGGG - Intronic
1153889371 18:9498415-9498437 ATTCCCAAGACCCCCTCTTCAGG + Intronic
1154468046 18:14668959-14668981 GGTCTCATGGCCCCCTTTTTGGG + Intergenic
1154476839 18:14768409-14768431 ATTCTCATGACTCCCTCTTTGGG - Intronic
1155293685 18:24366084-24366106 GTTCCCATGACTCCCTGTTTGGG + Intronic
1155397890 18:25405780-25405802 GTTTCCATGATCCCCTCCTTGGG + Intergenic
1155719432 18:28992624-28992646 GTTCCTATGTCACCCTCCTTGGG + Intergenic
1155759498 18:29548299-29548321 GTTCCCACATCCCCTACTTTGGG - Intergenic
1155971416 18:32087225-32087247 GTTCCCAGAGCCCACTCTTTCGG + Intergenic
1155971429 18:32087339-32087361 GTTCCCATAGCCCACTCTTTGGG - Intergenic
1156334215 18:36153664-36153686 ATTCCCTCGACCCCCTCTTTAGG + Intronic
1156409335 18:36812658-36812680 GTTCCCATGACCCCCTCCTCAGG - Intronic
1156695755 18:39764777-39764799 GTTCCCATGACTCCCTCCTTAGG + Intergenic
1156766434 18:40662596-40662618 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1156868191 18:41912340-41912362 GCTCCCATGACTCCCTCCTTGGG - Intergenic
1157534917 18:48451102-48451124 GTTCCCTTGTTCCCCTCTCAGGG + Intergenic
1157688403 18:49661380-49661402 GTACCCATGACCCCCTCCTCAGG - Intergenic
1157966631 18:52216110-52216132 GTTCCTATGATCCCCTCTTTGGG + Intergenic
1158573535 18:58616818-58616840 GTTCCCATGAGCACCTCTTGGGG - Intronic
1158798009 18:60871791-60871813 TTTCCCATGACCCCCTCTTTGGG - Intergenic
1159587051 18:70290903-70290925 CATCCCATGACCCCCTCTCTTGG + Intronic
1160368706 18:78352498-78352520 GTTGCCATTTCCCCCTCCTGTGG + Intergenic
1160418583 18:78728660-78728682 CTTCCCATGACCCTTTCTTTGGG - Intergenic
1161441966 19:4296895-4296917 TTTGCCATGTCCCCCACTTATGG - Intronic
1162712432 19:12605574-12605596 GTTTTCATGACCCACTCTTTGGG - Intronic
1163588278 19:18175720-18175742 CCACCCATGTCCCCCTCCTTGGG - Intronic
1164538128 19:29101893-29101915 GTTCCCAAGACCTCCTCTTTGGG - Intergenic
1164538141 19:29101949-29101971 GTTTCCAAGGTCCCCTCTTTGGG + Intergenic
1164717600 19:30404914-30404936 GTTCCCATGACCCCCTCTTTGGG + Intronic
1164883078 19:31752345-31752367 GCTCCCATGACTTCCTCTTTGGG - Intergenic
1165294669 19:34916931-34916953 GTTCCCACAGCCCCCTCTTTGGG + Intergenic
1165551331 19:36588914-36588936 GTTCTCACAACCCCCTCTTTGGG - Intronic
1165570259 19:36769974-36769996 ATTCCTACGACCCCCTCTTTGGG + Intronic
1165891743 19:39116689-39116711 GTTTCCACGACCCCCTCTTGGGG + Intergenic
1166128464 19:40731042-40731064 GTTCCCATGTCCTCCTCTTTGGG + Intronic
1166252423 19:41580507-41580529 GTTTCCATGACTCCCTGTTTGGG + Intronic
1166634574 19:44438951-44438973 GTTCCCACAACCCACTCTTTGGG - Intronic
1167029456 19:46947802-46947824 GTTCCCATGACCCCCTCTTTGGG + Intronic
1167318653 19:48781817-48781839 GTTCCCATGACTCCCTCCTTAGG - Intergenic
1167810452 19:51825141-51825163 GTTCCCACTACCCCCTCTTTGGG + Exonic
1167850601 19:52198433-52198455 GTTCCCACGACCCCCTCTTTGGG + Intronic
1167851205 19:52203822-52203844 ATTCCCACGACCCCCTCTTTGGG + Intronic
1167869625 19:52357119-52357141 GTTCCCATGGCTCCCTCTTTGGG + Intronic
1167966321 19:53150059-53150081 ATTCCCATGACCCCCTCCTCAGG - Intronic
1167969589 19:53179712-53179734 GTTCCCATGAACCCTTCTTTGGG - Intronic
1167972753 19:53198622-53198644 GCTCCCATGACTCCCTCTTTGGG + Intergenic
1168125965 19:54283068-54283090 GATCCCATGCCCCACTCTTTGGG - Intergenic
1168171310 19:54591720-54591742 GATCCCATGACCACCTCTTTGGG + Intronic
1168358633 19:55719137-55719159 GTTCCCCTGACCCCTTCCTTGGG + Intronic
1168540084 19:57202810-57202832 GTTCCCGCGACCCCCTCTTTGGG - Intronic
1168677774 19:58291416-58291438 GTTCTCAAGTCCCCCTCCTCCGG + Intronic
925572278 2:5325211-5325233 GCTCCTATGTCCCCCTCATAGGG + Intergenic
925805989 2:7648709-7648731 GCACCCATGTCCCCCTCTGTGGG + Intergenic
925806706 2:7658201-7658223 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
926007568 2:9384553-9384575 GTTCCCACAGCCCCCTCTTTGGG + Intronic
927164034 2:20299098-20299120 GTTCCCACAAGCCCCTCTTTGGG - Intronic
927211247 2:20640490-20640512 GTCCCCATGACCCTCTCTGTGGG + Intronic
927666862 2:25038916-25038938 GTTCCCGTGACTCCCTCTTCGGG + Intergenic
928330794 2:30356477-30356499 GTTCCCATGGCCCTCTCCTTGGG + Intergenic
928429322 2:31204840-31204862 ATTCCCATGATCCCCTCCTTGGG - Intronic
930602017 2:53454591-53454613 CTTCCCATGTAGCCCTCTTAAGG + Intergenic
930763709 2:55062515-55062537 ATTCCCTTGTCCCCCTCTCAGGG - Intronic
931435682 2:62244006-62244028 GTTCCAGTGACCCCCTCTTTGGG - Intergenic
931441100 2:62291141-62291163 GTTCCCATGCCCCCCTCCTTGGG - Intergenic
931470103 2:62531299-62531321 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
931561507 2:63566840-63566862 GTTCCCACGACCCCCTCCTCAGG + Intronic
931562380 2:63576313-63576335 GTTCCCATGAACCCCTTTTTGGG + Intronic
932054417 2:68430163-68430185 GTTGCCATGACCTTCTCTTTAGG - Intergenic
932081428 2:68719214-68719236 GCTCCCATGACCCTCTCCTTGGG - Intronic
932461342 2:71883803-71883825 GTTCCCATGTGCCCAGCTGTGGG - Intergenic
932632239 2:73354950-73354972 GTTCCCATGACCCCCTCTTTGGG + Intergenic
932723465 2:74157475-74157497 GTTCCCACAACCCCCTCCTTGGG - Intronic
933112057 2:78414913-78414935 CTTCCCATGTTCCCCCCTTTTGG - Intergenic
933553811 2:83807721-83807743 GTTCCCATGACCCCCTCTTTGGG + Intergenic
933725842 2:85426776-85426798 GTTCCCACAACCTCCTCTTTGGG - Intronic
933896506 2:86815352-86815374 GTTCCCTTTTCCCGGTCTTTAGG + Intronic
933987928 2:87608198-87608220 GTTCCCATGACCCCCTCTTTGGG - Intergenic
934027125 2:88010449-88010471 GTTCCCAGGACCTCCTCCTTAGG + Intergenic
935543600 2:104377914-104377936 GTTCCCTTGTCCCCCTTGTAGGG + Intergenic
935663933 2:105494142-105494164 GTTCCCTTGTCCCTCTCTCAGGG + Intergenic
935882273 2:107576302-107576324 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
935971922 2:108537832-108537854 GCTCCAAGGTCCCCCTCTCTAGG - Intronic
936002808 2:108851053-108851075 GTTCCTACAACCCCCTCTTTGGG + Intronic
936258457 2:110936599-110936621 GTTCCCATGACCCTCTCCTTAGG + Intronic
936296010 2:111267886-111267908 GTTCCCAAGACCCCCTCTTTGGG + Intergenic
936305912 2:111342610-111342632 GTTCCCATGACCCCCTCTTTGGG + Intergenic
936692805 2:114912876-114912898 GTTCCCATGTCAAACTCTTTGGG - Intronic
936954048 2:118006679-118006701 GTTCCCTTCTCCCCACCTTTAGG + Intronic
936955922 2:118022106-118022128 GTTCCCATGATTCCCTCCTTGGG + Intergenic
937284436 2:120741335-120741357 GTCCGCCTGTCCCCCTCCTTTGG + Intronic
937286871 2:120759423-120759445 GTTCCCATGCCGCCTTCCTTGGG + Intronic
937356143 2:121199339-121199361 GTTCCCATGACCCCCTCTTTGGG - Intergenic
937511034 2:122595183-122595205 GTTCCCACAACCCCCTCCTTGGG + Intergenic
937771756 2:125727765-125727787 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
938030296 2:127986375-127986397 GTTCCCTTGTCCCCCTCGCAGGG - Intronic
939061017 2:137421401-137421423 GTTCCCACGACTCCCACTTTGGG + Intronic
939607904 2:144274795-144274817 GTTCCCATGACCTCCTCCTCAGG - Intronic
940360554 2:152791475-152791497 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
941091547 2:161182397-161182419 GTTCCCACAATCCCCTCTTTGGG + Intronic
941790454 2:169547086-169547108 TTTCCCATGACCTCCTCTTTGGG + Intronic
942224359 2:173802341-173802363 GCTCCCATGATCCCCTCTTGGGG + Intergenic
942226512 2:173821480-173821502 ATGCCCATCTCCCCGTCTTTTGG + Intergenic
942429672 2:175897533-175897555 GCTCCAATGAGCCCCTCTTTGGG + Intergenic
942526778 2:176861527-176861549 GTTCCCATGACCCCCTCCTTGGG + Intergenic
943676647 2:190722040-190722062 GTTCCCACAACTCCCTCTTTGGG - Intergenic
943854304 2:192768758-192768780 GTTTCCATGACCTCCTCCTTGGG + Intergenic
944207851 2:197175577-197175599 GATACCATGTCCCTTTCTTTGGG - Intronic
944551589 2:200849484-200849506 GTTCCCATGACTTCCTCTTTGGG + Intergenic
945176535 2:207049031-207049053 CTTCCCATTGCCACCTCTTTGGG - Intergenic
945219363 2:207468432-207468454 GTTCCCGCGACCCCCTCCTTGGG + Intergenic
945322476 2:208441136-208441158 GTTCCCACGAACCCCTCTTTAGG + Intronic
945517649 2:210782890-210782912 ATTCCCATGACCCCATCTTTGGG + Intergenic
945549156 2:211197671-211197693 GTTGCCATGAACCCCTCTTTGGG - Intergenic
945951389 2:216042036-216042058 GTTCCCACGACCCCCTCTTTGGG - Intronic
946210399 2:218143147-218143169 GTTCCCTTATCCCCCTCATGAGG + Intergenic
947537682 2:230951102-230951124 GTTCCCACAACGCCCTCTTTGGG - Intronic
947760765 2:232602155-232602177 GTTCCCACGAACCCCTCCTTAGG - Intergenic
948065726 2:235077558-235077580 GTTCCCATGATTCCCTCTTCTGG + Intergenic
948758512 2:240174073-240174095 GTTCCCATGGCCCCATCCTAGGG - Intergenic
1169060572 20:2657907-2657929 GTTCCCCTGTCCTTCCCTTTAGG + Exonic
1169261797 20:4144620-4144642 GTTCCCATGATCCCTTCTTTGGG - Intronic
1169963325 20:11187428-11187450 GTTCCCACAACCCTCTCTTTGGG + Intergenic
1170199983 20:13732064-13732086 GTTCCCACGACCCCCTCTTTAGG - Intronic
1170270908 20:14526672-14526694 GTTCCCTTGTCCCCCTCACAGGG + Intronic
1170724538 20:18914652-18914674 GTTCCCATGACCCCATCTTTGGG - Intergenic
1170864570 20:20142078-20142100 TCTCCCAGGTCTCCCTCTTTAGG + Intronic
1171384148 20:24756394-24756416 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1171404007 20:24897624-24897646 GTTCCCATGACCCCTTGCTTGGG + Intergenic
1171538150 20:25917165-25917187 GTTCTCATGACCCCCTCTTTGGG + Intergenic
1171841091 20:30212466-30212488 GTTCTCATGACCCCCTCTTTGGG + Intergenic
1172175396 20:32969212-32969234 TGTCCCATGTCCCCGTCCTTGGG - Intergenic
1172315098 20:33947710-33947732 GGTCCCAAGACACCCTCTTTAGG + Intergenic
1173090287 20:39964304-39964326 GTTCCCATGACCCCCTTCTCAGG + Intergenic
1173348497 20:42222829-42222851 GTTCCCACAACCCCTTCTTTGGG - Intronic
1173421681 20:42906731-42906753 GTTCCCCTGTCCCCCTCACAGGG - Intronic
1173894328 20:46538851-46538873 GTTCCCATGACTCCCTCCTCGGG - Intergenic
1174126604 20:48311218-48311240 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1175670333 20:60897098-60897120 GTCCCCACGTCCCCCTCCTCAGG - Intergenic
1175816778 20:61887131-61887153 GTGCCCATCTCCCCCTTTTCTGG - Intronic
1176580946 21:8524901-8524923 CTTCTCAGGACCCCCTCTTTGGG - Intergenic
1177264547 21:18765471-18765493 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1177339590 21:19782523-19782545 GTTCCCTTGTCCCCCTCGCAAGG - Intergenic
1177601234 21:23317887-23317909 GTTCCCTTGTCCCCCTCGTAGGG + Intergenic
1177644873 21:23887817-23887839 GTTCCCTTGTCCCCCTTGTAGGG - Intergenic
1178071078 21:28967702-28967724 GATCCCATGACCCCCTCCTGGGG - Intronic
1178237276 21:30857512-30857534 GTTCCCATGATTCCCTCCTTGGG + Intergenic
1178421144 21:32444371-32444393 GTTCCCATGACCCCCTCCTTGGG + Intronic
1178438745 21:32581649-32581671 GTTCCCTTGTCCCCCTCGCAGGG - Intronic
1178967160 21:37131590-37131612 GTTCCCATGAGTCCCTCTTCAGG - Intronic
1179182342 21:39056589-39056611 CCACCCATGTCCCCCTCTTTGGG + Intergenic
1179918120 21:44491076-44491098 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1179954848 21:44732882-44732904 GTTCCCATGACCCCCTCCTTAGG + Intergenic
1180930317 22:19586213-19586235 GTTCCCGTGTCCCCCTCGCAGGG + Intergenic
1181451599 22:23026426-23026448 GTTCCCTTGTCCCCCTCTCAGGG + Intergenic
1181696929 22:24597983-24598005 GGTTCCAAGGCCCCCTCTTTGGG + Intronic
1183006292 22:34905449-34905471 GTTCCCACGACTCCCTCTTTGGG - Intergenic
1183626366 22:39005091-39005113 GTTCCCATGACCCATTCTTTGGG - Intergenic
1184133168 22:42529983-42530005 GTTCCCACAGCCCTCTCTTTGGG - Intergenic
1184366292 22:44053719-44053741 GTTCCCACAGCCCCATCTTTGGG + Intronic
949279547 3:2330095-2330117 ATTCCCATGACCGCCTCCTTGGG + Intronic
949487295 3:4552372-4552394 ATTCCTATGACCACCTCTTTGGG + Intronic
949806197 3:7958724-7958746 GTTCCCTTGTCCCCCTCTCAGGG + Intergenic
949966211 3:9358712-9358734 GTTTCCATGACCCCCTCTTTGGG + Intronic
950319267 3:12035189-12035211 GATTCCATGTCCCCATCTTCGGG + Intronic
950828492 3:15850817-15850839 GTTCCCATGACCCCCTCCTTGGG - Intronic
950841938 3:15976175-15976197 TTTCCCCTTTCCCCCTCTTCTGG - Intergenic
950930568 3:16784872-16784894 ATTCCCATGACCCTCTCTCTGGG + Intergenic
952298720 3:32085280-32085302 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
952580316 3:34824928-34824950 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
952580647 3:34829799-34829821 CTTTCCATCTACCCCTCTTTTGG + Intergenic
953745886 3:45573729-45573751 GTTCCCATGACCCCCTCCTCAGG - Intronic
953797592 3:45997314-45997336 GTTCCCACGACACCCTCTTTGGG + Intergenic
953797942 3:45999944-45999966 GTTCCCAAGACCTCCTCTTTGGG + Intergenic
954074836 3:48170369-48170391 GTTCCCATGACCCCTTCTTTGGG + Intronic
954565818 3:51598970-51598992 GTTCCCATGAAGCCCTCTTTGGG - Intronic
954736515 3:52712286-52712308 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
954812916 3:53258967-53258989 GTTCCCACCACTCCCTCTTTGGG - Intergenic
955464000 3:59216930-59216952 GTTCCCATGATCCCCTCCTCAGG - Intergenic
955506633 3:59639342-59639364 GTTCTCATGACACCCTCCTTCGG + Intergenic
955958613 3:64316468-64316490 GTTCTCACGACCCCCTCTTTGGG - Intronic
956056141 3:65300922-65300944 GTTCCCATGCTTCCCTCTTTGGG + Intergenic
956511751 3:70000324-70000346 GTTCCCTTGTCCTCCTCTCAGGG - Intergenic
956937207 3:74116712-74116734 GTTCCCATCTCCCATTCATTTGG - Intergenic
957050248 3:75406166-75406188 GATCCCATAACCCCCTCCTTGGG - Intergenic
957057945 3:75458760-75458782 GTTCCCTTGTCCCCCTCGAAGGG + Intergenic
957550421 3:81697139-81697161 ATTCCCATGGTCCCCTCTTTGGG + Intronic
958454216 3:94309362-94309384 GTTCTCATAACCCCATCTTTGGG - Intergenic
958942427 3:100331152-100331174 GTTGCCATGATCCCATCTTTGGG - Intergenic
959369322 3:105504125-105504147 GTTCCCTTGTCCCCCTCACAGGG + Intronic
959739020 3:109694907-109694929 TTTCCCTTTTCCCCCTCCTTAGG + Intergenic
959889180 3:111534582-111534604 GTTCCCATGACCCCCTTCTCAGG - Intronic
960021130 3:112954867-112954889 GTTCCCATGACCCCCTCCTTTGG - Intronic
960024944 3:112998314-112998336 GTTCCAACTACCCCCTCTTTGGG + Intronic
960062754 3:113340536-113340558 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
960456419 3:117878364-117878386 GTTCCCATGACCTCCTCCTCGGG - Intergenic
960878005 3:122315848-122315870 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
961065567 3:123872536-123872558 ATTCCCATGACCCCCTTCTTGGG + Intronic
961295507 3:125880955-125880977 GTTCCCTTGTCCCCCTCGAAGGG - Intergenic
961600300 3:128055665-128055687 GTTCCCAGATTCCCCTGTTTGGG + Exonic
961718500 3:128875751-128875773 GCTCCCATGTCACCCTCTAGTGG - Intergenic
961882559 3:130072604-130072626 CTTCCCATAACCCCCTCCTTGGG - Intergenic
962139443 3:132772928-132772950 GTTCCCAGGTCATCCTCTCTGGG - Intergenic
962326704 3:134440502-134440524 GTTCCCACTACCCCCTCTTTGGG + Intergenic
963994017 3:151685519-151685541 GTTTCCATGACTCCCTCTTTGGG - Intergenic
964659735 3:159106806-159106828 GTTCCCGTGACCCCTTCTTTGGG + Intronic
964741918 3:159975309-159975331 GTTCCCTTCACCCCCTCCTTGGG - Intergenic
965185203 3:165454513-165454535 GTTCCCTTATCCCCCTCCTAGGG + Intergenic
966365741 3:179185665-179185687 GTTCCCATGACCCCCTCCTTGGG + Intronic
968039820 3:195579570-195579592 GTGCCCATGGTCCCCTCTGTGGG + Intronic
968163106 3:196443134-196443156 GTTCCCCTGTTTCCCTCTCTTGG - Intergenic
968359548 3:198137637-198137659 GTTCCCACGCCAGCCTCTTTGGG - Intergenic
968846493 4:3045184-3045206 GTTCCCACAGCCCCCTCCTTGGG - Intergenic
968920373 4:3519248-3519270 GCTGCCCTGTCCCCCTCCTTGGG - Intronic
968940657 4:3635802-3635824 GTTCCCACGACCCCCGCCTTGGG + Intergenic
969680734 4:8641993-8642015 CTTCCCATGTGTCCCTCTCTGGG + Intergenic
970289668 4:14557728-14557750 GTTCCCATGTCCACTTCATTTGG + Intergenic
970354330 4:15237008-15237030 GTTCCCATGACCCCCTTCTCAGG - Intergenic
970628896 4:17920125-17920147 GGTTCCATGACCCCCTCTTTGGG - Intronic
970697498 4:18695844-18695866 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
972766950 4:42159955-42159977 GTTCCTATGACCCCCTCTTTGGG + Intergenic
972983269 4:44731554-44731576 GTTCCCTTGGCACCCTGTTTTGG - Intergenic
973233067 4:47864897-47864919 GTTCACACAGCCCCCTCTTTGGG - Intronic
973267009 4:48220997-48221019 GTTCCCACAACCCCCTCCTTGGG + Intronic
973801808 4:54485769-54485791 GCTCCCATGTCCATCTCTGTTGG - Intergenic
973816829 4:54626892-54626914 GTTCCCACAACCCCCTCTTCAGG + Intergenic
974015988 4:56649789-56649811 GTTCTCCTGTTCTCCTCTTTGGG - Intronic
974934214 4:68394242-68394264 GTTCCCATGACCCCTTTTTTGGG - Intergenic
975536790 4:75459591-75459613 ATTCTCATGACCCCCTTTTTGGG - Intergenic
976391609 4:84510702-84510724 ATTCCCATGTCCTTCTCCTTTGG - Intergenic
976737850 4:88328684-88328706 ATTCCCATGACCCCCTCTTTGGG + Intergenic
976751494 4:88454935-88454957 GTTCCCTTGTCCCCTTCGTAGGG - Intergenic
976902574 4:90197080-90197102 GTTCCCACGACCCCCTCCTTGGG + Intronic
977481222 4:97578352-97578374 CTTCCCATGACCTCCTCTTTAGG - Intronic
977920518 4:102637838-102637860 GTTCCCATGACCCCTTCTTTGGG - Intronic
978110142 4:104953641-104953663 GTTTCCATGACCCCCTCCTCAGG + Intergenic
978132460 4:105214910-105214932 GTTCCCACAACACCCTCTTTGGG - Intronic
978177864 4:105755969-105755991 GTTCCCATGACACCCTCCTAAGG + Intronic
978327476 4:107575525-107575547 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
978723367 4:111941234-111941256 GTTCTCATGACCCCCTTCTTGGG - Intergenic
979181196 4:117729643-117729665 CTTCCCATGTCCCCCACTTTAGG + Intergenic
979958213 4:126981844-126981866 GTTCCCTTGATCCCCTCCTTAGG + Intergenic
980312692 4:131154202-131154224 GTTCCCAAGGCCACCTGTTTGGG + Intergenic
980765753 4:137301599-137301621 GTTCCCATGACTCCCTGTTTTGG + Intergenic
980864223 4:138535763-138535785 GTTCCCATGACCCCCTATTTGGG + Intergenic
980864335 4:138536690-138536712 GTTCCCATGATCCCCTCTTTGGG + Intergenic
981188009 4:141827960-141827982 ATTCCCATGATCCCCTCCTTGGG - Intergenic
981317142 4:143350932-143350954 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
981623797 4:146734480-146734502 GTTCCCCTGACTCCCTCTTTAGG - Intronic
981906112 4:149923736-149923758 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
982350174 4:154406899-154406921 GTTCCAATCTTCCCCTCCTTGGG + Intronic
982504500 4:156199273-156199295 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
982985397 4:162200449-162200471 GTTCCTACAACCCCCTCTTTGGG + Intergenic
983079961 4:163372802-163372824 GTTCCCATAACTCCCTCTTTAGG + Intergenic
983129270 4:163995165-163995187 GTTCCCACAACCCCCTCCTTAGG + Intronic
983382626 4:167017123-167017145 GTTCCCATTTCCCTTTCCTTGGG + Intronic
983626134 4:169803718-169803740 GTTCCCATGACCCCTTCTTTGGG - Intergenic
984232489 4:177115606-177115628 GTTCCCATGATCCCCTCCTTGGG - Intergenic
984272009 4:177558404-177558426 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
984388248 4:179092756-179092778 CTTCTCATGTCTTCCTCTTTTGG - Intergenic
985043654 4:185917600-185917622 GTTCCCATGTCCCCCTTCTTAGG - Intronic
985065548 4:186117520-186117542 GTGTCCATGTGCCCCACTTTTGG - Intronic
985248194 4:187997146-187997168 GCTCCGATGGCCCCCTCCTTGGG + Intronic
985271494 4:188197968-188197990 GTTCCCTTGTCCCCCTCACATGG - Intergenic
985395222 4:189536802-189536824 GTTCCCAAGATCCCCTCTTTGGG + Intergenic
985406107 4:189639771-189639793 GTTCCCATGACTCCCTCTTTGGG - Intergenic
986147165 5:5089163-5089185 GTTCCTATGACCCCCTCCTTGGG - Intergenic
986364704 5:7018947-7018969 GTTCCCTTATCCCCCTCTCAGGG + Intergenic
986974505 5:13379688-13379710 GTCCCCATGACCCCTTCTTTGGG - Intergenic
987203082 5:15596991-15597013 GTTTCCATGACCTCCTCCTTGGG - Intronic
987661866 5:20888531-20888553 GTTCCCATGACCTTCTCTTTAGG + Intergenic
988099027 5:26655155-26655177 GTTCCCATCATCCCCTCTTTGGG + Intergenic
988761720 5:34316788-34316810 GTTCCCATGGCCTTCTCTTTAGG - Intergenic
989186625 5:38632355-38632377 GTTCCCACAAACCCCTCTTTGGG - Intergenic
990429966 5:55725127-55725149 GTTCCCATGACCCCCTCTCTGGG + Intronic
990575482 5:57119883-57119905 GTTCCCATGACTCCTTCTTTAGG + Intergenic
990866690 5:60387949-60387971 GTTTCCATGACCCCTTCTTTGGG + Intronic
991022989 5:62000162-62000184 GTTCCCATGTCCCACACCTCTGG + Intergenic
992556255 5:77906440-77906462 GTTCCCATGATCCCCTCCTCAGG - Intergenic
992789937 5:80204212-80204234 GTTCCCAGCATCCCCTCTTTAGG - Intronic
993302137 5:86224263-86224285 GTTCCCTTATCCCCCTCTCAGGG - Intergenic
993391227 5:87321496-87321518 GTTTCCACAACCCCCTCTTTGGG + Intronic
993810526 5:92470578-92470600 GTTCTCATGACCTCCTCTTTGGG + Intergenic
993857794 5:93097451-93097473 GTTTTCATGACCCCCTCTTTGGG + Intergenic
993889399 5:93455027-93455049 GTTCTCATGACCCCATCCTTGGG - Intergenic
994439574 5:99785197-99785219 GTTTCCATGACCCCCTCTTTGGG + Intergenic
994787335 5:104181212-104181234 ACTCCCAGGTCCCCCTCCTTTGG - Intergenic
995114551 5:108465031-108465053 TTTTCCTTTTCCCCCTCTTTTGG + Intergenic
995130431 5:108624323-108624345 CTTCCCACGACCCTCTCTTTGGG - Intergenic
995392112 5:111651135-111651157 GTTCCCATGATCCCTTCCTTGGG + Intergenic
995450237 5:112291898-112291920 GTTCCCATGACCTTCTCTTTGGG - Intronic
996286751 5:121803161-121803183 GTTCCCATGTCCTCTGCCTTAGG - Intergenic
997005766 5:129814659-129814681 GTTCCTATGACCCCCTCTTTGGG + Intergenic
997428960 5:133824284-133824306 GTTCCCACAGCCCCCTCCTTGGG + Intergenic
998181684 5:139950469-139950491 CTTCCCATTTCCACTTCTTTAGG + Intronic
998421486 5:141991302-141991324 GTTCCTATGTACCCCTCACTTGG + Intergenic
999217468 5:149947239-149947261 GTTCCCATGACACCCTCTTTGGG - Intergenic
999392754 5:151206106-151206128 GTTTCCTTGACCTCCTCTTTGGG + Intronic
999990753 5:157047779-157047801 GTTCCCACAACCCTCTCTTTGGG - Intronic
1000847840 5:166303879-166303901 GTTCCCCTGACTCCCTCTTTAGG + Intergenic
1001217209 5:169867028-169867050 GTTCCCAAAACCCCTTCTTTGGG + Intronic
1001755247 5:174163628-174163650 GTTCCCACAACCCCCTCTTTGGG + Intronic
1001985365 5:176070040-176070062 GTTCCCAGGACTCCCTCTTTGGG - Intronic
1002231505 5:177768079-177768101 GTTCCCAGGACTCCCTCTTTGGG + Intronic
1002263836 5:178015669-178015691 GTTCCCAGGACTCCCTCTTTGGG - Intronic
1002626432 5:180532766-180532788 GTTCCCACGACCCCCTCTTTGGG + Intronic
1002837768 6:879753-879775 GTTCCCATGACCCCCTGTTTGGG - Intergenic
1003323798 6:5076640-5076662 GTTCCCAAGCACCCCTCCTTAGG - Intergenic
1004605838 6:17194428-17194450 GTTCCTATGACCCCCTCCTCAGG - Intergenic
1004680854 6:17892928-17892950 GTTCCCGTGTCCCCCTCCTCAGG - Intronic
1004687164 6:17957520-17957542 GTTTCCAGGACCCCTTCTTTGGG - Intronic
1004953556 6:20702137-20702159 GTTCCCTTGTCCCCCTCGCAGGG + Intronic
1005479864 6:26245345-26245367 GTTCCCATGTCCCTCCCCTCTGG + Intergenic
1005794693 6:29347598-29347620 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1005976607 6:30804904-30804926 ATTCCCACAACCCCCTCTTTGGG + Intergenic
1006267808 6:32939825-32939847 GTTCCCATGACCCCCTCCTTGGG - Intronic
1006483600 6:34319365-34319387 ATTTCCATGACCCCCTATTTGGG + Intronic
1006723809 6:36181162-36181184 ATTCCCATGACTCCCTCCTTGGG + Intergenic
1006962658 6:37949611-37949633 ATTCCCACAACCCCCTCTTTGGG + Intronic
1007404425 6:41625839-41625861 CTTCCTCTGTCCCCCTCTCTTGG + Intergenic
1008586823 6:52958253-52958275 ATTCCCACAACCCCCTCTTTGGG + Intergenic
1008952489 6:57175875-57175897 GTTCCCATGTCCCCCTCTTTGGG - Intronic
1009374264 6:62947879-62947901 ATTTCCATGACCCCCTGTTTGGG - Intergenic
1010659138 6:78548594-78548616 GTTTACATTTCCCCCACTTTGGG + Intergenic
1010995218 6:82524286-82524308 GTTCCCTTGTCCCCCTCACAGGG - Intergenic
1011259471 6:85456359-85456381 GTTCCCATGACCCTATCCTTGGG - Intronic
1011821699 6:91260724-91260746 GTTCCCATGACCCCCCTCTTTGG - Intergenic
1011823761 6:91282335-91282357 GCTCACATGACCCCATCTTTGGG - Intergenic
1013438839 6:110140428-110140450 GTTCCTATGACTCCCCCTTTGGG - Intronic
1013971982 6:116030806-116030828 CTTCCCATGACCCACTCTTGGGG - Intronic
1014434363 6:121405341-121405363 GCTTCCATTTCCCCTTCTTTTGG + Intergenic
1015433467 6:133157536-133157558 GTTCTCATGTACCAGTCTTTGGG - Intergenic
1015593394 6:134843575-134843597 GTTCCCACAACCCCCTCTTTGGG - Intergenic
1015689782 6:135909286-135909308 GTACCCATGTTCCCATCTTCAGG - Intronic
1016286690 6:142481486-142481508 GTTTCCATGACCCCCTTCTTAGG - Intergenic
1016825611 6:148385941-148385963 GTTCCCACGACCCCCTTTTGGGG - Intronic
1016951766 6:149587455-149587477 GTTGCCATGACTTCCTCTTTGGG + Intronic
1017769212 6:157632009-157632031 GTCCCCATGTGCCCCACTATGGG - Intronic
1017832195 6:158140614-158140636 GTGCCCATGACCCCCACCTTGGG - Intronic
1018195588 6:161353702-161353724 ATTCCCATGACTCCCTCTTTGGG - Intronic
1018772747 6:166986324-166986346 GTTCCCATGACCCCCTCTTTGGG + Intergenic
1018794355 6:167174495-167174517 GTTCCCTTGTCCCCCTCCCAGGG + Intronic
1018821964 6:167380572-167380594 GTTCCCTTGTCCCCCTCCCAGGG - Intronic
1019221321 6:170475106-170475128 CTTCCCATGGCTCCCTCTTTGGG - Intergenic
1019403158 7:867932-867954 GTTCCCTGGTACCCCTCTTGGGG - Intronic
1019870567 7:3757206-3757228 GTTCCCAAAACCCCCTCCTTGGG + Intronic
1020407338 7:7852500-7852522 GTTCCCACAACCCTCTCTTTGGG + Intronic
1020815288 7:12898206-12898228 TCTCCCACGTCCACCTCTTTAGG + Intergenic
1021105789 7:16638322-16638344 GTTCCCATGATCCCCTCCTCAGG + Intronic
1021115193 7:16739289-16739311 TTTCCCATGACCCCCTCTTTGGG - Intergenic
1021293016 7:18869088-18869110 GTTCCCATGCCCCCCTCTTTGGG - Intronic
1021625247 7:22586658-22586680 GTTCCCATGACCCCCTTCTCAGG - Intronic
1021737348 7:23653093-23653115 GTTCCCATGACCGTCTTTTTGGG + Intergenic
1022008452 7:26288719-26288741 GATCCCATGACCCCCTCCTTAGG + Intergenic
1022011094 7:26308709-26308731 GATCCCATGACCTCCTCCTTGGG - Intronic
1022048575 7:26643516-26643538 GATCCCATGATCCCCTCCTTGGG - Intronic
1022051307 7:26676365-26676387 GCTCCCATCTCTCCCTTTTTTGG + Intronic
1022473083 7:30693615-30693637 GTTCCCATGACCCTCTCTTTGGG - Intronic
1022568186 7:31424557-31424579 GATCCCATAACCCCCTGTTTGGG + Intergenic
1022987693 7:35674997-35675019 GTTCCCGTGACCCCCTCCTGGGG - Intronic
1023373365 7:39533286-39533308 GTGCCCATTTCTCCCTTTTTGGG - Intergenic
1023392209 7:39721260-39721282 GTTCCCACAACCTCCTCTTTGGG + Intergenic
1023919802 7:44619232-44619254 GATCCCATGACCCCCTCCTTTGG - Intronic
1024013141 7:45287707-45287729 GTTCCCATGGCCCACTCCTTGGG + Intergenic
1024103384 7:46056752-46056774 GTTCCCACAGCCCCCTCCTTAGG - Intergenic
1024136168 7:46411570-46411592 ATTCCCATGACTCCCTCTTTGGG + Intergenic
1024267741 7:47619669-47619691 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1024331787 7:48162265-48162287 GTTCCCATGACCCTCTCTTTGGG + Intergenic
1024536288 7:50437265-50437287 GTTCCCATGACCCCTTCTTTGGG + Intergenic
1025289605 7:57703991-57704013 GTTCTCATGACCCCCTCTTTGGG + Intergenic
1025911118 7:65829592-65829614 GTTCCCATGACCCTCTTCTTGGG + Intergenic
1025936176 7:66039497-66039519 GTTCCCAGGACCTCCTCTTTAGG + Intergenic
1025947992 7:66119421-66119443 GTTCCCAAGACCTCCTCTTTAGG - Intronic
1025978588 7:66389256-66389278 GTTCCCATGACCCCCTCTTGGGG - Intronic
1025987205 7:66464074-66464096 GTTCCCATGGCTCCCTTTTTAGG - Intergenic
1026003472 7:66581614-66581636 GTTCCCATGGCTGCCTTTTTAGG - Intergenic
1026027800 7:66761348-66761370 GTTCCCATGGCTCCCTTTTTAGG + Intronic
1026095834 7:67345942-67345964 GTTCCCACAACTCCCTCTTTGGG + Intergenic
1026344879 7:69465276-69465298 AATCCTATGACCCCCTCTTTGGG + Intergenic
1026372600 7:69716764-69716786 GTTCTCATGACCCCCTCCTCAGG + Intronic
1027204181 7:76083960-76083982 GTTCCCATGACCCCCTTCTTGGG - Intergenic
1027210481 7:76142910-76142932 GTTCCCATGGCTCCCTTTTTAGG - Intergenic
1027293725 7:76744758-76744780 GTTCCCATGACCCCCTCTTTCGG + Intergenic
1027632156 7:80620358-80620380 GTTCTCATTACCCCCTCTTTGGG + Intronic
1028192423 7:87868544-87868566 GTTCCCACAACTCCCTCTTTGGG + Intronic
1028294105 7:89105845-89105867 GTTCCCATGACCCCTTTGTTAGG + Intronic
1028404442 7:90460693-90460715 GTACTCATAACCCCCTCTTTGGG + Intronic
1028724359 7:94070789-94070811 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1029028937 7:97448590-97448612 GTTCCTATCACCCCCTCCTTGGG + Intergenic
1029036652 7:97529396-97529418 ATTCCCATGACCCCCACTTTGGG + Intergenic
1029404841 7:100368493-100368515 GTTCCCATGATCCCCTCCTTGGG + Intronic
1030586888 7:111432016-111432038 GTTCCCATGACCCCCTCTTTGGG - Intronic
1031795287 7:126166590-126166612 GTTCTCATGAGCCCTTCTTTAGG - Intergenic
1032545054 7:132734737-132734759 GTTCCCTTGTCCCCCTCGAAGGG - Intergenic
1032729891 7:134630013-134630035 GTTCTCATGACCCCCTCCTCAGG - Intergenic
1032795489 7:135272677-135272699 GTTCCCATTTCTCCCTCCTCTGG - Intergenic
1032913678 7:136462731-136462753 GTTCCCATGACCCCCTCTTTAGG - Intergenic
1033063964 7:138135020-138135042 GTTCTCAAGACCCCCTCCTTGGG - Intergenic
1033079349 7:138280246-138280268 GTTCACATGATCCCCTCCTTGGG - Intergenic
1033841236 7:145376713-145376735 GTCCCTTTGTCCTCCTCTTTTGG + Intergenic
1034099211 7:148436942-148436964 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1034482446 7:151332939-151332961 GTTCCCACAACCCCCTCCTTAGG - Intergenic
1036116504 8:5965951-5965973 ATTCTCATGACCCCTTCTTTGGG - Intergenic
1036533997 8:9627341-9627363 GTTCCCATGACCTCCTCTTTGGG - Intronic
1037058106 8:14469984-14470006 GTTCCCATCAACCCATCTTTGGG - Intronic
1037110487 8:15159385-15159407 GTTCCCATGACCCACTCTTTGGG - Intronic
1037456061 8:19065520-19065542 GTTCCCATGATCCCCTCCTTGGG + Intronic
1037558850 8:20054412-20054434 GTTCCCATGATCCCCTCCTTGGG + Intergenic
1037586032 8:20276660-20276682 GTTCCCATGACCCCAGCCTTGGG - Intronic
1037722778 8:21459078-21459100 GTCCCCATGACCTCCTTTTTGGG - Intergenic
1038280793 8:26162492-26162514 GTTCCCATGACCCCCTCCTCTGG + Intergenic
1038427323 8:27472245-27472267 GTTCCCATGACCCCCTCCCTGGG - Intronic
1038473344 8:27843848-27843870 CTTCCCATGAACCCCTCTTTGGG + Intergenic
1038625665 8:29190617-29190639 GTTCCCACAACCTCCTCTTTGGG - Intronic
1038839643 8:31171227-31171249 GTTCAGATGTACTCCTCTTTTGG + Intronic
1039076185 8:33692657-33692679 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1039262003 8:35782010-35782032 GTGCCCATGTCCTTCCCTTTCGG + Intronic
1039330775 8:36534393-36534415 ATTTCCATGACCCCCTCTTTGGG + Intergenic
1039536951 8:38325083-38325105 GTTCTCGTGACCCCCTCCTTGGG - Intronic
1039803888 8:40982643-40982665 GTGCCCAGGACTCCCTCTTTGGG - Intergenic
1039804485 8:40986767-40986789 GTTCCCATGACTCCCTCACTGGG + Intergenic
1039820164 8:41127799-41127821 GTTCCCACAACCCCCTCTTTGGG - Intergenic
1040733479 8:50477723-50477745 GTTCCCATGTACCCCACATCCGG - Intronic
1040744723 8:50627629-50627651 GTTCCCATGACCCCACCTTCAGG + Intronic
1040932345 8:52748236-52748258 ATTCCCATGACCCACTCTTCAGG + Intergenic
1041164827 8:55080865-55080887 GTTCCCAAGTCTGCCTTTTTGGG - Intergenic
1041657695 8:60370350-60370372 GTTCCCATGTCCCGCTCTTTGGG + Intergenic
1041669446 8:60478229-60478251 GGTCCCATGACCCCCTCTTTGGG + Intergenic
1041710623 8:60891025-60891047 GTTCCAATTTCCCCATCTGTGGG + Intergenic
1041950503 8:63495642-63495664 GTTCCCATGACCCCCTCTTTGGG - Intergenic
1042111809 8:65389075-65389097 GATCCCATGCCCCGCTCTTTGGG - Intergenic
1042149627 8:65767880-65767902 GTTCCCAGGACCCTCTTTTTGGG - Intronic
1042344675 8:67715307-67715329 GTTCCCATGACCCCCTTCTTAGG + Intronic
1043091337 8:75908045-75908067 GTTCCCATAACCCCCACTTTGGG - Intergenic
1043310906 8:78858903-78858925 GTTCCCTTGTCCCCTTCTCAGGG + Intergenic
1043850929 8:85215803-85215825 GTTCCCATGACCCCCTCCTTGGG - Intronic
1043919580 8:85965760-85965782 TTTCCCATCTCCTTCTCTTTTGG - Intergenic
1044073219 8:87787828-87787850 TTTTCCATGTCCCCATCTTATGG - Intergenic
1044553349 8:93536056-93536078 GTTCCCATTGTCCCCTCTTTGGG + Intergenic
1044606693 8:94054135-94054157 GTTCCCAGGACCCCCTCCTTGGG + Intergenic
1044697665 8:94938830-94938852 GTTCCCACGACCCCTTCCTTGGG - Intronic
1045347787 8:101310270-101310292 GTTCCCATGACCCCCTCTTTGGG + Intergenic
1045517398 8:102872206-102872228 GTTCCCATGACCTCCTCTTTGGG + Intronic
1045861582 8:106819603-106819625 GTTCCCTTGTCCCCCTTTCAAGG - Intergenic
1045911541 8:107416265-107416287 GTTCCCATGATTCCCTCTGTAGG + Intronic
1045940281 8:107730008-107730030 GTCCCCATGACCCTCTCTTTGGG - Intergenic
1045991578 8:108314662-108314684 GTTCCCATGACCCCCTCTTTGGG - Intronic
1046550228 8:115706676-115706698 GTTCCCATGATCCTCTCTTCAGG + Intronic
1046870099 8:119196756-119196778 GTTCCTTTGTCCCCCTCATAGGG + Intronic
1047202043 8:122775607-122775629 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1047640841 8:126820514-126820536 GTTCCCTTGTCCCCCTCTCAGGG + Intergenic
1048135086 8:131740482-131740504 GTTCCCTTGTCCCCCTCTCAGGG - Intergenic
1048340790 8:133537114-133537136 GTTCCCATGACCCCCTTTCTGGG + Intronic
1048427737 8:134338452-134338474 GTTCCCACGACCCCCTCCTCAGG + Intergenic
1049161250 8:141099400-141099422 GTTCCCACGACCCCCTCCTCGGG + Intergenic
1049282424 8:141756956-141756978 CAGCCCAAGTCCCCCTCTTTGGG + Intergenic
1049429771 8:142555369-142555391 GTTCCCACGACCCTCTCCTTGGG - Intergenic
1049495057 8:142926138-142926160 GATCCCAAGTCGCCCTCTGTGGG - Intergenic
1049861944 8:144904736-144904758 GTTTCCATGACTCCCTCTTTGGG + Intergenic
1049872765 8:144993906-144993928 GTTCCCATGACCCTCACTTTGGG - Intergenic
1050538373 9:6649313-6649335 GTTTCCATGATCCCTTCTTTGGG - Intergenic
1050784771 9:9387700-9387722 GTTCCTTTGTCCCCCTCTCAGGG + Intronic
1050988385 9:12113081-12113103 CTTCCCATGACCCCTTCTTTGGG + Intergenic
1051092350 9:13424585-13424607 GTTCCCTTGTCCCCATCTCAGGG - Intergenic
1051427726 9:16950599-16950621 GTTTCCATGAGTCCCTCTTTGGG - Intergenic
1052949101 9:34193582-34193604 GTTCCCACGATCCCCTCTTTGGG + Intronic
1053415740 9:37945781-37945803 CTCCCCATGTCCCCATCTGTGGG - Intronic
1053608715 9:39687559-39687581 GTTCCCATTACCCCCTGTTTAGG - Intergenic
1053797462 9:41739759-41739781 GTTCCTACGACCCCCTCTTTGGG + Intergenic
1053866561 9:42443911-42443933 GTTCCCATTACCCCCTGTTTAGG - Intergenic
1054147726 9:61575184-61575206 GTTCCTACAACCCCCTCTTTGGG - Intergenic
1054185875 9:61951811-61951833 GTTCCTACGATCCCCTCTTTGGG + Intergenic
1054244809 9:62654839-62654861 GTTCCCATTACCCCCTGTTTAGG + Intergenic
1054467474 9:65506231-65506253 GTTCCTACGACCCCCTCTTTGGG - Intergenic
1054558936 9:66689382-66689404 GTTCCCATTACCCCCTGTTTAGG + Intergenic
1054652631 9:67636708-67636730 GTTCCTACGACCCCCTCTTTGGG - Intergenic
1055081125 9:72268682-72268704 GTTCCCTTGTCCCCCTCGTAAGG + Intergenic
1055199752 9:73646181-73646203 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1055250140 9:74293868-74293890 GTTCCCACGACTCCCTCTTTGGG + Intergenic
1055305780 9:74927744-74927766 GTTCCTATGAGTCCCTCTTTGGG + Intergenic
1055484869 9:76746969-76746991 GTTCCCATGACCGCTTCCTTGGG - Intronic
1055485259 9:76750232-76750254 GTTCCCAAGACCCTCTCTTCTGG - Intronic
1056023311 9:82464375-82464397 GTTCCCATGATCCCCTCCTTAGG - Intergenic
1056023359 9:82464870-82464892 GTTCCCATGATCCCCTCCTTAGG - Intergenic
1056327428 9:85491288-85491310 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1056605625 9:88082541-88082563 GTTCCCATAATTCCCTCTTTGGG - Intergenic
1056625079 9:88246168-88246190 GTTCCCATGACCCTCTCCTCAGG - Intergenic
1056890581 9:90488240-90488262 GTTCCCACCATCCCCTCTTTGGG - Intergenic
1056945260 9:90989687-90989709 ATTCCCATCTCCTCATCTTTTGG + Intergenic
1056956582 9:91086711-91086733 GTTCCCATGACCCTCTCTTTGGG - Intergenic
1057021277 9:91699388-91699410 GGTCCCACAACCCCCTCTTTGGG - Intronic
1057469410 9:95344268-95344290 GTTCCCATGGCTCCCTTTCTGGG + Intergenic
1057495982 9:95561736-95561758 GATCCCATTTCCCCCTCTCATGG + Intergenic
1057711456 9:97449427-97449449 GTTCCCAAAACCTCCTCTTTGGG + Intronic
1057851143 9:98567860-98567882 TTTGCCATGTCTCCCTCTTTTGG + Intronic
1059108249 9:111530436-111530458 GTTCCCATGAGCCCCTCCCTGGG - Intronic
1060064214 9:120488941-120488963 GAACCCATGTCTCTCTCTTTCGG + Intronic
1060213824 9:121726454-121726476 TTTCCCATAAACCCCTCTTTGGG - Intronic
1061024779 9:128041438-128041460 GTTCCCATGATTCCCTCTTTGGG - Intergenic
1061294276 9:129668250-129668272 GATCCCATCTCCCCCACCTTTGG - Intronic
1061333385 9:129912017-129912039 GTTCCCCTGACCCTCTCTTTGGG - Intronic
1061504176 9:131021760-131021782 GTTCCCATGACCCCTTCTTTGGG + Intronic
1061737472 9:132670984-132671006 CTTCCCCTGTCCCCCTCTCGCGG + Intronic
1061812197 9:133168748-133168770 GTTCCCAGAGCCTCCTCTTTGGG + Intergenic
1062249222 9:135585981-135586003 GTCCCCCTGTCCTCCTCTGTAGG + Intergenic
1062744235 9:138201351-138201373 GTTCCCGTGCCAGCCTCTTTGGG - Intergenic
1203610956 Un_KI270749v1:2950-2972 GTTCTCATGACCCCCTCTTTGGG - Intergenic
1185619593 X:1445342-1445364 ATTCCTATGTCCTCCTCTCTGGG + Intronic
1185797008 X:2973793-2973815 GTTCCCTTGACCCCCTTTGTGGG + Intergenic
1185942806 X:4340467-4340489 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1186255050 X:7709127-7709149 GTTCCCACAGTCCCCTCTTTCGG - Intergenic
1186263252 X:7803984-7804006 GTCCTCATGCCCCACTCTTTCGG + Intergenic
1186697051 X:12046560-12046582 GTTCCCTCAGCCCCCTCTTTGGG + Intergenic
1186837209 X:13450017-13450039 GTCCCCATAACCCCCTCCTTGGG + Intergenic
1186861830 X:13680335-13680357 TTTGCAATGTCCCTCTCTTTAGG + Intronic
1186896053 X:14005616-14005638 GTTCCCACGACCTCCTCTTTGGG - Intergenic
1187048623 X:15674811-15674833 GTTCCCAGGCCACCCACTTTTGG - Intergenic
1187373233 X:18727746-18727768 GTTCCCATGACCCCCTCTTTGGG + Intronic
1187862022 X:23691957-23691979 GTTCCCATGACCCCCTCTTTAGG + Intergenic
1188597797 X:31922421-31922443 GTTCCCATGACCCTCTCTTTGGG - Intronic
1188972820 X:36638317-36638339 ATTCCCATGACTCCCTCCTTGGG + Intergenic
1189083889 X:38000408-38000430 GTTCCCTTGTCCCCCTCACAGGG + Intronic
1189312418 X:40029051-40029073 ATTTCCATGACCCCCTCCTTGGG - Intergenic
1189340752 X:40202872-40202894 GTTCCCATGACCCCCTCTTTGGG + Intergenic
1189515602 X:41711062-41711084 GATCCCACGGCTCCCTCTTTGGG - Intronic
1189949627 X:46215004-46215026 GTTCCCACGACCCCCTCCTTGGG - Intergenic
1191146562 X:57172304-57172326 GTTCCCTTGTCCCCCTCACAGGG + Intergenic
1191930703 X:66368295-66368317 ATTTCCATGACCCCCTCTTTAGG + Intergenic
1193769637 X:85573586-85573608 GTTCCCATGATCCCCTCTTTGGG - Intergenic
1193836266 X:86348798-86348820 GTTCCCTTGTTCCCCTCTCAGGG + Intronic
1194912916 X:99669431-99669453 CTTCAAATGTCCCCCCCTTTTGG - Intergenic
1195087301 X:101424406-101424428 GTTCCCATGACCCTCCCCTTGGG - Intronic
1195344185 X:103932162-103932184 GTTCACATGACCCCCTCTTTGGG - Intronic
1195362763 X:104101051-104101073 GTTCACATGACCCCTTCTTTGGG + Exonic
1196072368 X:111539706-111539728 GTTCCCTTGTCCCCCTCGCAGGG - Intergenic
1196258819 X:113554367-113554389 GTTCCCTTGTCCCCCTCGCAGGG + Intergenic
1196387677 X:115175898-115175920 GTTCCCATGACCCCCTCCTCAGG - Intronic
1196783707 X:119404340-119404362 GTTCCCACGACCCCCTCTTTGGG + Intronic
1196802028 X:119552377-119552399 GTTCCCACGACCCCCTCTTTGGG + Intronic
1197337955 X:125231259-125231281 GTTCCCACAACCCCCTCTTTGGG - Intergenic
1198048412 X:132925376-132925398 GTTTCCACGACCCCCTCCTTGGG - Intronic
1198167494 X:134072010-134072032 GTTCCCTTGTCCCCCTCATAGGG + Intergenic
1198743133 X:139862321-139862343 GTTCCCATGAACCTCTCCTTGGG - Intronic
1199237488 X:145507667-145507689 GTTCCCATGATCCCCTCTTTGGG - Intergenic
1199619659 X:149687775-149687797 GTTGTCATGACCCCTTCTTTAGG + Intergenic
1200377210 X:155795524-155795546 GTTCTCATGACACCCTCTCTGGG - Intergenic