ID: 1008952490

View in Genome Browser
Species Human (GRCh38)
Location 6:57175876-57175898
Sequence GGTTCCCATGTCCCCCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 26, 2: 88, 3: 241, 4: 572}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952490_1008952498 28 Left 1008952490 6:57175876-57175898 CCAAAGAGGGGGACATGGGAACC 0: 1
1: 26
2: 88
3: 241
4: 572
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952490_1008952491 -4 Left 1008952490 6:57175876-57175898 CCAAAGAGGGGGACATGGGAACC 0: 1
1: 26
2: 88
3: 241
4: 572
Right 1008952491 6:57175895-57175917 AACCCCAATTTGAAGCCAGTTGG No data
1008952490_1008952495 9 Left 1008952490 6:57175876-57175898 CCAAAGAGGGGGACATGGGAACC 0: 1
1: 26
2: 88
3: 241
4: 572
Right 1008952495 6:57175908-57175930 AGCCAGTTGGTCAGAAGTTCTGG 0: 14
1: 54
2: 156
3: 288
4: 577
1008952490_1008952497 12 Left 1008952490 6:57175876-57175898 CCAAAGAGGGGGACATGGGAACC 0: 1
1: 26
2: 88
3: 241
4: 572
Right 1008952497 6:57175911-57175933 CAGTTGGTCAGAAGTTCTGGAGG 0: 16
1: 29
2: 95
3: 185
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952490 Original CRISPR GGTTCCCATGTCCCCCTCTT TGG (reversed) Intronic
900745464 1:4357630-4357652 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
901385193 1:8903563-8903585 GGTTCCCATGACCCCCTCTTTGG - Intergenic
901488097 1:9579398-9579420 GGTTCCCATGACCCTCTCTTTGG + Intronic
902512084 1:16972074-16972096 GGGTCACATGTCCACCCCTTGGG + Intronic
902585160 1:17434571-17434593 GGTTCTCATGACCCCCTCTTTGG - Intronic
903102213 1:21040477-21040499 GGATCTCATGATCCCCTCTTTGG - Intronic
903281346 1:22251759-22251781 GCCATCCATGTCCCCCTCTTTGG + Intergenic
904059391 1:27696155-27696177 GGTCTCCATGATCCCCTCTTTGG + Intergenic
904218283 1:28942382-28942404 GGTTCCCACAACCCCCTCTTTGG + Intronic
904868255 1:33599695-33599717 AGTTCCCATGCCCCTCTCATTGG - Intronic
905280907 1:36848938-36848960 GGGACACCTGTCCCCCTCTTTGG - Intronic
905534407 1:38708985-38709007 CGTGCCCATGTCCTCCTCCTTGG - Intergenic
905558646 1:38908581-38908603 AGTTCCCTTGTCCCCCTCGCAGG + Intronic
905569213 1:38991037-38991059 GGGTCCCATCCCCCCCGCTTTGG - Intergenic
905692093 1:39950992-39951014 GGTTCCCATGATCCCCTCTTTGG + Intergenic
905810374 1:40908361-40908383 TGGTCCCATGACCCCCTTTTTGG - Intergenic
906433209 1:45772907-45772929 GGTTCCCACATCTCCCTGTTTGG - Intergenic
906482743 1:46210550-46210572 GGTTCCTATGACCCCCTCCTTGG + Intronic
906684906 1:47757017-47757039 AGCCCCCTTGTCCCCCTCTTGGG + Intergenic
907035232 1:51210573-51210595 GGTTCCCACAACCCCCACTTTGG + Intergenic
907103235 1:51856457-51856479 GGTTCCCACGACCTCCTCTTTGG + Intronic
907169885 1:52452812-52452834 GGTTCCTATGACGACCTCTTTGG - Intronic
908560498 1:65301526-65301548 GGTTCCCATGATCCCCTCTTTGG + Intronic
908689698 1:66764445-66764467 ATTTCCCATGTCTCTCTCTTTGG - Intronic
908908793 1:69047878-69047900 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
909130064 1:71723745-71723767 GATTCCCACTTCCCCCTCTCTGG - Intronic
909863061 1:80633006-80633028 GGTTCCCTTGTCCCCCTTGCAGG - Intergenic
910035586 1:82783771-82783793 GGCTCTCATGGCCCCCTCTTTGG - Intergenic
910229266 1:84969230-84969252 GGTTCCCATGACTCCCTCTTTGG - Intronic
910477264 1:87620425-87620447 GGTTCCCTTGTCCCCCTTGCAGG - Intergenic
910824194 1:91388216-91388238 GCTTCCCATGACCCCATCTTAGG - Intronic
910914859 1:92277882-92277904 GATTCCCAGGACCCCCTCCTTGG - Intronic
911262888 1:95708468-95708490 GGTTCCCACGATCCCCTCTTAGG + Intergenic
911352521 1:96772171-96772193 GGTTCCCACAACCCCCTTTTTGG + Intronic
911435968 1:97857751-97857773 GATTCCCATGACCACCTCTTTGG - Intronic
912134934 1:106649206-106649228 GGTTCCCATGACCCCCTCTTTGG - Intergenic
912665019 1:111571093-111571115 GGTTCCCATGACTCCCCCTCAGG + Intronic
913171873 1:116240503-116240525 GGTTACCACAACCCCCTCTTTGG - Intergenic
914934831 1:151969119-151969141 GGTTCCTATGACCTCCTCCTGGG - Intergenic
914977211 1:152377828-152377850 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
916553805 1:165875624-165875646 GGTTCCCATAACCCCCTCTTAGG + Intronic
917499999 1:175577382-175577404 GATTCCCTGGTCACCCTCTTGGG + Intronic
917543330 1:175936653-175936675 GGTTCCCATGAACCCTTCTTTGG - Intergenic
917995793 1:180437235-180437257 GGTTCCCATGACCCCCTCTTTGG - Intronic
918081419 1:181210508-181210530 GGTGCCCATGTCCCTTTCTAAGG + Intergenic
918362419 1:183772393-183772415 GGTTCCCTTGTCCCCCTCCCAGG - Intronic
919183660 1:194117710-194117732 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
919193496 1:194253479-194253501 GGTTCCCATGACCCTCTCTTTGG - Intergenic
919493093 1:198229417-198229439 GGTTCCCCTGACCCCCTCTCTGG - Intronic
919539063 1:198827123-198827145 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
919661130 1:200248811-200248833 TATTCCCTTGTCACCCTCTTCGG + Intergenic
919678756 1:200412012-200412034 GGTTCCCATGACCCCTTCCTTGG - Intergenic
919715268 1:200769576-200769598 GGTTCCCATGACCCCCTCTTTGG + Intronic
920266169 1:204725051-204725073 GGTTCCCAAGACCCCCTCCTTGG + Intergenic
920403780 1:205693912-205693934 GGTTCCCAGGGCTCCCACTTGGG + Intergenic
920897722 1:210074688-210074710 AGTTCCCTTGTCCCCCTCTCAGG + Intronic
921068306 1:211638512-211638534 GGTTCCCATGGCCCCCTCTTTGG + Intergenic
921686591 1:218095783-218095805 CGTTCCCACAACCCCCTCTTTGG - Intergenic
921785966 1:219229793-219229815 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
922204790 1:223436872-223436894 GGTTCCCATGACTCCCCCTCAGG + Intergenic
922699998 1:227753725-227753747 GGTTCCCTTGTCCCCCTCACAGG + Intronic
922939452 1:229448805-229448827 GGTTCCCACAACCCCCTCCTTGG - Intronic
923206100 1:231760366-231760388 GTGTCCCATCTCTCCCTCTTTGG - Intronic
923228397 1:231960884-231960906 GATTCCCATGATCCCCTCCTTGG + Intronic
923378392 1:233389892-233389914 GGTTCCCAGGACCTCCTCCTTGG - Intergenic
923383719 1:233446664-233446686 GATTCCACTGTCCCCCTCATAGG + Intergenic
923744837 1:236690907-236690929 GCTTCCCATTCCCCCCTCCTCGG + Intronic
923804467 1:237243340-237243362 GGTTCCCATGACCCCCTGTTTGG + Intronic
924736392 1:246760814-246760836 AGTTCCCGTTTCCCCCTCTGTGG + Intronic
1062871455 10:908436-908458 GATCCCCATGGCCCCCTCTTTGG - Intronic
1063564144 10:7157583-7157605 GTTTCCCATTTTGCCCTCTTAGG + Intergenic
1063869851 10:10405451-10405473 GGATCCCACGACCCCCTCCTAGG - Intergenic
1064950952 10:20849558-20849580 GTTTCCCATCTCCTCCTCTAAGG + Intronic
1064962672 10:20983057-20983079 GGTTGCCATACTCCCCTCTTCGG - Intronic
1065036021 10:21639406-21639428 GGTTCCCACAGCCCCCTCCTTGG + Intronic
1065053646 10:21820733-21820755 GGTTCCCATGACCCCCTCTTTGG + Intronic
1065208089 10:23375863-23375885 GGTTCCCACAACCCCCTCTTTGG - Intergenic
1065468033 10:26046112-26046134 GGTTCCCATGACCGTCTCCTTGG - Intronic
1065778363 10:29143340-29143362 GGTTCCCTTGTCCCCCTCCCAGG - Intergenic
1065935804 10:30519584-30519606 GGTTCCTATAACCCCTTCTTTGG + Intergenic
1065990665 10:31006584-31006606 GGTTCCCACAACCACCTCTTTGG - Intronic
1066040326 10:31542946-31542968 GGTTCCCACAACTCCCTCTTTGG + Intergenic
1066265826 10:33774762-33774784 GGTCCCCTTGTCCCCCTCACAGG - Intergenic
1067282557 10:44883438-44883460 GGTGCCCATGACTCCCCCTTAGG + Intergenic
1067315838 10:45161171-45161193 GGTTCTCATGACTCCCTCTTTGG - Intergenic
1067675478 10:48371809-48371831 GGTTCCCATGATCCGCTCCTTGG + Intronic
1067677164 10:48391793-48391815 GGTTCCCATGCCCCTCTCTTTGG + Intronic
1067859600 10:49831838-49831860 GGTTCCCATGTCCCCACCTCAGG - Intronic
1067870577 10:49957157-49957179 GTTTCCCACAACCCCCTCTTTGG + Intronic
1068134740 10:52940488-52940510 GGTTCCCTTGTACCCCTCGCTGG - Intergenic
1068258396 10:54543492-54543514 GGTTCCCTTGTCCTCCTCGCAGG - Intronic
1068429441 10:56912895-56912917 GGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1068607988 10:59026661-59026683 TGTTCCCTTGTCCCCCTCACAGG - Intergenic
1069175535 10:65284969-65284991 GGTTCCCATGACCACCACTTTGG - Intergenic
1069222700 10:65903944-65903966 AGTTCCCTTATCCCCCTCTCAGG - Intergenic
1069576492 10:69533701-69533723 GGTTCCCATGAACCCGTCCTTGG - Intergenic
1069897925 10:71690354-71690376 GGGTCCCACGTCCTCCTCTTGGG + Intronic
1070252493 10:74785120-74785142 GGCTCCCATGACCCCATCTTTGG - Intergenic
1071028197 10:81140348-81140370 GGTTCCCATGTCCCCCTCACAGG - Intergenic
1071078561 10:81783368-81783390 AGTTCCCATAACCCCCTCCTTGG + Intergenic
1071220488 10:83459369-83459391 TGTTCCCTTGTCCCCCTTGTAGG - Intergenic
1071310784 10:84341736-84341758 GGTTCCCATGACCCCCTTCTTGG + Intronic
1071353150 10:84767057-84767079 GGTTCCCTTGTCCTCCTCACAGG + Intergenic
1071662485 10:87518703-87518725 CGTTCCCATGACCTCTTCTTTGG + Intronic
1071928366 10:90437176-90437198 GGTTCCCATGCCCCTGTCTTTGG - Intergenic
1072162535 10:92781685-92781707 GGTTCCCTTGTCCCCCAACTGGG - Intergenic
1072350916 10:94556006-94556028 GGTTCCCACAAGCCCCTCTTTGG - Intronic
1073160856 10:101393343-101393365 GGTTACCATGATCCCCTCTGTGG - Intronic
1073249269 10:102111863-102111885 GAGTCCCCTGACCCCCTCTTGGG + Intronic
1073848723 10:107589122-107589144 GGTTCCCATGACCCTCTCTTTGG - Intergenic
1074363214 10:112839028-112839050 GCTGCCCATGGCCCCCTCCTTGG - Intergenic
1074777388 10:116776117-116776139 GGTTCCCAGGTCCCTGTTTTGGG + Intergenic
1074969036 10:118520545-118520567 GATTCCCATGTCCGGCACTTTGG - Intergenic
1075674682 10:124288061-124288083 GGGTCCCATGGCACCCACTTTGG - Intergenic
1075690318 10:124389647-124389669 GGTTCCCATTCCCCCGTCTTGGG - Intergenic
1075722159 10:124593549-124593571 TACTCCCATGTCCTCCTCTTGGG + Intronic
1076258203 10:129045300-129045322 GGTTCCCATGCCCCCTGCTCCGG + Intergenic
1076563032 10:131379834-131379856 GGTTCCCCTGTCCTTCCCTTTGG + Intergenic
1076833084 10:133006742-133006764 GGTTCCCGTCTCTCGCTCTTGGG - Intergenic
1076862153 10:133143009-133143031 GGTTCCCATGATCCCCTCCTTGG + Intergenic
1077663917 11:4091885-4091907 CCTTCCCATGCCCCACTCTTGGG - Exonic
1078301978 11:10140648-10140670 GGTTCTCATGGCCCCTCCTTGGG - Intronic
1078346521 11:10554549-10554571 GGTTCTCATGACCCCCTCTTTGG - Intergenic
1078457311 11:11485338-11485360 GATTCCTATGACCCCCTCCTCGG + Intronic
1079187868 11:18253687-18253709 GGTTCCCATGACCCCCTCTTTGG - Intergenic
1079256879 11:18838291-18838313 GGTTCCCATGCCCCCCAGCTGGG + Intergenic
1079835317 11:25326774-25326796 AGTTCCCATGACACCCTCTCTGG - Intergenic
1080326474 11:31079474-31079496 GATTCTCATGACCCCCTCGTTGG - Intronic
1080606375 11:33868709-33868731 GGTTCACATGTCCCCATCGGTGG + Intronic
1081342621 11:41947116-41947138 GGTTCCCTTGTCCCCCTCACAGG + Intergenic
1081499526 11:43652587-43652609 GGTTCCCATGACCCCCTGTTTGG + Intronic
1082262357 11:50086444-50086466 GGTTCCCATGACCCTCTTCTTGG - Intergenic
1082685327 11:56231554-56231576 ATCTCCCATGACCCCCTCTTTGG + Intergenic
1083039939 11:59676085-59676107 GGTTCCCATGACCCCCTCTTTGG - Intergenic
1083168152 11:60904548-60904570 GGTTCCCATGACCTCCTTTTTGG + Intronic
1083543180 11:63528999-63529021 GGTTCCCAGGACCTCCTCATTGG - Intergenic
1083703252 11:64495218-64495240 GGTTCCCATGACCCCCTTTTTGG + Intergenic
1083810833 11:65105784-65105806 GGTTTCCATAACTCCCTCTTTGG + Intronic
1084042034 11:66547829-66547851 GCTGCCCCTGTGCCCCTCTTTGG - Intronic
1084205927 11:67592967-67592989 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
1084396494 11:68914374-68914396 GGTTCCCTTGTCCCCCTCGCAGG + Intronic
1084737934 11:71117875-71117897 GGTTCCCACCACCCCCTTTTTGG - Intronic
1085371044 11:76005743-76005765 GGTTCCCATAACCCACTCCTTGG + Intronic
1085442895 11:76579460-76579482 TGTTCCCCTTCCCCCCTCTTCGG - Intergenic
1085684139 11:78606192-78606214 GGTTCCCTTGTCCCCCTCCCAGG - Intergenic
1085702142 11:78755057-78755079 GCTTCCCTTGTCACCCTCTGGGG + Intronic
1086345041 11:85887405-85887427 GGTTCCCATGTCCCCCTATCAGG + Intronic
1086575160 11:88331339-88331361 GGTTCCCATAACCCCCTCTTTGG + Intronic
1086956446 11:92938738-92938760 GGTTCCCATGACCTCCTCCTTGG - Intergenic
1087023735 11:93629173-93629195 GGTTCCCAGGACACCCTCTTTGG - Intergenic
1087233844 11:95696490-95696512 GGTTCCCATGACCCTATCTTTGG + Intergenic
1087261203 11:96014147-96014169 GATTCCCTTGTCCCCCTCGCAGG - Intronic
1087328072 11:96747218-96747240 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1087363227 11:97187082-97187104 GGATCCCATGGTCCCCTCTTTGG + Intergenic
1087474978 11:98623411-98623433 AGTTCCCTTGTCTCCCTCTCAGG + Intergenic
1087781938 11:102310413-102310435 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1088103303 11:106177586-106177608 GGTTCCCTTGTCCCCCTCACAGG - Intergenic
1088238460 11:107750057-107750079 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1089058761 11:115608884-115608906 GCTTCCCAAGTCCCCCTTATGGG + Intergenic
1089949165 11:122509616-122509638 GGTTCCCTTGGCCCCCTTTCAGG + Intergenic
1090136213 11:124201364-124201386 AGTTCCCTTGTCCCCCTCGAAGG - Intergenic
1090492350 11:127175904-127175926 GGTTCCCACGACCCCCTCCTTGG - Intergenic
1090635487 11:128688210-128688232 GGCTCCCACGTGCCCCTCTAGGG - Intronic
1091577210 12:1749017-1749039 GGCTCCCATGGCCCCCTCTTTGG + Intronic
1092177107 12:6417595-6417617 GGTTCCCATGACCCCCTCTTTGG + Intergenic
1092252522 12:6908016-6908038 GGTTCCCATGACCTCTTCTCTGG + Intronic
1093089451 12:14904872-14904894 AGTTCCCTTGTCCCCCTCGCAGG - Intronic
1093261980 12:16950171-16950193 GGCTCCCCTCTGCCCCTCTTGGG - Intergenic
1093503341 12:19836704-19836726 GATTCCCTTGTCCCCCTCGCGGG - Intergenic
1093639603 12:21511173-21511195 GGTTCCCACGATCCCCTGTTTGG + Intronic
1094461134 12:30697221-30697243 GGTTCCCTTGTCCCCCTCACAGG - Intergenic
1094603683 12:31932619-31932641 GGTTCCCATGACCCCCTCTTTGG + Intergenic
1094742303 12:33303540-33303562 GGTTCCCATGACCCCCTCTTTGG - Intergenic
1095043692 12:37474431-37474453 GGTTCTCCTGACCCCCTCTTTGG + Intergenic
1095052789 12:37568928-37568950 GGTTCCTACGACCCCCTCTTTGG - Intergenic
1095704629 12:45223173-45223195 GGTTCCCACGACACCCTCCTTGG - Intronic
1095730958 12:45506320-45506342 GGTTCCCATGACCCCTTCTTTGG - Intergenic
1095898548 12:47305108-47305130 GGTTCCCTCGTCCCCCTCACAGG + Intergenic
1096132215 12:49168599-49168621 CGCTCCCATGACCCCTTCTTTGG - Intergenic
1096171726 12:49476687-49476709 AGTTCCCTTGTCCCCCTCACAGG - Intronic
1096414364 12:51400960-51400982 GGTTCCCTTGTCCCCCTCACAGG + Intronic
1097729856 12:63116287-63116309 GGTTTCTATGACCCCCTCCTTGG + Intergenic
1098377715 12:69835727-69835749 GGTTCCCTTGTCCCCCTCACAGG + Intronic
1098548029 12:71732330-71732352 GGTTCCTTTGTCCCCCTCACAGG - Intergenic
1098665751 12:73161048-73161070 TGCTCCCATCTCCTCCTCTTAGG + Intergenic
1098825197 12:75287792-75287814 GGTTCCCACCACCCCCTCCTTGG - Intronic
1099499196 12:83389865-83389887 GATTCCCTTGTCCCCCTCGCAGG - Intergenic
1100247955 12:92783107-92783129 GGTTTTCATGACACCCTCTTTGG - Intronic
1100308228 12:93370868-93370890 GGTTTCCATGACCCTCTCTTTGG + Intergenic
1100445637 12:94657154-94657176 GGTTCCCATGACCCCCTCTTTGG - Intergenic
1101772823 12:107767288-107767310 GATTTCCATGACCCCCTCTTTGG + Intergenic
1102163399 12:110787249-110787271 GGTTCCCATGACCTCCTTTTTGG + Intergenic
1102222213 12:111202229-111202251 GGACCCCTTGTGCCCCTCTTAGG - Intronic
1102840619 12:116116581-116116603 GGTTCCCACAGCCCCCTCCTTGG - Intronic
1103674195 12:122642891-122642913 GGTTCTCATGACCCCCTTTTTGG + Intergenic
1103752361 12:123173883-123173905 GGTTCCCACAGCCCTCTCTTTGG - Intronic
1103986292 12:124769692-124769714 GGTTCCCACGACCCTGTCTTTGG - Intergenic
1104083216 12:125450810-125450832 GGTGTCCATGTGCCCCTCATTGG - Intronic
1104448591 12:128852681-128852703 AGTCCCCATGTTCCCCTCCTCGG + Intergenic
1104682949 12:130763805-130763827 GGTTCCCACAACCCCCTCTTTGG - Intergenic
1104749034 12:131226946-131226968 CATTCCCAGGACCCCCTCTTGGG - Intergenic
1104756779 12:131274265-131274287 GGTGCCCGTGTCCGCCGCTTTGG - Intergenic
1104784089 12:131438618-131438640 CATTCCCAGGACCCCCTCTTGGG + Intergenic
1105614658 13:22000854-22000876 GGTTCTCTTGTCCCCCTCGCAGG - Intergenic
1105634986 13:22208157-22208179 GGTTCCCATGTGGCCCTGTGTGG + Intergenic
1105950339 13:25224245-25224267 GGTTCCTACGACCCCCTGTTTGG - Intergenic
1105972910 13:25447412-25447434 AGTTCCCTTGACCCCCTCGTGGG + Intronic
1106534137 13:30624011-30624033 GGTTCCCACTCCCCCTTCTTGGG - Intronic
1106613916 13:31309517-31309539 GGTTCCCACAGCCCCTTCTTTGG + Intronic
1106615160 13:31319838-31319860 TCTTCCAATGTCCCCCTCTCAGG + Intronic
1106800931 13:33255166-33255188 AGTTCCCTGGTCCCCCTCGTAGG - Intronic
1107298516 13:38940750-38940772 GGTTCCCATGACCCCATCTTTGG + Intergenic
1107360028 13:39607747-39607769 GGTTTGCATGACCCCTTCTTTGG - Intergenic
1107540657 13:41386061-41386083 GCTTCCCATGACTCCTTCTTTGG + Intergenic
1107555043 13:41510239-41510261 AGTTCCCATGACCGCCTCCTTGG + Intergenic
1108055792 13:46483711-46483733 AGTTCCCATGACCCTGTCTTTGG - Intergenic
1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG + Intergenic
1108869014 13:54959053-54959075 AGTTCCCATATCCCCCTCATAGG - Intergenic
1109102060 13:58198111-58198133 CCTTCCCATGTCCTCCTTTTTGG - Intergenic
1109138453 13:58682967-58682989 GGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1109459576 13:62638479-62638501 GGTTCCCATGAGCCCCTGTTTGG + Intergenic
1110817943 13:79882326-79882348 GGTTCCCTTGTCCTCCTCGCAGG + Intergenic
1111097699 13:83536014-83536036 GGTTCCCTTGTCCTCCTCGCAGG - Intergenic
1111292243 13:86185352-86185374 GATTCCCTTGTCCCCCTCGCAGG - Intergenic
1112059075 13:95719047-95719069 GATTCCCATGACCCCTTCCTTGG + Intronic
1112592453 13:100776177-100776199 GGTTCCCATGACCCCTTCTTTGG + Intergenic
1112608553 13:100932038-100932060 AGTTCCCAAGACCCGCTCTTTGG - Intergenic
1112616672 13:101013878-101013900 GGTCCCCATGACTGCCTCTTTGG + Intergenic
1113272072 13:108684996-108685018 GGTTCCCATGACCCTCTTCTTGG - Intronic
1113471563 13:110550372-110550394 GGTTCCCACGACCCCCTCTTTGG - Intronic
1113734540 13:112668972-112668994 GGTTCCGATGTCACTCTCCTGGG + Intronic
1114273830 14:21123186-21123208 GGTTCCCTTGACCCCATCTCCGG - Intergenic
1114544294 14:23487221-23487243 GGTTCAGATGTCCCATTCTTTGG + Intronic
1114772598 14:25445157-25445179 GGTTCCCATAACTCCCTCCTTGG - Intergenic
1115262706 14:31470033-31470055 GATTCCCATGACCCTGTCTTTGG - Intergenic
1115375032 14:32665326-32665348 GGTTCCCATGACCCCTTCTTTGG + Intronic
1116847766 14:49880696-49880718 GGCTCCCATGACTCCCTCCTGGG + Intergenic
1116882463 14:50185125-50185147 AGTTCCCATGACCCCCTCCTTGG - Intronic
1117353988 14:54906056-54906078 GGTTTCCACAACCCCCTCTTTGG - Intergenic
1118604186 14:67491110-67491132 GGTTCCCATGACCGCCTCCTTGG + Intronic
1118830419 14:69426298-69426320 GGTTCCCACAACCCCCTCTTTGG + Intronic
1119556137 14:75554408-75554430 GGTTCCCACGACCCTCTCTTTGG + Intergenic
1119844254 14:77816719-77816741 GGTTCCCACAACCCCTTCTTTGG - Intronic
1120506378 14:85357877-85357899 GGTTCCCATGACCCCCTTCTTGG + Intergenic
1120945177 14:89988013-89988035 GGTTCCCATGACCCTCTCTTTGG + Intronic
1121595860 14:95161758-95161780 GGTTGCCATGACCCCCTCTTGGG - Intergenic
1121706857 14:96002636-96002658 GATTCCCATGCCCCCCAGTTGGG + Intergenic
1122255171 14:100471157-100471179 GGTTTCCATGTCCCTCTCCCTGG + Intronic
1122321766 14:100859720-100859742 GGTACCCATGTACCATTCTTTGG - Intergenic
1122371084 14:101229403-101229425 GGTTCCCTTGTCCCTCTCGCAGG + Intergenic
1122554268 14:102568630-102568652 GGTTCCCACATCCCCCTCTTTGG + Intergenic
1124183747 15:27502681-27502703 GGTTCTCACAACCCCCTCTTTGG + Intronic
1124824939 15:33084353-33084375 GGTTCCTATGACCCCCTCTTCGG - Intronic
1124836326 15:33199098-33199120 GGTTCCCACGACTCCCTCTCTGG - Intergenic
1125125157 15:36211379-36211401 GGTTCCCATGACCCCATCTTGGG + Intergenic
1125393979 15:39226970-39226992 GGTTCCCACGACCCACTCCTTGG + Intergenic
1126228364 15:46296840-46296862 GGTTCCCTTGTCCCCCTTGCAGG - Intergenic
1126278938 15:46919330-46919352 GGTTCCCTTGTCCCCCTCACAGG - Intergenic
1126291190 15:47081429-47081451 GGTTCTCATGACCCCCTCTTTGG - Intergenic
1126312553 15:47334334-47334356 GGTTCCCATAAACCCCACTTTGG - Intronic
1126323277 15:47447711-47447733 GGTTCCCACTGCCCCCTCCTTGG - Intronic
1126587289 15:50301546-50301568 ATATCCCAAGTCCCCCTCTTAGG + Intronic
1126948458 15:53852016-53852038 GGTTCCCACAGCTCCCTCTTTGG - Intergenic
1127533242 15:59865401-59865423 GGTTCCCATGATCCCCTCTTTGG - Intergenic
1127807460 15:62534367-62534389 GGTTCCCATGACACCCTTTTCGG + Intronic
1128046000 15:64618248-64618270 AGTTCCCTTGTCCCCCTCACAGG + Intronic
1128136791 15:65269607-65269629 GGTTGCCATGTACCTTTCTTTGG + Intronic
1128619693 15:69138227-69138249 GGTTCCCATGACTCCCTCCTTGG - Intergenic
1128987926 15:72234777-72234799 GATTCCCATGATCCCCTTTTTGG - Intergenic
1129091189 15:73152597-73152619 GGTTCCCAGGACTCCCTCTCTGG - Intronic
1129091941 15:73160578-73160600 GGTTCCCATGATCCCCTTGTTGG + Intronic
1129451006 15:75651424-75651446 AGTTCTCATGACCCCCTCTGTGG + Intronic
1130074344 15:80675823-80675845 GATTCCCATGACCCCCTCCTTGG - Intergenic
1130264954 15:82392755-82392777 GGATCCCATGTCATCTTCTTTGG + Intergenic
1130303188 15:82695730-82695752 GGTTCCCATGCCACCCTCCTTGG - Intronic
1130430529 15:83842526-83842548 AGTTCCCTTATCCCCCTCTCAGG - Intronic
1131151822 15:90052051-90052073 GCTTCTCATCTCCCCCTCCTCGG + Intronic
1131353344 15:91721724-91721746 GGTTCCCAAAACCTCCTCTTTGG + Intergenic
1131691529 15:94832279-94832301 GGTTCCCTTGTCCTCCTCGCAGG - Intergenic
1132425234 15:101710370-101710392 AGTTCCCATGACCCCATCCTTGG - Intronic
1133354042 16:5123072-5123094 AGTTCCCTTGTCCCCCTCGAAGG + Intergenic
1133906072 16:10023823-10023845 GGTGCCCATGTCCACCTCCCTGG - Intronic
1134164656 16:11920403-11920425 GGTTCCCATGACCCCCTCCATGG + Intergenic
1134299174 16:12974345-12974367 GGTTTCCATGCCTCCTTCTTTGG - Intronic
1134337782 16:13317199-13317221 GTTGCCCATGTCCCACTCTCTGG - Intergenic
1134485036 16:14651233-14651255 GGTTCCCATGATTCCCTCTTTGG + Intronic
1134535934 16:15027218-15027240 GGTTCCCTTGTCCCCCTCGCAGG + Intronic
1134573010 16:15307856-15307878 GATTCCCCTGTCCCCAGCTTTGG - Intergenic
1134573225 16:15309509-15309531 GATTCCCCTGTCCCCGGCTTTGG + Intergenic
1134599530 16:15522690-15522712 AGTTCCCTTGTCCCCCTCGCAGG + Intronic
1134602019 16:15541088-15541110 GGTTCCCACGACCACCTCCTCGG + Intronic
1134729159 16:16446449-16446471 GATTCCCCTGTCCCCGGCTTTGG - Intergenic
1134729373 16:16448098-16448120 GATTCCCCTGTCCCCAGCTTTGG + Intergenic
1134804688 16:17114273-17114295 GGTTCCCACAACCCCCTCTTTGG - Intronic
1134872395 16:17663730-17663752 GATTCCCATGACCCCCTTTCAGG + Intergenic
1134938060 16:18263760-18263782 GATTCCCCTGTCCCCAGCTTTGG - Intergenic
1134938275 16:18265415-18265437 GATTCCCCTGTCCCCGGCTTTGG + Intergenic
1135069665 16:19340860-19340882 GGTTCCCATGATGCCTTCTTTGG - Intergenic
1135090742 16:19514156-19514178 GGTTCCCACCTCCTCCTCCTTGG + Intronic
1135238633 16:20782731-20782753 GGTTCCCATGACCCTTCCTTGGG + Intronic
1135412551 16:22246119-22246141 GGTTCCCATGAACCCCTCCTTGG + Intronic
1135737397 16:24943115-24943137 GGTTCCCATGGCCCCCTTTGGGG - Intronic
1135900981 16:26459626-26459648 GGCTCCTATGCCCCCCTCTTTGG + Intergenic
1135955996 16:26956649-26956671 GATTCCCATGAACCCCTCGTTGG + Intergenic
1135996474 16:27253188-27253210 GGTTCCCATAACTCCCTCTTTGG - Intronic
1136181740 16:28557544-28557566 GGTTTCCATGACTCCCTCCTTGG - Intronic
1136865769 16:33751935-33751957 GTTTCCCAGGACCCCCTCTTTGG + Intergenic
1137247406 16:46717062-46717084 GGTTCCCAAGACCCCCTCTTTGG - Intronic
1137281307 16:46979018-46979040 GGTTCCCATGAACCCTTCCTTGG - Intergenic
1137309837 16:47244262-47244284 GGTTCCCATGACCCCCTCCTCGG - Intronic
1137373645 16:47932326-47932348 AGTTCCCATGAACCCCTCTGTGG + Intergenic
1138367003 16:56488391-56488413 GGTTCCCATGACCCCCTCTGTGG + Intronic
1138546385 16:57722233-57722255 GGTTCCCATGACAGCCTCTCTGG - Intronic
1138808555 16:60121353-60121375 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1138956013 16:61971352-61971374 GATTCCCATGAGCCCCTCCTTGG + Intronic
1139178009 16:64713328-64713350 GGTTCCCACAACCCCCTCTTTGG + Intergenic
1139860121 16:70013569-70013591 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1140614727 16:76648734-76648756 GGTTCCCTTGTCCCCCTGGCAGG + Intergenic
1140835334 16:78788726-78788748 AGTTCCCATAACCCCCTCTTTGG - Intronic
1140916124 16:79494852-79494874 GGTTCCCAAGACTCCCTCCTTGG + Intergenic
1141459155 16:84167104-84167126 GGTTCCCATGACCCTCTCTTTGG + Intronic
1141751948 16:85964386-85964408 GATTCCCATGTCCTCGTCCTTGG + Intergenic
1203106385 16_KI270728v1_random:1364168-1364190 GTTTCCCAGGACCCCCTCTTTGG - Intergenic
1203127129 16_KI270728v1_random:1598200-1598222 GTTTCCCAGGACCCCCTCTTTGG + Intergenic
1143009630 17:3858814-3858836 GGTTCCCACAACCCTCTCTTTGG - Intergenic
1143290181 17:5822422-5822444 GGTTCCCCTGTCCCCGTCGCAGG + Intronic
1143292286 17:5840589-5840611 GGTTCCCTTGTCCCCCTCAGAGG + Intronic
1143398059 17:6618362-6618384 GGTTCCCTTGACCCCCTCCTGGG - Intronic
1143465460 17:7133581-7133603 GGTTCCCTTGTCCCCGTCGCAGG + Intergenic
1143793436 17:9316726-9316748 GGTTCCCAGGACCCCTTCCTTGG - Intronic
1143811364 17:9474345-9474367 GGTTCCCATGACCCCCCTTCAGG - Intronic
1144230528 17:13198778-13198800 GGTTCCCATGATCCCCTCTGTGG + Intergenic
1145257532 17:21335030-21335052 GGTTCCCATGGCCACATCCTTGG + Intergenic
1145319108 17:21753005-21753027 GGTTCCCATGGCCACATCCTTGG - Intergenic
1145373306 17:22324863-22324885 GGTTCCTACGACCCCCTCTTTGG - Intergenic
1145923210 17:28626888-28626910 GGTTCCCACAACCCCCTCCTTGG - Intronic
1146161832 17:30564175-30564197 GGGTCCCCTTTGCCCCTCTTTGG - Intergenic
1146401272 17:32501844-32501866 AGTTCCCAGGACCTCCTCTTTGG - Intronic
1146501524 17:33368869-33368891 GGTACCCATGTCCCTCTCCAGGG - Intronic
1147738372 17:42655372-42655394 GGTTCTCATGACCCCCTCTTTGG - Intergenic
1148132366 17:45269886-45269908 GGACCCCATGACCCCCTCCTTGG - Intronic
1149268230 17:54951124-54951146 GGTTCCCATGACTGCTTCTTTGG + Intronic
1149347660 17:55754291-55754313 GGATCCCATGACCCCCTCCTTGG + Intronic
1149604811 17:57917068-57917090 GGTTCCCATGTCCTCCCTATTGG - Intronic
1149882665 17:60308428-60308450 GGTTCCCTTGTCCCCCTCACAGG - Intronic
1150174181 17:63032941-63032963 GGTGCCCATGGCTCCCTCCTTGG + Intronic
1150637232 17:66922238-66922260 AGTTCCCAAGACCCCCTCTTGGG + Intergenic
1150883038 17:69052831-69052853 GGTTCCCATAACCCGCTCCTTGG + Intronic
1151247707 17:72807835-72807857 GGTTCCCACGACCCCCTCGTCGG - Intronic
1151777286 17:76214051-76214073 GGTTCCCATAACCCCCTCCTTGG - Intronic
1152335309 17:79697241-79697263 AGTTCCCTTGTCCCCCTCACAGG - Intergenic
1152776771 17:82206708-82206730 GGTTCCCACAGCCCCCTCTTTGG - Intronic
1152851241 17:82637606-82637628 GGTTCCCGTGACCCCTTCTTTGG + Intronic
1152852018 17:82642531-82642553 GGTTCCCACAGCCCCCTCCTTGG - Intronic
1153415167 18:4838359-4838381 GGTACCCGTGATCCCCTCTTTGG + Intergenic
1153673373 18:7434099-7434121 GGTTCACATTTCCCCCTTTTTGG + Intergenic
1153710558 18:7794429-7794451 GGTTCCCTTGTCCCCCTCCCAGG - Intronic
1153713117 18:7819851-7819873 AGATCCCTTGTCCCCCTCTTAGG - Intronic
1153775272 18:8447822-8447844 GGTTCCCATGACCCACTCTTTGG + Intergenic
1153888928 18:9494489-9494511 GGTTCCCATGACCCCTGCCTTGG - Intronic
1153960203 18:10133924-10133946 GGTTCCCTTGTCCTCCTCACAGG + Intergenic
1154468045 18:14668958-14668980 GGGTCTCATGGCCCCCTTTTTGG + Intergenic
1154476840 18:14768410-14768432 GATTCTCATGACTCCCTCTTTGG - Intronic
1155129037 18:22911839-22911861 GGATCCCAAGACCCCCTCCTTGG + Intronic
1155132445 18:22951739-22951761 GGTTCCCACAACCCCCTCCTCGG + Intronic
1155293684 18:24366083-24366105 GGTTCCCATGACTCCCTGTTTGG + Intronic
1155397889 18:25405779-25405801 GGTTTCCATGATCCCCTCCTTGG + Intergenic
1155719431 18:28992623-28992645 AGTTCCTATGTCACCCTCCTTGG + Intergenic
1155748382 18:29389639-29389661 GGTTCCCATGACTCCACCTTGGG - Intergenic
1155759499 18:29548300-29548322 GGTTCCCACATCCCCTACTTTGG - Intergenic
1155790983 18:29970957-29970979 GGTTCCCTTGTCTCCCTCGCAGG + Intergenic
1155971430 18:32087340-32087362 GGTTCCCATAGCCCACTCTTTGG - Intergenic
1156060091 18:33063557-33063579 GGTGCCCATGTGCACCTCTCAGG + Intronic
1156766433 18:40662595-40662617 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
1157478122 18:48036313-48036335 GATTCCCATGTCCTCCCCCTGGG + Intronic
1157534916 18:48451101-48451123 AGTTCCCTTGTTCCCCTCTCAGG + Intergenic
1157858852 18:51123637-51123659 GGTTCTCCTGTCCCCCTCGCAGG + Intergenic
1157966630 18:52216109-52216131 GGTTCCTATGATCCCCTCTTTGG + Intergenic
1158015162 18:52775158-52775180 GGTTCGCCTGTCCCCCTCGCAGG + Intronic
1158187927 18:54792301-54792323 GGTTCCCTTGTTCCCCTCAAAGG - Intronic
1158573536 18:58616819-58616841 GGTTCCCATGAGCACCTCTTGGG - Intronic
1158631035 18:59114126-59114148 GGTTCTCATGTCACACTCTATGG + Intergenic
1158798010 18:60871792-60871814 GTTTCCCATGACCCCCTCTTTGG - Intergenic
1158967315 18:62633927-62633949 GATTCTCAGGTCCCCATCTTGGG + Intergenic
1159017670 18:63114895-63114917 GGTCCCCAGAGCCCCCTCTTTGG - Intergenic
1159327979 18:66949124-66949146 GGTTCCCATGTCCCTGTCACAGG + Intergenic
1159721609 18:71898650-71898672 GGTTCCCTTGTCCCCTTCAAAGG + Intergenic
1160418584 18:78728661-78728683 GCTTCCCATGACCCTTTCTTTGG - Intergenic
1162011072 19:7815468-7815490 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
1162712433 19:12605575-12605597 GGTTTTCATGACCCACTCTTTGG - Intronic
1163612014 19:18306577-18306599 GGTCCCCATCACCCCCTCCTGGG - Exonic
1163617210 19:18336466-18336488 GGTTCCCTTGTTCCCCTCGCAGG - Intergenic
1163670774 19:18627161-18627183 GGTGCCCACCTCCTCCTCTTGGG + Intergenic
1164538129 19:29101894-29101916 GGTTCCCAAGACCTCCTCTTTGG - Intergenic
1164538140 19:29101948-29101970 GGTTTCCAAGGTCCCCTCTTTGG + Intergenic
1164717599 19:30404913-30404935 GGTTCCCATGACCCCCTCTTTGG + Intronic
1164847125 19:31441884-31441906 GGTCCCCACAACCCCCTCTTTGG - Intergenic
1164883079 19:31752346-31752368 GGCTCCCATGACTTCCTCTTTGG - Intergenic
1165294668 19:34916930-34916952 AGTTCCCACAGCCCCCTCTTTGG + Intergenic
1165551332 19:36588915-36588937 GGTTCTCACAACCCCCTCTTTGG - Intronic
1165570258 19:36769973-36769995 GATTCCTACGACCCCCTCTTTGG + Intronic
1165891742 19:39116688-39116710 GGTTTCCACGACCCCCTCTTGGG + Intergenic
1166128463 19:40731041-40731063 AGTTCCCATGTCCTCCTCTTTGG + Intronic
1166252422 19:41580506-41580528 GGTTTCCATGACTCCCTGTTTGG + Intronic
1166634575 19:44438952-44438974 GGTTCCCACAACCCACTCTTTGG - Intronic
1167029455 19:46947801-46947823 GGTTCCCATGACCCCCTCTTTGG + Intronic
1167810451 19:51825140-51825162 GGTTCCCACTACCCCCTCTTTGG + Exonic
1167850600 19:52198432-52198454 GGTTCCCACGACCCCCTCTTTGG + Intronic
1167851204 19:52203821-52203843 GATTCCCACGACCCCCTCTTTGG + Intronic
1167869624 19:52357118-52357140 GGTTCCCATGGCTCCCTCTTTGG + Intronic
1167969590 19:53179713-53179735 AGTTCCCATGAACCCTTCTTTGG - Intronic
1167972752 19:53198621-53198643 GGCTCCCATGACTCCCTCTTTGG + Intergenic
1168125966 19:54283069-54283091 GGATCCCATGCCCCACTCTTTGG - Intergenic
1168171309 19:54591719-54591741 GGATCCCATGACCACCTCTTTGG + Intronic
1168358632 19:55719136-55719158 GGTTCCCCTGACCCCTTCCTTGG + Intronic
1168540085 19:57202811-57202833 GGTTCCCGCGACCCCCTCTTTGG - Intronic
1168603788 19:57741728-57741750 GGATCACATCTCTCCCTCTTGGG - Intronic
1168607651 19:57772544-57772566 GGTTCCCATGACCCCTTCCTCGG + Intronic
925572277 2:5325210-5325232 AGCTCCTATGTCCCCCTCATAGG + Intergenic
925805988 2:7648708-7648730 AGCACCCATGTCCCCCTCTGTGG + Intergenic
925806705 2:7658200-7658222 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
925842811 2:8008245-8008267 GTCTCCCGTGACCCCCTCTTTGG - Intergenic
926007567 2:9384552-9384574 GGTTCCCACAGCCCCCTCTTTGG + Intronic
926139342 2:10359142-10359164 GGTTCCCTTTTCCCCCTCAAAGG - Intronic
926374091 2:12209551-12209573 GGTTCCCAGGACCCCCTCTTTGG - Intergenic
926762411 2:16290618-16290640 GGTTTCCACAACCCCCTCTTTGG + Intergenic
927213642 2:20653571-20653593 GGGTCCCACGTGCCCCTCTATGG + Intergenic
927567334 2:24124080-24124102 GATTCCCACGTCCCCCTCCAAGG - Intronic
927584085 2:24282744-24282766 GGTTCCCTTGTCCCCCTTGAAGG - Intronic
927666861 2:25038915-25038937 GGTTCCCGTGACTCCCTCTTCGG + Intergenic
928330793 2:30356476-30356498 GGTTCCCATGGCCCTCTCCTTGG + Intergenic
928429323 2:31204841-31204863 GATTCCCATGATCCCCTCCTTGG - Intronic
930297882 2:49578499-49578521 GGTTCCCTTGTCCCCTTTGTAGG + Intergenic
930398128 2:50848244-50848266 GATTCCCTTGTCCCCCTCGCAGG - Intronic
930763710 2:55062516-55062538 GATTCCCTTGTCCCCCTCTCAGG - Intronic
930816855 2:55607407-55607429 GCTTCCCATGACTCCCTCCTTGG + Intronic
931252957 2:60550124-60550146 ACTTGCCATATCCCCCTCTTCGG + Intronic
931435683 2:62244007-62244029 GGTTCCAGTGACCCCCTCTTTGG - Intergenic
931441101 2:62291142-62291164 GGTTCCCATGCCCCCCTCCTTGG - Intergenic
931470102 2:62531298-62531320 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
931562379 2:63576312-63576334 GGTTCCCATGAACCCCTTTTTGG + Intronic
932081429 2:68719215-68719237 GGCTCCCATGACCCTCTCCTTGG - Intronic
932632238 2:73354949-73354971 GGTTCCCATGACCCCCTCTTTGG + Intergenic
932723466 2:74157476-74157498 GGTTCCCACAACCCCCTCCTTGG - Intronic
933398892 2:81766019-81766041 AGTTCCCTTGTCCCCCTCACAGG - Intergenic
933553810 2:83807720-83807742 GGTTCCCATGACCCCCTCTTTGG + Intergenic
933593584 2:84260504-84260526 ACTTGCCATCTCCCCCTCTTCGG + Intergenic
933725843 2:85426777-85426799 GGTTCCCACAACCTCCTCTTTGG - Intronic
933987929 2:87608199-87608221 GGTTCCCATGACCCCCTCTTTGG - Intergenic
933997841 2:87682981-87683003 GGTTCCCAAGACCCCCTCTTTGG - Intergenic
934634289 2:95968805-95968827 GTTTCCCAGGACCCCCTCTTTGG + Intronic
934799342 2:97136434-97136456 GTTTCCCAGGACCCCCTCTTTGG - Intronic
934834099 2:97567035-97567057 GTTTCCCAGGACCCCCTCTTTGG + Intronic
935543599 2:104377913-104377935 AGTTCCCTTGTCCCCCTTGTAGG + Intergenic
935663932 2:105494141-105494163 GGTTCCCTTGTCCCTCTCTCAGG + Intergenic
935752178 2:106245361-106245383 GGTTCCCACAACACCCTCTTTGG - Intergenic
935882274 2:107576303-107576325 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
935912590 2:107912907-107912929 GGTTCCCACAACACCCTCTTTGG - Intergenic
936002807 2:108851052-108851074 GGTTCCTACAACCCCCTCTTTGG + Intronic
936296009 2:111267885-111267907 GGTTCCCAAGACCCCCTCTTTGG + Intergenic
936305911 2:111342609-111342631 GGTTCCCATGACCCCCTCTTTGG + Intergenic
936692806 2:114912877-114912899 CGTTCCCATGTCAAACTCTTTGG - Intronic
936955921 2:118022105-118022127 GGTTCCCATGATTCCCTCCTTGG + Intergenic
937115267 2:119400391-119400413 GGTTCCCATGACTACCTCCTCGG + Intergenic
937286870 2:120759422-120759444 GGTTCCCATGCCGCCTTCCTTGG + Intronic
937356144 2:121199340-121199362 GGTTCCCATGACCCCCTCTTTGG - Intergenic
937771757 2:125727766-125727788 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
938030297 2:127986376-127986398 AGTTCCCTTGTCCCCCTCGCAGG - Intronic
938231735 2:129667440-129667462 AGTTCCCTTGTGCCCATCTTTGG - Intergenic
938884177 2:135625982-135626004 GGTTCCCATGACCCCTGCTTTGG - Intronic
939061016 2:137421400-137421422 GGTTCCCACGACTCCCACTTTGG + Intronic
939649777 2:144746096-144746118 GGTTCCATTGTCCCCCTCACAGG - Intergenic
940360555 2:152791476-152791498 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
940844821 2:158629189-158629211 GGTTTCCATGGCCCCCTCCTTGG + Intronic
941543483 2:166816040-166816062 GGTTCCCACCTCCCTCTCCTTGG - Intergenic
941790453 2:169547085-169547107 GTTTCCCATGACCTCCTCTTTGG + Intronic
942224358 2:173802340-173802362 GGCTCCCATGATCCCCTCTTGGG + Intergenic
942429671 2:175897532-175897554 GGCTCCAATGAGCCCCTCTTTGG + Intergenic
942526777 2:176861526-176861548 AGTTCCCATGACCCCCTCCTTGG + Intergenic
942708037 2:178799401-178799423 GATTCCCTTGTCCCCCTCGCAGG - Intronic
943471921 2:188305096-188305118 AGTTCCCACGATCCCCTCTTTGG + Intronic
943676648 2:190722041-190722063 GGTTCCCACAACTCCCTCTTTGG - Intergenic
943886789 2:193228388-193228410 GATTCCCAAGCCCTCCTCTTTGG - Intergenic
944067040 2:195630233-195630255 GGTTCCCACAACCCCCTCTTAGG + Intronic
944551588 2:200849483-200849505 AGTTCCCATGACTTCCTCTTTGG + Intergenic
945219362 2:207468431-207468453 GGTTCCCGCGACCCCCTCCTTGG + Intergenic
945517648 2:210782889-210782911 GATTCCCATGACCCCATCTTTGG + Intergenic
945549157 2:211197672-211197694 GGTTGCCATGAACCCCTCTTTGG - Intergenic
945951390 2:216042037-216042059 GGTTCCCACGACCCCCTCTTTGG - Intronic
946808088 2:223492326-223492348 GTTTTCCATGTCCCAATCTTTGG - Intergenic
947537683 2:230951103-230951125 GGTTCCCACAACGCCCTCTTTGG - Intronic
948758513 2:240174074-240174096 GGTTCCCATGGCCCCATCCTAGG - Intergenic
1169261798 20:4144621-4144643 TGTTCCCATGATCCCTTCTTTGG - Intronic
1170270907 20:14526671-14526693 GGTTCCCTTGTCCCCCTCACAGG + Intronic
1170394800 20:15914848-15914870 GGTTCCCATGACTCTTTCTTGGG + Intronic
1170724539 20:18914653-18914675 GGTTCCCATGACCCCATCTTTGG - Intergenic
1170738122 20:19028105-19028127 GGTTCCCATGTGACCCTCCCAGG + Intergenic
1170872599 20:20220435-20220457 GGTTCCCATGACCCCTGCTTAGG - Intronic
1171384147 20:24756393-24756415 GGTTCCCTTGTCCCCCTCACAGG + Intergenic
1171404006 20:24897623-24897645 GGTTCCCATGACCCCTTGCTTGG + Intergenic
1171480231 20:25449702-25449724 AGTTCCCATGCCCCACTCTTTGG + Intronic
1171529488 20:25843461-25843483 GGTTCCTATGACCTCCTCTTTGG + Intronic
1171538149 20:25917164-25917186 GGTTCTCATGACCCCCTCTTTGG + Intergenic
1171547338 20:26012419-26012441 GGTTCCTATGACCTCCTCTTTGG - Intergenic
1171802991 20:29644277-29644299 GGTTCTCATGACCCCCTCTTTGG - Intergenic
1171841090 20:30212465-30212487 GGTTCTCATGACCCCCTCTTTGG + Intergenic
1172797031 20:37547334-37547356 GCTTCCCACGACCCTCTCTTTGG + Intergenic
1173348498 20:42222830-42222852 GGTTCCCACAACCCCTTCTTTGG - Intronic
1173421682 20:42906732-42906754 AGTTCCCCTGTCCCCCTCACAGG - Intronic
1173659738 20:44724952-44724974 GGGTCCCCAGTCCCCCTCCTTGG - Exonic
1173894329 20:46538852-46538874 GGTTCCCATGACTCCCTCCTCGG - Intergenic
1174126603 20:48311217-48311239 GGTTCCCTTGTCCCCCTCACAGG + Intergenic
1174363142 20:50040882-50040904 GGCTCCCATGTGCTCCTCCTGGG + Intergenic
1175059588 20:56229802-56229824 GCTTCACATGTCCCTCTCTGCGG - Intergenic
1176580947 21:8524902-8524924 GCTTCTCAGGACCCCCTCTTTGG - Intergenic
1176668675 21:9711754-9711776 GGTTCCCATGACTCCCTCTTTGG + Intergenic
1176993384 21:15524214-15524236 GGTTCCCTTGTCCCCCTTGCAGG - Intergenic
1177264548 21:18765472-18765494 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1177601233 21:23317886-23317908 TGTTCCCTTGTCCCCCTCGTAGG + Intergenic
1177644874 21:23887818-23887840 GGTTCCCTTGTCCCCCTTGTAGG - Intergenic
1178071079 21:28967703-28967725 GGATCCCATGACCCCCTCCTGGG - Intronic
1178237275 21:30857511-30857533 GGTTCCCATGATTCCCTCCTTGG + Intergenic
1178421143 21:32444370-32444392 GGTTCCCATGACCCCCTCCTTGG + Intronic
1178438746 21:32581650-32581672 AGTTCCCTTGTCCCCCTCGCAGG - Intronic
1179182340 21:39056588-39056610 TCCACCCATGTCCCCCTCTTTGG + Intergenic
1179918121 21:44491077-44491099 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1180080538 21:45485765-45485787 GCTTCCCATGTCCCCCACAGGGG - Intronic
1180202450 21:46232995-46233017 GGTTCCCAAGACCCCTTCCTTGG + Intergenic
1180930316 22:19586212-19586234 AGTTCCCGTGTCCCCCTCGCAGG + Intergenic
1181378597 22:22480906-22480928 GGTTCTCACAACCCCCTCTTTGG - Intergenic
1181451598 22:23026425-23026447 GGTTCCCTTGTCCCCCTCTCAGG + Intergenic
1181696928 22:24597982-24598004 GGGTTCCAAGGCCCCCTCTTTGG + Intronic
1183006293 22:34905450-34905472 GGTTCCCACGACTCCCTCTTTGG - Intergenic
1183626367 22:39005092-39005114 GGTTCCCATGACCCATTCTTTGG - Intergenic
1184133169 22:42529984-42530006 GGTTCCCACAGCCCTCTCTTTGG - Intergenic
1184366291 22:44053718-44053740 GGTTCCCACAGCCCCATCTTTGG + Intronic
1184412693 22:44333928-44333950 GTTTCCTCCGTCCCCCTCTTGGG - Intergenic
1184569413 22:45312357-45312379 GGTTCCCATGACCCTTCCTTAGG + Intronic
1184916956 22:47575877-47575899 GGCTCCCATGCCCCCTTCTTGGG + Intergenic
1185235214 22:49708491-49708513 GGTTCCCAAATCCCCTCCTTGGG + Intergenic
949210359 3:1491699-1491721 GGTTCCCATTACCTCCTCCTCGG + Intergenic
949279546 3:2330094-2330116 GATTCCCATGACCGCCTCCTTGG + Intronic
949487294 3:4552371-4552393 GATTCCTATGACCACCTCTTTGG + Intronic
949806196 3:7958723-7958745 GGTTCCCTTGTCCCCCTCTCAGG + Intergenic
949808099 3:7977122-7977144 GGTTCCCTTATCCCCCTCACAGG - Intergenic
949966210 3:9358711-9358733 GGTTTCCATGACCCCCTCTTTGG + Intronic
950319266 3:12035188-12035210 TGATTCCATGTCCCCATCTTCGG + Intronic
950828493 3:15850818-15850840 AGTTCCCATGACCCCCTCCTTGG - Intronic
950880200 3:16317086-16317108 GTTTCCCATGTCTCCAGCTTTGG + Exonic
950930567 3:16784871-16784893 GATTCCCATGACCCTCTCTCTGG + Intergenic
952298719 3:32085279-32085301 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
952580317 3:34824929-34824951 AGTTCCCTTGTCCCCCTCACAGG - Intergenic
953282091 3:41568930-41568952 GTTTCCCATGACTGCCTCTTTGG + Intronic
953441915 3:42925549-42925571 GGTTCACATGACCCCCTTCTTGG + Intronic
953797591 3:45997313-45997335 AGTTCCCACGACACCCTCTTTGG + Intergenic
953797941 3:45999943-45999965 GGTTCCCAAGACCTCCTCTTTGG + Intergenic
954074835 3:48170368-48170390 GGTTCCCATGACCCCTTCTTTGG + Intronic
954565819 3:51598971-51598993 GGTTCCCATGAAGCCCTCTTTGG - Intronic
954736514 3:52712285-52712307 AGTTCCCTTGTCCCCCTCGCAGG + Intronic
954754153 3:52829941-52829963 GGTGCCCGTGTGCCCCTCCTCGG - Intronic
954812917 3:53258968-53258990 GGTTCCCACCACTCCCTCTTTGG - Intergenic
954922400 3:54203239-54203261 GGTCCCCTTGTCCCCCTCGCAGG + Intronic
955958614 3:64316469-64316491 GGTTCTCACGACCCCCTCTTTGG - Intronic
956056140 3:65300921-65300943 GGTTCCCATGCTTCCCTCTTTGG + Intergenic
956511752 3:70000325-70000347 GGTTCCCTTGTCCTCCTCTCAGG - Intergenic
957050249 3:75406167-75406189 GGATCCCATAACCCCCTCCTTGG - Intergenic
957057944 3:75458759-75458781 AGTTCCCTTGTCCCCCTCGAAGG + Intergenic
957550420 3:81697138-81697160 GATTCCCATGGTCCCCTCTTTGG + Intronic
957991117 3:87628233-87628255 GGCTCCCTTGTCCCCCTCGCAGG - Intergenic
958942428 3:100331153-100331175 GGTTGCCATGATCCCATCTTTGG - Intergenic
959369321 3:105504124-105504146 AGTTCCCTTGTCCCCCTCACAGG + Intronic
959578454 3:107960497-107960519 GGTGCCTATGTCCCCCTCCCAGG + Intergenic
960024943 3:112998313-112998335 GGTTCCAACTACCCCCTCTTTGG + Intronic
960062753 3:113340535-113340557 GGTTCCCTTGTCCCCCTCGCAGG + Intronic
960456420 3:117878365-117878387 GGTTCCCATGACCTCCTCCTCGG - Intergenic
960878006 3:122315849-122315871 AGTTCCCTTGTCCCCCTCACAGG - Intergenic
961065566 3:123872535-123872557 GATTCCCATGACCCCCTTCTTGG + Intronic
961295508 3:125880956-125880978 AGTTCCCTTGTCCCCCTCGAAGG - Intergenic
961422122 3:126814783-126814805 AGCTCCCATGACCCTCTCTTGGG - Intronic
961431037 3:126883262-126883284 GGTTCCCACAGCCTCCTCTTGGG - Intronic
961882560 3:130072605-130072627 GCTTCCCATAACCCCCTCCTTGG - Intergenic
962058904 3:131904462-131904484 GGTTCCCACGTGGCTCTCTTGGG + Intronic
962129874 3:132660769-132660791 GCTTCCCACGTCCCGCTCATGGG + Intronic
962139444 3:132772929-132772951 GGTTCCCAGGTCATCCTCTCTGG - Intergenic
962199260 3:133388277-133388299 GGGTCCCCTGTCCCCTTCTCTGG - Intronic
962326703 3:134440501-134440523 GGTTCCCACTACCCCCTCTTTGG + Intergenic
963538325 3:146556082-146556104 GGTTCTCATGACCCACTCCTAGG + Intergenic
963994018 3:151685520-151685542 GGTTTCCATGACTCCCTCTTTGG - Intergenic
964659734 3:159106805-159106827 GGTTCCCGTGACCCCTTCTTTGG + Intronic
964741919 3:159975310-159975332 GGTTCCCTTCACCCCCTCCTTGG - Intergenic
965185202 3:165454512-165454534 AGTTCCCTTATCCCCCTCCTAGG + Intergenic
965433093 3:168612958-168612980 GGTTCCCTTGTCCCCCTGGCAGG - Intergenic
966344641 3:178964991-178965013 GGTTCCCATGACCCCCTCTCAGG - Intergenic
966365740 3:179185664-179185686 CGTTCCCATGACCCCCTCCTTGG + Intronic
966966623 3:185001338-185001360 GGTCCCCATGACCCCCTCTGAGG + Intronic
968744189 4:2351028-2351050 GGCTCCCATGACCCCCTTCTGGG - Intronic
968744325 4:2351807-2351829 GGCTCCCATGGCCCCCTTCTGGG + Intronic
968846494 4:3045185-3045207 GGTTCCCACAGCCCCCTCCTTGG - Intergenic
968940656 4:3635801-3635823 GGTTCCCACGACCCCCGCCTTGG + Intergenic
969199507 4:5591445-5591467 GGTCTCCATCTTCCCCTCTTGGG + Intronic
970628897 4:17920126-17920148 GGGTTCCATGACCCCCTCTTTGG - Intronic
970697497 4:18695843-18695865 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
971023650 4:22566045-22566067 GGGTCCTATGAACCCCTCTTTGG - Intergenic
972766949 4:42159954-42159976 GGTTCCTATGACCCCCTCTTTGG + Intergenic
973233068 4:47864898-47864920 GGTTCACACAGCCCCCTCTTTGG - Intronic
973267008 4:48220996-48221018 GGTTCCCACAACCCCCTCCTTGG + Intronic
974015989 4:56649790-56649812 GGTTCTCCTGTTCTCCTCTTTGG - Intronic
974499765 4:62684505-62684527 GGTTCCCATGTACCCCAACTGGG + Intergenic
974934215 4:68394243-68394265 AGTTCCCATGACCCCTTTTTTGG - Intergenic
975143262 4:70939622-70939644 GGTTCCCTTGTCCCCCTTAAAGG + Intronic
975641249 4:76502349-76502371 GATTCCCATGACCTCCACTTTGG - Intronic
976266951 4:83193776-83193798 GGTTCCCATAACTCCCTCTTGGG - Intergenic
976282746 4:83341337-83341359 GGCTTCCATGGCCCCCTTTTTGG + Intergenic
976657803 4:87507827-87507849 GGCTTCCATGACTCCCTCTTGGG + Intronic
976737849 4:88328683-88328705 CATTCCCATGACCCCCTCTTTGG + Intergenic
976751495 4:88454936-88454958 GGTTCCCTTGTCCCCTTCGTAGG - Intergenic
976902573 4:90197079-90197101 GGTTCCCACGACCCCCTCCTTGG + Intronic
977289019 4:95143355-95143377 GGCTCCCATCACCCCCTCCTTGG + Intronic
977400504 4:96525396-96525418 GGTTCCCATGACCCCTGCTCAGG + Intergenic
977401754 4:96541420-96541442 GGTTTCCATGACCCCCTCCTTGG - Intergenic
977715985 4:100184564-100184586 GGTTCCCATGACTCCCTCCTGGG + Intergenic
977757007 4:100683150-100683172 GTTTCCCTTGTCCCCCTCGCAGG - Intronic
977920519 4:102637839-102637861 GGTTCCCATGACCCCTTCTTTGG - Intronic
978132461 4:105214911-105214933 GGTTCCCACAACACCCTCTTTGG - Intronic
978327477 4:107575526-107575548 AGTTCCCTTGTCCCCCTCACAGG - Intergenic
978723368 4:111941235-111941257 GGTTCTCATGACCCCCTTCTTGG - Intergenic
979657185 4:123209142-123209164 GGTTCCCATGACCCCTGCTTGGG - Intronic
980100626 4:128538525-128538547 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
980312691 4:131154201-131154223 GGTTCCCAAGGCCACCTGTTTGG + Intergenic
980864222 4:138535762-138535784 GGTTCCCATGACCCCCTATTTGG + Intergenic
980864334 4:138536689-138536711 GGTTCCCATGATCCCCTCTTTGG + Intergenic
981188010 4:141827961-141827983 GATTCCCATGATCCCCTCCTTGG - Intergenic
981317141 4:143350931-143350953 GGTTCCCTTGTCCCCCTCGCAGG + Intronic
981643533 4:146972756-146972778 GGTTCCCATGGCCCCACCTCAGG + Intergenic
981906111 4:149923735-149923757 GGTTCCCTTGTCCCCCTCGCAGG + Intergenic
982504501 4:156199274-156199296 GGTTCCCTTGTCCCCCTCACAGG - Intergenic
982985396 4:162200448-162200470 GGTTCCTACAACCCCCTCTTTGG + Intergenic
983382625 4:167017122-167017144 GGTTCCCATTTCCCTTTCCTTGG + Intronic
983626135 4:169803719-169803741 AGTTCCCATGACCCCTTCTTTGG - Intergenic
983867792 4:172789226-172789248 AGTTCCCATGACCCCCTCTTGGG + Intronic
983998469 4:174213832-174213854 GGTTCCCGTGGCCCTCTCCTTGG + Intergenic
984232490 4:177115607-177115629 GGTTCCCATGATCCCCTCCTTGG - Intergenic
984263536 4:177470417-177470439 GGTTCCCTTGTCTCCCTCGCAGG + Intergenic
984272010 4:177558405-177558427 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
985248193 4:187997145-187997167 GGCTCCGATGGCCCCCTCCTTGG + Intronic
985395221 4:189536801-189536823 GGTTCCCAAGATCCCCTCTTTGG + Intergenic
985406108 4:189639772-189639794 GGTTCCCATGACTCCCTCTTTGG - Intergenic
986147166 5:5089164-5089186 AGTTCCTATGACCCCCTCCTTGG - Intergenic
986265557 5:6187194-6187216 GGTCTCCATGACCCCCTCCTTGG - Intergenic
986344633 5:6823098-6823120 GGTTCCCAGGTCCCCCACTCTGG - Intergenic
986364703 5:7018946-7018968 AGTTCCCTTATCCCCCTCTCAGG + Intergenic
986484082 5:8217656-8217678 GGTTCCCTTATCCCCCTCACAGG - Intergenic
986974506 5:13379689-13379711 AGTCCCCATGACCCCTTCTTTGG - Intergenic
987203083 5:15596992-15597014 GGTTTCCATGACCTCCTCCTTGG - Intronic
987794519 5:22608963-22608985 GGTTCCCTTGTTCCCTGCTTTGG - Intronic
988099026 5:26655154-26655176 GGTTCCCATCATCCCCTCTTTGG + Intergenic
989186626 5:38632356-38632378 GGTTCCCACAAACCCCTCTTTGG - Intergenic
989286232 5:39703164-39703186 GCTTCCCATATCTCCCTCTAAGG - Intergenic
990199478 5:53355010-53355032 TGTTCTCATGTCCTCCTCTGTGG - Intergenic
990273331 5:54169701-54169723 TGTGCCCATCTCCCCATCTTGGG - Intronic
990305993 5:54494367-54494389 GGTTCCCACAACCCCCTCTTTGG - Intergenic
990429965 5:55725126-55725148 GGTTCCCATGACCCCCTCTCTGG + Intronic
990561550 5:56988492-56988514 GGTCCCCATGCCTCCCTCTTTGG + Intergenic
990866689 5:60387948-60387970 GGTTTCCATGACCCCTTCTTTGG + Intronic
992038245 5:72802827-72802849 AGTTCCGTTGTCCCCCTCTCAGG - Intergenic
992599967 5:78389980-78390002 GGTTTCCATGACCCTCTCCTTGG - Intronic
992670432 5:79055055-79055077 GCTTCCCCTGGCCCCATCTTCGG - Intronic
993302138 5:86224264-86224286 AGTTCCCTTATCCCCCTCTCAGG - Intergenic
993391226 5:87321495-87321517 GGTTTCCACAACCCCCTCTTTGG + Intronic
993810525 5:92470577-92470599 GGTTCTCATGACCTCCTCTTTGG + Intergenic
993857793 5:93097450-93097472 GGTTTTCATGACCCCCTCTTTGG + Intergenic
993889400 5:93455028-93455050 GGTTCTCATGACCCCATCCTTGG - Intergenic
994301849 5:98157110-98157132 GGTTCCCTTGTCCCCCTAGCAGG + Intergenic
994439573 5:99785196-99785218 GGTTTCCATGACCCCCTCTTTGG + Intergenic
994913420 5:105943202-105943224 GGTTCCCTTGACCCCTTCTCGGG + Intergenic
995130432 5:108624324-108624346 GCTTCCCACGACCCTCTCTTTGG - Intergenic
995392111 5:111651134-111651156 GGTTCCCATGATCCCTTCCTTGG + Intergenic
995450238 5:112291899-112291921 AGTTCCCATGACCTTCTCTTTGG - Intronic
995493998 5:112722616-112722638 GTTTCCCACTACCCCCTCTTTGG + Intronic
996576801 5:124984357-124984379 AGTTCCCTTGACCCCCTCATGGG - Intergenic
997005765 5:129814658-129814680 GGTTCCTATGACCCCCTCTTTGG + Intergenic
997016530 5:129941873-129941895 GGTCCCCACAACCCCCTCTTTGG + Intronic
997428959 5:133824283-133824305 GGTTCCCACAGCCCCCTCCTTGG + Intergenic
998300522 5:141014682-141014704 GGTTGCTATGTACCACTCTTAGG - Intergenic
998798160 5:145840618-145840640 GCTTCCCATGATCCTCTCTTTGG - Intergenic
999217469 5:149947240-149947262 GGTTCCCATGACACCCTCTTTGG - Intergenic
999392753 5:151206105-151206127 GGTTTCCTTGACCTCCTCTTTGG + Intronic
999990754 5:157047780-157047802 GGTTCCCACAACCCTCTCTTTGG - Intronic
1000326297 5:160175314-160175336 TTCTCCCATGTCCACCTCTTGGG - Intergenic
1001217208 5:169867027-169867049 GGTTCCCAAAACCCCTTCTTTGG + Intronic
1001330709 5:170760488-170760510 GGTTCCCATCTGCCCTTCCTTGG + Intergenic
1001739070 5:174035051-174035073 GGTTCCCATGCCCCCCAACTGGG - Intergenic
1001755246 5:174163627-174163649 GGTTCCCACAACCCCCTCTTTGG + Intronic
1001985366 5:176070041-176070063 GGTTCCCAGGACTCCCTCTTTGG - Intronic
1002003472 5:176213044-176213066 GTTCCCCCTGCCCCCCTCTTAGG - Intergenic
1002231504 5:177768078-177768100 GGTTCCCAGGACTCCCTCTTTGG + Intronic
1002263837 5:178015670-178015692 GGTTCCCAGGACTCCCTCTTTGG - Intronic
1002288219 5:178179858-178179880 GGTTCCCATGACCCCTCCTCAGG + Intergenic
1002476929 5:179472318-179472340 GGTTCCCTTGTCCTCCTCACAGG + Intergenic
1002626431 5:180532765-180532787 GGTTCCCACGACCCCCTCTTTGG + Intronic
1002837769 6:879754-879776 GGTTCCCATGACCCCCTGTTTGG - Intergenic
1002842835 6:921164-921186 GGTTCCCTTGTTCCCCTCACAGG - Intergenic
1002843412 6:924912-924934 GGTTCCCTTGTTCCCCTCGCAGG - Intergenic
1004278209 6:14256780-14256802 CGTTCTCATAGCCCCCTCTTAGG + Intergenic
1004294152 6:14394927-14394949 GGTTCCCATGACCCCCTTTTTGG - Intergenic
1004394432 6:15235640-15235662 GGTTCCCATGACGCTCTCTTGGG + Intergenic
1004417193 6:15435938-15435960 GGTTTTCTTGTCCCCCTCTCAGG + Intronic
1004687165 6:17957521-17957543 GGTTTCCAGGACCCCTTCTTTGG - Intronic
1004953555 6:20702136-20702158 GGTTCCCTTGTCCCCCTCGCAGG + Intronic
1005794692 6:29347597-29347619 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1005976606 6:30804903-30804925 GATTCCCACAACCCCCTCTTTGG + Intergenic
1006267809 6:32939826-32939848 GGTTCCCATGACCCCCTCCTTGG - Intronic
1006483599 6:34319364-34319386 GATTTCCATGACCCCCTATTTGG + Intronic
1006723808 6:36181161-36181183 GATTCCCATGACTCCCTCCTTGG + Intergenic
1006962657 6:37949610-37949632 GATTCCCACAACCCCCTCTTTGG + Intronic
1007937975 6:45750715-45750737 GGACCCCATGACCCCCTTTTGGG - Intergenic
1008586822 6:52958252-52958274 GATTCCCACAACCCCCTCTTTGG + Intergenic
1008952490 6:57175876-57175898 GGTTCCCATGTCCCCCTCTTTGG - Intronic
1009594455 6:65716586-65716608 GGTTCCCACAACCCTCTCTTTGG + Intergenic
1010995219 6:82524287-82524309 GGTTCCCTTGTCCCCCTCACAGG - Intergenic
1011259472 6:85456360-85456382 GGTTCCCATGACCCTATCCTTGG - Intronic
1011326247 6:86152176-86152198 GGTTCCTTTGTCCCCCTCCCAGG + Intergenic
1011571301 6:88738741-88738763 AGTTCCCATATACACCTCTTGGG - Intronic
1013438840 6:110140429-110140451 GGTTCCTATGACTCCCCCTTTGG - Intronic
1013971983 6:116030807-116030829 GCTTCCCATGACCCACTCTTGGG - Intronic
1014422361 6:121261297-121261319 GGTTCCCATGCCCCCCAACTGGG + Intronic
1014718044 6:124888162-124888184 GATTCCCTTGTCCCCCTCGCAGG - Intergenic
1015433468 6:133157537-133157559 GGTTCTCATGTACCAGTCTTTGG - Intergenic
1015593395 6:134843576-134843598 GGTTCCCACAACCCCCTCTTTGG - Intergenic
1015828116 6:137337431-137337453 GTTTCCTTTGTCCCACTCTTTGG + Intergenic
1016825612 6:148385942-148385964 GGTTCCCACGACCCCCTTTTGGG - Intronic
1016951765 6:149587454-149587476 GGTTGCCATGACTTCCTCTTTGG + Intronic
1017033090 6:150241434-150241456 GGTTCTCATGACCCTCTCTGAGG - Intronic
1017645876 6:156539433-156539455 GCTTCCCATGAACCCCTCCTCGG - Intergenic
1018195589 6:161353703-161353725 GATTCCCATGACTCCCTCTTTGG - Intronic
1018265735 6:162023049-162023071 GGTTCCCTTGTCCCCCTAGCAGG + Intronic
1018772746 6:166986323-166986345 GGTTCCCATGACCCCCTCTTTGG + Intergenic
1018794354 6:167174494-167174516 AGTTCCCTTGTCCCCCTCCCAGG + Intronic
1018821965 6:167380573-167380595 AGTTCCCTTGTCCCCCTCCCAGG - Intronic
1018942535 6:168319217-168319239 GGCCTCCATGTCCCCCTCCTTGG + Intronic
1019221322 6:170475107-170475129 GCTTCCCATGGCTCCCTCTTTGG - Intergenic
1019403159 7:867933-867955 GGTTCCCTGGTACCCCTCTTGGG - Intronic
1019468194 7:1202024-1202046 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1019664093 7:2242651-2242673 GGTTCCCTTGTCCTCCTCGAAGG + Intronic
1019870566 7:3757205-3757227 GGTTCCCAAAACCCCCTCCTTGG + Intronic
1020407337 7:7852499-7852521 GGTTCCCACAACCCTCTCTTTGG + Intronic
1020825101 7:13016907-13016929 GGTTCCCTTGTCCCCCTTGGAGG - Intergenic
1021097688 7:16551835-16551857 GGTCCCCATTACCCCCTCCTTGG - Intronic
1021115194 7:16739290-16739312 GTTTCCCATGACCCCCTCTTTGG - Intergenic
1021293017 7:18869089-18869111 GGTTCCCATGCCCCCCTCTTTGG - Intronic
1021505873 7:21384680-21384702 GGCTCCCAGGACCCCCTCCTCGG + Intergenic
1021737347 7:23653092-23653114 GGTTCCCATGACCGTCTTTTTGG + Intergenic
1022011095 7:26308710-26308732 GGATCCCATGACCTCCTCCTTGG - Intronic
1022048576 7:26643517-26643539 GGATCCCATGATCCCCTCCTTGG - Intronic
1022473084 7:30693616-30693638 AGTTCCCATGACCCTCTCTTTGG - Intronic
1022568185 7:31424556-31424578 GGATCCCATAACCCCCTGTTTGG + Intergenic
1022987694 7:35674998-35675020 GGTTCCCGTGACCCCCTCCTGGG - Intronic
1023373366 7:39533287-39533309 GGTGCCCATTTCTCCCTTTTTGG - Intergenic
1023392208 7:39721259-39721281 GGTTCCCACAACCTCCTCTTTGG + Intergenic
1023405220 7:39826670-39826692 GGTTCCCATGACCTCTCCTTGGG - Intergenic
1023708965 7:42971469-42971491 AGTTTCCATGACCCCATCTTGGG + Intergenic
1024013140 7:45287706-45287728 GGTTCCCATGGCCCACTCCTTGG + Intergenic
1024136167 7:46411569-46411591 GATTCCCATGACTCCCTCTTTGG + Intergenic
1024267742 7:47619670-47619692 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1024331786 7:48162264-48162286 GGTTCCCATGACCCTCTCTTTGG + Intergenic
1024536287 7:50437264-50437286 AGTTCCCATGACCCCTTCTTTGG + Intergenic
1024844999 7:53633073-53633095 GGTTCCCTTGTCCCCTTCCAGGG + Intergenic
1024925145 7:54604708-54604730 GATTCCCATAACCTCCTCTTTGG - Intergenic
1025289604 7:57703990-57704012 GGTTCTCATGACCCCCTCTTTGG + Intergenic
1025911117 7:65829591-65829613 GGTTCCCATGACCCTCTTCTTGG + Intergenic
1025978589 7:66389257-66389279 GGTTCCCATGACCCCCTCTTGGG - Intronic
1026095833 7:67345941-67345963 GGTTCCCACAACTCCCTCTTTGG + Intergenic
1026861367 7:73792142-73792164 GGTTCCCATGACCCCCTCCTTGG + Intergenic
1027204182 7:76083961-76083983 GGTTCCCATGACCCCCTTCTTGG - Intergenic
1027632155 7:80620357-80620379 GGTTCTCATTACCCCCTCTTTGG + Intronic
1027785862 7:82577802-82577824 GGTTCCCATGATCCCCTCCTTGG - Intergenic
1027932336 7:84553149-84553171 GGTTCCCTTATCCCCCTCGCAGG - Intergenic
1028192422 7:87868543-87868565 GGTTCCCACAACTCCCTCTTTGG + Intronic
1028724358 7:94070788-94070810 GGTTCCCTTGTCCCCCTCACAGG + Intergenic
1029028936 7:97448589-97448611 GGTTCCTATCACCCCCTCCTTGG + Intergenic
1029036651 7:97529395-97529417 GATTCCCATGACCCCCACTTTGG + Intergenic
1029038716 7:97550116-97550138 GGTTCCTTTGTCCCCCTCGCAGG - Intergenic
1029404840 7:100368492-100368514 GGTTCCCATGATCCCCTCCTTGG + Intronic
1029458617 7:100683230-100683252 CCTCACCATGTCCCCCTCTTAGG - Exonic
1029542085 7:101189602-101189624 GGGTCCCATGACCCCCTGTTGGG + Intergenic
1030586889 7:111432017-111432039 AGTTCCCATGACCCCCTCTTTGG - Intronic
1031179266 7:118394133-118394155 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1031479166 7:122257525-122257547 GGTTCCTATGCCACCCACTTTGG - Intergenic
1032545055 7:132734738-132734760 GGTTCCCTTGTCCCCCTCGAAGG - Intergenic
1032790828 7:135241328-135241350 GGTTCCCTTCACCTCCTCTTTGG + Intronic
1033063965 7:138135021-138135043 GGTTCTCAAGACCCCCTCCTTGG - Intergenic
1033079350 7:138280247-138280269 GGTTCACATGATCCCCTCCTTGG - Intergenic
1033082980 7:138315183-138315205 GATTCCCATGCTCCCCTCCTGGG + Intergenic
1033408774 7:141096755-141096777 GGTTCCCATGATCCCCTTTTGGG - Intronic
1034099210 7:148436941-148436963 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
1034561130 7:151879885-151879907 GGTTCCCACAACCCCCTCTCAGG - Intergenic
1034938142 7:155212824-155212846 GGCTCCCCTGGCCCCCACTTTGG - Intergenic
1036116505 8:5965952-5965974 GATTCTCATGACCCCTTCTTTGG - Intergenic
1036533998 8:9627342-9627364 GGTTCCCATGACCTCCTCTTTGG - Intronic
1037006475 8:13787285-13787307 GATTCTCATTTCCTCCTCTTTGG - Intergenic
1037058107 8:14469985-14470007 GGTTCCCATCAACCCATCTTTGG - Intronic
1037110488 8:15159386-15159408 AGTTCCCATGACCCACTCTTTGG - Intronic
1037456060 8:19065519-19065541 GGTTCCCATGATCCCCTCCTTGG + Intronic
1037558849 8:20054411-20054433 GGTTCCCATGATCCCCTCCTTGG + Intergenic
1037722779 8:21459079-21459101 GGTCCCCATGACCTCCTTTTTGG - Intergenic
1038405655 8:27320512-27320534 GGTTCCCATGACCCCTCCTTAGG + Intronic
1038427324 8:27472246-27472268 GGTTCCCATGACCCCCTCCCTGG - Intronic
1038473343 8:27843847-27843869 GCTTCCCATGAACCCCTCTTTGG + Intergenic
1038625666 8:29190618-29190640 GGTTCCCACAACCTCCTCTTTGG - Intronic
1038850177 8:31268147-31268169 GGTTCCCATCACCCCTTCCTCGG + Intergenic
1039076184 8:33692656-33692678 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
1039330774 8:36534392-36534414 GATTTCCATGACCCCCTCTTTGG + Intergenic
1039536952 8:38325084-38325106 GGTTCTCGTGACCCCCTCCTTGG - Intronic
1039803889 8:40982644-40982666 GGTGCCCAGGACTCCCTCTTTGG - Intergenic
1039804484 8:40986766-40986788 GGTTCCCATGACTCCCTCACTGG + Intergenic
1039820165 8:41127800-41127822 GGTTCCCACAACCCCCTCTTTGG - Intergenic
1040007186 8:42630414-42630436 TGTTTCCATGACGCCCTCTTGGG + Intergenic
1040652649 8:49465831-49465853 GGTTCCCTTGTGCCCCTCGCAGG - Intergenic
1041657694 8:60370349-60370371 AGTTCCCATGTCCCGCTCTTTGG + Intergenic
1041669445 8:60478228-60478250 GGGTCCCATGACCCCCTCTTTGG + Intergenic
1041710622 8:60891024-60891046 GGTTCCAATTTCCCCATCTGTGG + Intergenic
1041950504 8:63495643-63495665 GGTTCCCATGACCCCCTCTTTGG - Intergenic
1042002905 8:64146286-64146308 AGTTCCCATTTTCCCCTTTTTGG + Intergenic
1042111810 8:65389076-65389098 GGATCCCATGCCCCGCTCTTTGG - Intergenic
1042149628 8:65767881-65767903 GGTTCCCAGGACCCTCTTTTTGG - Intronic
1043091338 8:75908046-75908068 GGTTCCCATAACCCCCACTTTGG - Intergenic
1043310905 8:78858902-78858924 AGTTCCCTTGTCCCCTTCTCAGG + Intergenic
1043559017 8:81468970-81468992 GGTTTCCATGACCGCCTCCTGGG + Intergenic
1043850930 8:85215804-85215826 TGTTCCCATGACCCCCTCCTTGG - Intronic
1044553348 8:93536055-93536077 GGTTCCCATTGTCCCCTCTTTGG + Intergenic
1044606692 8:94054134-94054156 GGTTCCCAGGACCCCCTCCTTGG + Intergenic
1045265920 8:100618624-100618646 GGTTTCCATGACCCCCTCTCAGG + Intronic
1045347786 8:101310269-101310291 GGTTCCCATGACCCCCTCTTTGG + Intergenic
1045517397 8:102872205-102872227 GGTTCCCATGACCTCCTCTTTGG + Intronic
1045940282 8:107730009-107730031 AGTCCCCATGACCCTCTCTTTGG - Intergenic
1045991579 8:108314663-108314685 GGTTCCCATGACCCCCTCTTTGG - Intronic
1046198053 8:110888928-110888950 GGTTCCCATGATCTCCTTTTGGG - Intergenic
1046229443 8:111334771-111334793 GGGTCCCTTGTCCCCCTCGCAGG + Intergenic
1046590265 8:116198123-116198145 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
1046870098 8:119196755-119196777 GGTTCCTTTGTCCCCCTCATAGG + Intronic
1047079253 8:121442289-121442311 GGTTCCCTTGTCCCCTTCACAGG + Intergenic
1047202042 8:122775606-122775628 AGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1047640840 8:126820513-126820535 AGTTCCCTTGTCCCCCTCTCAGG + Intergenic
1048073531 8:131043520-131043542 GGGTCCAATCTCCCCCTCCTTGG - Intergenic
1048135087 8:131740483-131740505 GGTTCCCTTGTCCCCCTCTCAGG - Intergenic
1048340789 8:133537113-133537135 GGTTCCCATGACCCCCTTTCTGG + Intronic
1049161249 8:141099399-141099421 GGTTCCCACGACCCCCTCCTCGG + Intergenic
1049429772 8:142555370-142555392 GGTTCCCACGACCCTCTCCTTGG - Intergenic
1049468008 8:142761999-142762021 GGTTCCCACAACCCCCTCCTCGG - Intergenic
1049495058 8:142926139-142926161 GGATCCCAAGTCGCCCTCTGTGG - Intergenic
1049861943 8:144904735-144904757 GGTTTCCATGACTCCCTCTTTGG + Intergenic
1049872766 8:144993907-144993929 GGTTCCCATGACCCTCACTTTGG - Intergenic
1050059083 9:1687028-1687050 AGTTCCCTTGTCCCCTTCATGGG + Intergenic
1050202085 9:3156660-3156682 GGTTCCCTTGTCCCCCTTGCAGG + Intergenic
1050479365 9:6073760-6073782 GTTTCCCTTGTCCCCCTCGCAGG - Intergenic
1050538374 9:6649314-6649336 GGTTTCCATGATCCCTTCTTTGG - Intergenic
1050605874 9:7300655-7300677 GGTTCCTATGACCACCTCTCAGG + Intergenic
1050784770 9:9387699-9387721 GGTTCCTTTGTCCCCCTCTCAGG + Intronic
1050988384 9:12113080-12113102 ACTTCCCATGACCCCTTCTTTGG + Intergenic
1051092351 9:13424586-13424608 AGTTCCCTTGTCCCCATCTCAGG - Intergenic
1052778336 9:32755441-32755463 GGTTCCCTTGTCGCCCTCGCAGG + Intergenic
1052949100 9:34193581-34193603 TGTTCCCACGATCCCCTCTTTGG + Intronic
1053032807 9:34797091-34797113 GCTTCCCTTGTCTCCCTCTCAGG + Intergenic
1053797461 9:41739758-41739780 GGTTCCTACGACCCCCTCTTTGG + Intergenic
1054147727 9:61575185-61575207 GGTTCCTACAACCCCCTCTTTGG - Intergenic
1054185874 9:61951810-61951832 GGTTCCTACGATCCCCTCTTTGG + Intergenic
1054467475 9:65506232-65506254 GGTTCCTACGACCCCCTCTTTGG - Intergenic
1054652632 9:67636709-67636731 GGTTCCTACGACCCCCTCTTTGG - Intergenic
1055199751 9:73646180-73646202 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
1055250139 9:74293867-74293889 GGTTCCCACGACTCCCTCTTTGG + Intergenic
1055300818 9:74879872-74879894 GGTTCCCATGACCTCCTCTTTGG - Intronic
1055484870 9:76746970-76746992 GGTTCCCATGACCGCTTCCTTGG - Intronic
1056327429 9:85491289-85491311 AGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1056605626 9:88082542-88082564 GGTTCCCATAATTCCCTCTTTGG - Intergenic
1056890582 9:90488241-90488263 GGTTCCCACCATCCCCTCTTTGG - Intergenic
1056956583 9:91086712-91086734 AGTTCCCATGACCCTCTCTTTGG - Intergenic
1057021278 9:91699389-91699411 GGGTCCCACAACCCCCTCTTTGG - Intronic
1057327336 9:94077459-94077481 GGTTCCCACACCCCTCTCTTTGG + Intronic
1057469409 9:95344267-95344289 GGTTCCCATGGCTCCCTTTCTGG + Intergenic
1057542527 9:95988927-95988949 GGTTCCCACAACCCCCTCCTGGG + Intronic
1057711455 9:97449426-97449448 GGTTCCCAAAACCTCCTCTTTGG + Intronic
1058584405 9:106491877-106491899 GGTTTCCTTGTCCCCCTCACAGG + Intergenic
1059108250 9:111530437-111530459 GGTTCCCATGAGCCCCTCCCTGG - Intronic
1060213825 9:121726455-121726477 GTTTCCCATAAACCCCTCTTTGG - Intronic
1061024780 9:128041439-128041461 GGTTCCCATGATTCCCTCTTTGG - Intergenic
1061333386 9:129912018-129912040 GGTTCCCCTGACCCTCTCTTTGG - Intronic
1061504175 9:131021759-131021781 AGTTCCCATGACCCCTTCTTTGG + Intronic
1062397989 9:136360206-136360228 GGTTCCCAAGGCCCCTTCTGGGG - Intronic
1203610957 Un_KI270749v1:2951-2973 GGTTCTCATGACCCCCTCTTTGG - Intergenic
1203657192 Un_KI270753v1:9187-9209 GGTTCCCATGACTCCCTCTTTGG - Intergenic
1185942805 X:4340466-4340488 GGTTCCCTTGTCCCCCTCACAGG + Intergenic
1186697050 X:12046559-12046581 GGTTCCCTCAGCCCCCTCTTTGG + Intergenic
1186837208 X:13450016-13450038 GGTCCCCATAACCCCCTCCTTGG + Intergenic
1186896054 X:14005617-14005639 GGTTCCCACGACCTCCTCTTTGG - Intergenic
1187337725 X:18395378-18395400 GGTTCCCCTGCCACCCCCTTAGG - Intergenic
1187365238 X:18661260-18661282 GGTCCCCTTGTCCCCATCTCAGG + Intronic
1187373232 X:18727745-18727767 GGTTCCCATGACCCCCTCTTTGG + Intronic
1188597798 X:31922422-31922444 GGTTCCCATGACCCTCTCTTTGG - Intronic
1188972819 X:36638316-36638338 GATTCCCATGACTCCCTCCTTGG + Intergenic
1189083888 X:38000407-38000429 AGTTCCCTTGTCCCCCTCACAGG + Intronic
1189312419 X:40029052-40029074 GATTTCCATGACCCCCTCCTTGG - Intergenic
1189340751 X:40202871-40202893 AGTTCCCATGACCCCCTCTTTGG + Intergenic
1189515603 X:41711063-41711085 GGATCCCACGGCTCCCTCTTTGG - Intronic
1189831717 X:44981291-44981313 GGTTCCCATGACCCTCTCCTTGG + Intronic
1189949628 X:46215005-46215027 GGTTCCCACGACCCCCTCCTTGG - Intergenic
1190833542 X:54080471-54080493 GTATCCCATGTCCTCCTCTAAGG + Intronic
1191146561 X:57172303-57172325 AGTTCCCTTGTCCCCCTCACAGG + Intergenic
1193769638 X:85573587-85573609 GGTTCCCATGATCCCCTCTTTGG - Intergenic
1193836265 X:86348797-86348819 AGTTCCCTTGTTCCCCTCTCAGG + Intronic
1193846478 X:86478645-86478667 GGTTCCCTTATCCCCCTCACAGG + Intronic
1193898287 X:87141366-87141388 GGTTCCCTTGTTCCCCTCGCAGG - Intergenic
1194298358 X:92155162-92155184 GGTTCCCCTGTCCCTCTCGCAGG - Intronic
1194819794 X:98491387-98491409 GGTTCCCATGACCCCTTTTGGGG - Intergenic
1195087302 X:101424407-101424429 GGTTCCCATGACCCTCCCCTTGG - Intronic
1195344186 X:103932163-103932185 GGTTCACATGACCCCCTCTTTGG - Intronic
1195362762 X:104101050-104101072 AGTTCACATGACCCCTTCTTTGG + Exonic
1196072369 X:111539707-111539729 GGTTCCCTTGTCCCCCTCGCAGG - Intergenic
1196258818 X:113554366-113554388 GGTTCCCTTGTCCCCCTCGCAGG + Intergenic
1196261333 X:113586021-113586043 AGTTCCCTTGTCCCCCTCCCAGG + Intergenic
1196783706 X:119404339-119404361 GGTTCCCACGACCCCCTCTTTGG + Intronic
1196802027 X:119552376-119552398 GGTTCCCACGACCCCCTCTTTGG + Intronic
1197337956 X:125231260-125231282 GGTTCCCACAACCCCCTCTTTGG - Intergenic
1198048413 X:132925377-132925399 GGTTTCCACGACCCCCTCCTTGG - Intronic
1198167493 X:134072009-134072031 AGTTCCCTTGTCCCCCTCATAGG + Intergenic
1198743134 X:139862322-139862344 GGTTCCCATGAACCTCTCCTTGG - Intronic
1199237489 X:145507668-145507690 TGTTCCCATGATCCCCTCTTTGG - Intergenic
1200615966 Y:5380122-5380144 GGTTCCCCTGTCCCTCTCGCAGG - Intronic
1202586216 Y:26430639-26430661 GTTTCCCAGGACCCCCTCTTTGG - Intergenic