ID: 1008952492

View in Genome Browser
Species Human (GRCh38)
Location 6:57175897-57175919
Sequence GACCAACTGGCTTCAAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 2, 1: 31, 2: 85, 3: 216, 4: 453}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952492_1008952498 7 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952492_1008952505 19 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952505 6:57175939-57175961 ACTTGCAACGGTGGAGGGTGGGG No data
1008952492_1008952502 14 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952502 6:57175934-57175956 CCTAGACTTGCAACGGTGGAGGG No data
1008952492_1008952508 27 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952508 6:57175947-57175969 CGGTGGAGGGTGGGGTCTTGGGG No data
1008952492_1008952507 26 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952507 6:57175946-57175968 ACGGTGGAGGGTGGGGTCTTGGG No data
1008952492_1008952504 18 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952504 6:57175938-57175960 GACTTGCAACGGTGGAGGGTGGG No data
1008952492_1008952503 17 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952503 6:57175937-57175959 AGACTTGCAACGGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 192
1008952492_1008952500 13 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952500 6:57175933-57175955 GCCTAGACTTGCAACGGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1008952492_1008952497 -9 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952497 6:57175911-57175933 CAGTTGGTCAGAAGTTCTGGAGG 0: 16
1: 29
2: 95
3: 185
4: 443
1008952492_1008952506 25 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952506 6:57175945-57175967 AACGGTGGAGGGTGGGGTCTTGG No data
1008952492_1008952499 10 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952499 6:57175930-57175952 GAGGCCTAGACTTGCAACGGTGG 0: 1
1: 1
2: 2
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952492 Original CRISPR GACCAACTGGCTTCAAATTG GGG (reversed) Intronic
900327436 1:2115634-2115656 GACCAACTGGCTGTGAATCGGGG + Intronic
900708706 1:4097155-4097177 GACCACCTGGCTTCAAGCTGGGG + Intergenic
901295913 1:8160771-8160793 AACCAACTGGCTTGAAATATGGG - Intergenic
901298352 1:8178640-8178662 GACCAACCAGCTACAAATTCTGG + Intergenic
901385194 1:8903584-8903606 GAGTCACTGGCTTCAATTTGGGG - Intergenic
901850922 1:12014845-12014867 GAGCATCTGGCTTCATAATGTGG + Intergenic
902285140 1:15403405-15403427 GACGGACAGGCTTCAAGTTGGGG + Intergenic
902585163 1:17434592-17434614 GACCAACTAGCCTCTAGTTGGGG - Intronic
903102214 1:21040498-21040520 GACTGACTGGCTTCAATTTGGGG - Intronic
903341373 1:22656810-22656832 GACCAATCAGCTTCAAGTTGGGG + Intronic
903519077 1:23933837-23933859 GACCGACTGGCTTCAAGCTGGGG + Intergenic
903526574 1:23995375-23995397 GACCAACCAGCTTCAAGTTGAGG - Intergenic
903564140 1:24252089-24252111 GACCACCTGAGTTCAAATTCTGG - Intergenic
904186835 1:28712054-28712076 GACCAACTGGCTATAAATTGGGG + Intronic
904218280 1:28942361-28942383 GACCAACTGGCTCCAAATTGGGG + Intronic
904542838 1:31245053-31245075 GATAAACTGGCTATAAATTGGGG + Intergenic
904934966 1:34123541-34123563 GACCAATTGGCTTCAAGTTGGGG - Intronic
905412068 1:37777533-37777555 GACCAACTCGCTATAAATTGGGG + Intergenic
905565591 1:38961870-38961892 GACCAACTGGCTACAAATCTGGG - Intergenic
905692092 1:39950971-39950993 GACAAGCTGGCTTCAAATTGAGG + Intergenic
905761070 1:40558829-40558851 GCCCAACTGGCTTCACCTAGTGG + Intergenic
906234175 1:44194007-44194029 GTCCAGCTGGCTTCAAATCTGGG - Intergenic
906268868 1:44458391-44458413 GACCACCTGGGTTCAAATCCTGG + Intronic
906433210 1:45772928-45772950 GACTGACTGGCTTCAAGTTAGGG - Intergenic
906482740 1:46210529-46210551 GACCAACCAGCTTCAAATTGGGG + Intronic
906753239 1:48285328-48285350 GATCCACTGGCTTGAAATTCTGG - Intergenic
907983125 1:59504347-59504369 GAACTACTGGCTTCAAGTTGGGG - Intronic
908211594 1:61906047-61906069 GACCAACTGGCTACAAACCAGGG + Intronic
908505255 1:64790983-64791005 GACCAACTAACTACAAATTTGGG + Intronic
908727627 1:67193933-67193955 GACCAACCGGCTAAAAATTGTGG + Intronic
909023033 1:70452979-70453001 GACTGACTGGCTTCAAGTTGGGG + Intergenic
909087239 1:71182137-71182159 GCCCAACTGTGTTCTAATTGTGG + Intergenic
909130067 1:71723767-71723789 GCCCAACTGGCTACAAATAGGGG - Intronic
909446883 1:75757928-75757950 GGCTGACTGGCTTCAAGTTGGGG + Intronic
909701190 1:78525300-78525322 GACAAACTGGCTACAAATTCAGG + Intronic
910169151 1:84359201-84359223 GACCAACTGGCTATAAATCAGGG - Intronic
910327740 1:86029283-86029305 GATCACCTGGCTTCAAATCTGGG + Intronic
910609672 1:89127964-89127986 GCCCAACTGGCTTCACCTAGTGG + Intronic
910881329 1:91924675-91924697 AACCAACTGGCTTCAAGTTGGGG + Intergenic
911020930 1:93386994-93387016 GACCAACTGGCTATAAATCATGG + Intergenic
911747118 1:101452325-101452347 GACTGACTGTCTTCAAATTGGGG + Intergenic
911890960 1:103371296-103371318 GATCAACTGGCTGCAAATTGGGG - Intergenic
912261591 1:108116147-108116169 GACTGACTGGCTATAAATTGGGG - Intergenic
912816947 1:112836999-112837021 GGTCAACTGGCTATAAATTGGGG + Intergenic
912913678 1:113789546-113789568 GACCAACTGGCTTCAAGTTGGGG - Intronic
913093865 1:115498080-115498102 GACCAGCTGGTTTCAAATTAAGG + Intergenic
913171875 1:116240524-116240546 CATCAACTGGCTCCAAGTTGGGG - Intergenic
913430109 1:118781178-118781200 GATCCACTGGCTTGAAATTCTGG - Intergenic
914934834 1:151969140-151969162 GACCAACTGGCTATAAATTAGGG - Intergenic
915183453 1:154083456-154083478 GACCAACTGGCCTCTAGTTGGGG - Intronic
915377788 1:155412673-155412695 GACCAACCAGCTTCAAGTTGGGG - Intronic
915696985 1:157753338-157753360 GACCAAATGGCTATAAACTGGGG + Intronic
915727340 1:158027129-158027151 GACTGGCTGGCTACAAATTGGGG + Intronic
916027703 1:160848952-160848974 GACCAACCAGCTTCCAGTTGGGG - Intronic
916293099 1:163187831-163187853 GACAAACTGGCTTCAAGTTAAGG - Intronic
916531420 1:165660250-165660272 GATCAACTGGCTTCAAGTTGAGG + Intronic
916658334 1:166897907-166897929 GACCAACTGGCTACAAATTTTGG - Intergenic
917155308 1:171991354-171991376 GACTGACTGGCTATAAATTGGGG + Intronic
917474244 1:175354558-175354580 GAGCAACTGGCTTGCAATTTGGG + Intronic
917995795 1:180437256-180437278 TACCAACTGGCTTCAAGTTGTGG - Intronic
918272265 1:182913241-182913263 GACTGACTGACTTCAAGTTGGGG - Intronic
918490235 1:185073988-185074010 GACCAATTGGCTATAAGTTGGGG + Intronic
918508366 1:185282611-185282633 GACCAACTGGCTTATAAATCAGG - Intronic
918508400 1:185282888-185282910 GACCAACTACCTATAAATTGGGG + Intronic
920568010 1:206991469-206991491 GACCAACTGGATTGGAATTCTGG + Intergenic
920808478 1:209257730-209257752 GACCAACTGCCTATAAATTCAGG + Intergenic
920809016 1:209264734-209264756 GACCTAATGGCTTCAAGTTGGGG - Intergenic
921129858 1:212210418-212210440 GACTACCTGGGTTCAAATTATGG - Intergenic
921295435 1:213696991-213697013 GACCCACTGGCTATAAACTGGGG + Intergenic
921525462 1:216211249-216211271 AACCCACTGGCTATAAATTGGGG - Intronic
921703584 1:218294395-218294417 GACCAACTGACTTAAAATTGGGG + Intronic
921829377 1:219710330-219710352 GACAAACTGGCTTGGACTTGAGG - Intronic
921830489 1:219723140-219723162 GGCCAATTGGCTTCAAGTTGGGG - Intronic
921933366 1:220773513-220773535 CACCAACTGGCTATAAATTGAGG - Intronic
922173206 1:223174675-223174697 GATCAGCTGGCTACAAATTTGGG + Intergenic
922761416 1:228134217-228134239 GACCAACTGGCTTCAAGTTGGGG + Intergenic
922805274 1:228383440-228383462 GACCAACTGGCTTTAAGTTGGGG + Intergenic
922843975 1:228668360-228668382 CATCAACTGGCTATAAATTGGGG - Intergenic
922966847 1:229697629-229697651 GACCCACCAGCTTCAAGTTGGGG + Intergenic
923065053 1:230509880-230509902 GACTCACTGGCTACAAATTCGGG + Intergenic
923301291 1:232643009-232643031 GACCAACTGGCTTCAAGCTGGGG - Intergenic
923746378 1:236704520-236704542 GACCAACCAACTTAAAATTGGGG + Intronic
923804465 1:237243319-237243341 AACCAACTGGCTTTGAGTTGGGG + Intronic
923856198 1:237848076-237848098 GATCAGCCGGCTTCAAGTTGGGG + Intergenic
923884367 1:238138504-238138526 GACCAACTGGGTATAAATCGGGG + Intergenic
923913530 1:238477107-238477129 GACCAACTGGCTATAAATCAGGG + Intergenic
924063199 1:240197428-240197450 GACCAACTGGCTATAAATCCAGG - Intronic
924855178 1:247868645-247868667 GACCAACTGACTGTAAACTGGGG + Intronic
1063507924 10:6618479-6618501 GACCAACTGGCATCAAGTCAGGG - Intergenic
1065034413 10:21622889-21622911 CACCAACTGGTTATAAATTGGGG + Intronic
1065053644 10:21820712-21820734 GACCAACTGGTTTCAAGTTGGGG + Intronic
1065208091 10:23375884-23375906 GACAAACCAGCTTCAAGTTGGGG - Intergenic
1065229489 10:23582736-23582758 GACCAACTGGCTACAAATTCAGG - Intergenic
1065579332 10:27155348-27155370 CGCCAACTGGGTTCAAAGTGAGG - Exonic
1065810256 10:29436483-29436505 GACAAACTGGCTACAAATTCAGG - Intergenic
1065935802 10:30519563-30519585 ACCAAACTGGCTTCAAGTTGGGG + Intergenic
1065961898 10:30740399-30740421 GAACGACTGGCTATAAATTGAGG - Intergenic
1065990668 10:31006605-31006627 GACCAACCTGCTATAAATTGGGG - Intronic
1067137483 10:43624274-43624296 GACCCACCAGCTTCAAGTTGGGG + Intergenic
1067315840 10:45161192-45161214 AACCAGCTGGTTTCAAGTTGGGG - Intergenic
1067370449 10:45677533-45677555 GACTACCTGGGATCAAATTGTGG + Intergenic
1068459338 10:57306783-57306805 GACCAACCAGCTTCAAGTTGGGG + Intergenic
1068518416 10:58051944-58051966 GACCAACAGGTTATAAATTGAGG - Intergenic
1068530424 10:58179949-58179971 GACCAACTGGTTACAAATCTGGG + Intergenic
1068566733 10:58584249-58584271 CACCTTCTGTCTTCAAATTGGGG + Intronic
1069176783 10:65300142-65300164 GACCAACTGGCTTCACATTGGGG - Intergenic
1069576494 10:69533722-69533744 GACCAACTGACTATAAATTGGGG - Intergenic
1071047546 10:81400587-81400609 GACCAATTGGCTACAAATCCAGG + Intergenic
1071341354 10:84651850-84651872 GATCCACTGGCTTCAAATTCTGG - Intergenic
1071522878 10:86341783-86341805 GACCGAGTGGCTTCCAAATGGGG + Intronic
1071664841 10:87544137-87544159 GACTGACTGGCTTCAAGTTGGGG + Intronic
1071849769 10:89557059-89557081 GACCAATCAGCTTCAAGTTGGGG - Intergenic
1072285112 10:93906756-93906778 AACCAACTGTTTTCAAAGTGTGG + Intronic
1072464200 10:95648064-95648086 GACTGACTGGCTTCAAGTTGGGG - Intronic
1073160857 10:101393364-101393386 GACTGACTGGCTTCAAGTTGGGG - Intronic
1073498383 10:103914942-103914964 GACCAACTGGTTATAAATTTGGG + Intronic
1073707591 10:106002647-106002669 GACAACCTGGATTCAAATTCTGG + Intergenic
1074265104 10:111893856-111893878 GACCAGCTGGCTTCAAATTTGGG - Intergenic
1074621134 10:115124233-115124255 GACCATCTGGCTACATATTTAGG + Intronic
1075531269 10:123232007-123232029 GACTATCTGGGTTCAAATTCAGG - Intergenic
1075940192 10:126384968-126384990 GACCAACTAGCTATAAGTTGGGG + Intronic
1077083858 11:737770-737792 CACCAAATGGCATTAAATTGGGG + Intergenic
1077086223 11:752826-752848 GATCCACTGGCTTCAACTTGGGG - Intronic
1078379026 11:10822993-10823015 TGACAACTGGCTTCAAGTTGGGG - Intronic
1078861173 11:15248643-15248665 GACCAACTAGCCTGATATTGAGG - Intergenic
1079187869 11:18253708-18253730 GACTGACTGGCTTCAAGTTGGGG - Intergenic
1080244383 11:30163261-30163283 GCCTGACTGGCTTCAAGTTGGGG - Intergenic
1080340372 11:31256376-31256398 GACCAGCTGGCTACAAATTCTGG + Intronic
1080798779 11:35590016-35590038 GTCCACCAGGCTTCACATTGAGG + Intergenic
1081150014 11:39616454-39616476 GACCAACTGGCTATAAATGAGGG - Intergenic
1081322961 11:41713778-41713800 GACCGACTGGCATTAAATTGGGG + Intergenic
1081471038 11:43371346-43371368 AACCAACCAGCTTCAAGTTGGGG + Intronic
1083286458 11:61662311-61662333 GACCGACTGGTTTCAAGTTGGGG - Intergenic
1083390495 11:62346162-62346184 GACCAACCAGCTATAAATTGGGG + Intronic
1083810830 11:65105763-65105785 GACCAACTGGCTCCAGGTAGGGG + Intronic
1085354397 11:75822558-75822580 TACCGACTGGCTATAAATTGGGG + Intronic
1085488604 11:76891578-76891600 GACCAACTGGCTTCAAGTTGGGG - Intronic
1085900006 11:80687493-80687515 GACCAACTGGCTATAAATCGAGG - Intergenic
1086575159 11:88331318-88331340 GATGGACTGGCTTCAAATTGGGG + Intronic
1087023738 11:93629194-93629216 GACCAATGGTCTTCAAGTTGGGG - Intergenic
1087077611 11:94139973-94139995 GACCAACCAGCTATAAATTGAGG - Intronic
1087362463 11:97178110-97178132 GACAAACTGGCTATACATTGGGG + Intergenic
1088205099 11:107383185-107383207 GACCACCCAGCTTCAAGTTGGGG - Intronic
1088526303 11:110759753-110759775 AACCAACTGGGTTCAAATGCTGG + Intergenic
1088608637 11:111556070-111556092 GACCAATTGGCTACAAATCCAGG + Intronic
1089532958 11:119143524-119143546 GACCAACTGGCTATAAATCAGGG - Intergenic
1089663886 11:120004600-120004622 CACCAACTGGCTACAAATTCAGG + Intergenic
1090037049 11:123258275-123258297 GACCAATTGGCTTCAAATCTGGG + Intergenic
1090307481 11:125703682-125703704 GAACCACTGGCTTGAAATTCTGG + Intergenic
1091116505 11:133018545-133018567 GGCCATCTGGCTTCAAAAGGGGG - Intronic
1091172925 11:133534334-133534356 ATACAACTGGCTTGAAATTGTGG + Intergenic
1091577206 12:1748996-1749018 GACCAACCAGCTTCAAGTTGGGG + Intronic
1091961385 12:4697974-4697996 GACCGATTGGCTACAAATCGAGG + Intronic
1092177106 12:6417574-6417596 GATCAACTGGCTTCAAGTTGGGG + Intergenic
1092395194 12:8119864-8119886 GATCAACTGACTACAAATTTGGG + Intergenic
1092470149 12:8770854-8770876 GACCAACTGGCTTCAAGTTGGGG + Intronic
1092502510 12:9063321-9063343 GACCAACTGGCCTGAAATGGGGG + Intergenic
1092546552 12:9457084-9457106 GACCCACCAGCTTCAAGTTGGGG + Intergenic
1092590253 12:9946722-9946744 GACCAACCAGCTACAGATTGAGG + Intergenic
1092612191 12:10184366-10184388 GACCTACTGGTTATAAATTGGGG - Intronic
1093254378 12:16848471-16848493 GACCAGCTGGCTATAAATTCAGG + Intergenic
1093703199 12:22246107-22246129 GACTGACTGGCTTCAAGTTGGGG - Intronic
1093708180 12:22298276-22298298 GACTGACTGGCTATAAATTGGGG - Intronic
1093927198 12:24920787-24920809 GACCAACAGGTTTCAAGTTGGGG + Intronic
1093942218 12:25067525-25067547 GACCAACTCTCTATAAATTGGGG + Intronic
1094374450 12:29775390-29775412 GACCAACTGGCTACATAATCAGG + Intronic
1094506390 12:31064998-31065020 GACCCACCAGCTTCAAGTTGGGG - Intergenic
1095277861 12:40310726-40310748 GAGCAACTCACTTAAAATTGTGG + Intronic
1095704305 12:45220990-45221012 GACCCACCGGCTACAAATTGAGG - Intronic
1095886734 12:47196266-47196288 GAGCAACTAGCTTCAAATCCTGG + Intronic
1096812393 12:54179715-54179737 GACCAACTGGCTATAAATTCAGG + Intronic
1097729855 12:63116266-63116288 GACTGACTGGCTTCAAGCTGGGG + Intergenic
1097798119 12:63885210-63885232 GACCAACCAGATTCAACTTGGGG + Intronic
1098104561 12:67055813-67055835 GACCAGCTGTCCTCAAAGTGTGG - Intergenic
1098132254 12:67362969-67362991 GACCAACTGGCTATAAATCAGGG - Intergenic
1098296701 12:69011354-69011376 GACTGACCGGCTTCAAGTTGGGG + Intergenic
1098493265 12:71106734-71106756 GACCAACTGGCTATAAATTAGGG - Intronic
1098690382 12:73480606-73480628 GAACAACTGGCTATAAATTTAGG + Intergenic
1100445640 12:94657175-94657197 GGCCAACCGGCTTCATGTTGGGG - Intergenic
1100615141 12:96225678-96225700 GACCAGCTGGGTTCAAATCCGGG - Intronic
1100705452 12:97195695-97195717 GACCAACTGGCTATAAATCAGGG - Intergenic
1100836627 12:98572713-98572735 GACCAACTGGCTTCAAGTTGGGG + Intergenic
1101462668 12:104912709-104912731 GACCAACTGGCTTTAAGCTGGGG - Intronic
1101582130 12:106050858-106050880 GACCAAGTGGCTTCAAGTTGGGG + Intergenic
1102022313 12:109692240-109692262 GACCAACCGGCCACAAATTCAGG - Intergenic
1103160384 12:118724422-118724444 GACTGCCTGGGTTCAAATTGTGG + Intergenic
1103160537 12:118725551-118725573 GACTGCCTGGGTTCAAATTGTGG - Intergenic
1103257130 12:119551340-119551362 GACCAGCTGGCTACAATTTGAGG - Intergenic
1103286903 12:119810112-119810134 CGCTGACTGGCTTCAAATTGGGG - Intronic
1103752363 12:123173904-123173926 AACCAACTGGCTTCAAGTTGAGG - Intronic
1103867681 12:124065737-124065759 GACCACCTGGGTTCAAATCCTGG - Intronic
1105604748 13:21917698-21917720 GACCAACTAGCTACAAATTCAGG - Intergenic
1105646292 13:22321486-22321508 CACCAATTGGCTTCCAATTTTGG - Intergenic
1105974573 13:25462333-25462355 GACCAACTGGCTACACATTCAGG + Intronic
1106085315 13:26536482-26536504 GACCAACAGGCTGGAAAGTGAGG - Intergenic
1106324954 13:28680183-28680205 GACCGACTGGTTGCAAATTGGGG + Intergenic
1106492183 13:30236245-30236267 GACCAGCTGGCTACAAATTCAGG - Intronic
1107018791 13:35730857-35730879 TACCAACTGGCTTCAAGTTGGGG + Intergenic
1107038850 13:35928141-35928163 GACCAACTGGCTACAAATTCAGG - Intronic
1107332548 13:39317313-39317335 GACCAACTGGCTACAAATTTGGG - Intergenic
1107360029 13:39607768-39607790 GACAAACTGGCTTCAAATTGGGG - Intergenic
1107404516 13:40099849-40099871 GACCAACTGGCTACAAATTCAGG - Intergenic
1107533931 13:41310274-41310296 GAGAAACAGGCTTCAAATTCAGG - Intergenic
1107655957 13:42592290-42592312 GACCAACCAGCTACAAATCGGGG + Intronic
1108233033 13:48370467-48370489 GACCAAAGGGCTTCAAGTTGGGG + Intronic
1108239132 13:48444151-48444173 GACCTACTGGCTTCAAATTGGGG + Intronic
1108252779 13:48583450-48583472 GACCTACTGGCTACAAATTGGGG + Intergenic
1108830719 13:54475022-54475044 GACCTACTGGTTTCAAGGTGGGG + Intergenic
1109459573 13:62638458-62638480 GACCCACTGGTTTCAAGTTGGGG + Intergenic
1109506228 13:63306169-63306191 GCCCAGCTGGCTTCACCTTGTGG - Intergenic
1109560816 13:64047777-64047799 GACAGACTGGCTTCAAGTTGGGG + Intergenic
1111706887 13:91761525-91761547 GACCAACTGGCTTCAAGTTGGGG + Intronic
1111812472 13:93108035-93108057 GACCAAATGGCTACAAATTGGGG - Intergenic
1111943024 13:94633161-94633183 GACCAACTGGCTGCAAGTTCAGG - Exonic
1112308964 13:98300988-98301010 GACCAGCTGTCATCAACTTGGGG + Intronic
1112592452 13:100776156-100776178 GACTGACAGGCTTCAAGTTGGGG + Intergenic
1112794662 13:103043204-103043226 GAACAACCGTCTTCAAACTGTGG - Intergenic
1113044301 13:106138386-106138408 GACCAACAGGCTGGAAATTCTGG - Intergenic
1113272125 13:108685326-108685348 GACCAACCAGCTACAAATTGGGG - Intronic
1114596661 14:23918065-23918087 GACCAAGTGGCTACAAATTTGGG - Intergenic
1114772599 14:25445178-25445200 GACTGACTGGCTAGAAATTGGGG - Intergenic
1115061004 14:29189799-29189821 GACAATCTGGCTTCCAAATGAGG + Intergenic
1117093111 14:52269438-52269460 GAACAAATGCCTTCAAAATGAGG - Intronic
1117272929 14:54163456-54163478 GACCAGCTGACTACAAATTGGGG + Intergenic
1117353989 14:54906077-54906099 GATTGACTGGCTTCAAGTTGGGG - Intergenic
1118187804 14:63553369-63553391 GACAAACAGGATTCAAATTGTGG - Intergenic
1118830417 14:69426277-69426299 GACCAACTGGCTTCAAGTTGGGG + Intronic
1118955036 14:70473226-70473248 GATCAACAAGCTTCAATTTGGGG + Intergenic
1118995936 14:70836066-70836088 GACCAACTGGCTACAAATTTAGG - Intergenic
1119127088 14:72137518-72137540 GAGCAACTGGCCATAAATTGGGG + Intronic
1119308513 14:73627443-73627465 GACTAACTGGCTTCACGTTGGGG + Intergenic
1119844257 14:77816740-77816762 GACCAACCAGCTTCAAGCTGGGG - Intronic
1119922571 14:78459979-78460001 GACCAACTGGCTATAAATCGGGG + Intronic
1120163335 14:81168684-81168706 GACCAATCAGCTTCAAGTTGGGG - Intergenic
1120171952 14:81255036-81255058 GACCAACTGGTTATAAATAGGGG - Intergenic
1120513024 14:85438436-85438458 GACCAACTGGCTTCCAGTTGGGG - Intergenic
1121156054 14:91685416-91685438 GACAGACTGGATTCAAATTTTGG - Intronic
1121458744 14:94056669-94056691 GACCAACCAGCTTCAAGTTGGGG - Intronic
1121519097 14:94573673-94573695 GACCAACTGGCTATAAAGTGAGG + Intronic
1121860446 14:97312839-97312861 CACCAACTGGCTTCTACTAGTGG + Intergenic
1122043103 14:99003880-99003902 GCCCACCTGGCTTCCAAGTGTGG + Intergenic
1122216259 14:100206645-100206667 GAGCTTCTGGCTTCAAGTTGGGG - Intergenic
1122554266 14:102568609-102568631 GACCTACAAGCTTCAAGTTGGGG + Intergenic
1122584597 14:102796467-102796489 GACCCACCAGCTTCAAGTTGGGG - Intronic
1122646516 14:103197995-103198017 GACCAACTGGCTATAAATCAAGG + Intergenic
1124183745 15:27502660-27502682 GACCAACGGGCTTCAAGTTGGGG + Intronic
1124391490 15:29262750-29262772 GACCAATGGTCTTCAAGTTGGGG - Intronic
1124434321 15:29634720-29634742 GCCTGACTGGCTTCAAGTTGGGG + Intergenic
1124836329 15:33199119-33199141 GACCAACCAGCTTCAAGCTGGGG - Intergenic
1124956679 15:34364909-34364931 GAAGAACTGGCCTCAAAGTGGGG - Intronic
1125378539 15:39060568-39060590 GACCAACTGGCTATAAATCAGGG - Intergenic
1125756056 15:42065716-42065738 GACCAGCTGGCTGCAAATTTGGG + Intergenic
1125810531 15:42536777-42536799 GACCACCTGGGATCAAATTTTGG + Intronic
1126187011 15:45840699-45840721 GACCAATTGGCTATAAACTGGGG + Intergenic
1126545193 15:49865455-49865477 GGCCAGCTGGCTATAAATTGGGG - Intronic
1127533244 15:59865422-59865444 GACCAACTGGCTTCAAGTTGGGG - Intergenic
1127787769 15:62371436-62371458 GACCAACTGGCTTCAAGTTGGGG + Intergenic
1127890490 15:63246364-63246386 GACCAACTGGCTATAAATTGGGG + Intronic
1128073461 15:64811550-64811572 GACCGACTGGCTTCAAGTTGGGG - Intergenic
1128461207 15:67869122-67869144 GACCAACTGACTTCAAGTTGGGG - Intergenic
1128571839 15:68739305-68739327 GACCAACTGGCTGTAAATCAGGG - Intergenic
1128864629 15:71105214-71105236 GACCAACCAGCTGCAAATTGGGG + Intronic
1129064489 15:72889606-72889628 GATCACCTGGCTTCAAGTTGGGG - Intergenic
1130303191 15:82695752-82695774 GACCAACTGGCTATAAATCAGGG - Intronic
1130740232 15:86591458-86591480 GACCCACTGGCTTGAAGTTGGGG + Intronic
1131353341 15:91721703-91721725 GACCAACCAGCTTCAAGTTGGGG + Intergenic
1131581931 15:93651890-93651912 GAGCAGCTGGCTACAAATTAGGG - Intergenic
1131698232 15:94903530-94903552 GACCAACTAGCTAAGAATTGGGG - Intergenic
1131901236 15:97089959-97089981 GACCATCTGGCCTCAAATCTGGG + Intergenic
1132153346 15:99477673-99477695 GACCACCTGGGTTTAAATTTTGG - Intergenic
1134164653 16:11920381-11920403 GACCAACTGGCTATGAATTGGGG + Intergenic
1134485032 16:14651212-14651234 GACCCACCAGCTTCAAGTTGGGG + Intronic
1134590387 16:15448227-15448249 GACCAACTGGATGCAAAGTCAGG + Intronic
1134755088 16:16660076-16660098 GACCAACTGGCTATAAATTAGGG + Intergenic
1134804690 16:17114294-17114316 GACCAAATGGTTTCAAACTGGGG - Intronic
1134990975 16:18699097-18699119 GACCAACTGGCTATAAATTAGGG - Intergenic
1135082962 16:19452110-19452132 GACCAACCAGCTTCAAGTTGGGG + Intronic
1135256767 16:20947455-20947477 GACCAACCAGCTTCACGTTGGGG - Intronic
1136423257 16:30150849-30150871 GACCGACTGGCTTCAAATTGGGG + Intergenic
1136776065 16:32872547-32872569 GACCGCCTGGCTTCCAAATGTGG - Intergenic
1136894550 16:33988965-33988987 GACCGCCTGGCTTCCAAATGCGG + Intergenic
1137628999 16:49928828-49928850 GCCCAACTGGAAGCAAATTGTGG - Intergenic
1137697633 16:50472619-50472641 AACTAACTGGCTTCAGGTTGGGG - Intergenic
1137997364 16:53233195-53233217 GACTGACTGGCTTCAAGTTAGGG + Intronic
1138343140 16:56303847-56303869 GGGAAACTGGCTTCAACTTGAGG - Intronic
1138780202 16:59775647-59775669 GACAGACTGGCTTCAAGTTGAGG - Intergenic
1139827719 16:69770614-69770636 GACCAACCGGCTATAAATCGAGG - Intronic
1140765098 16:78150108-78150130 GACTCACTGGCTACAAATTGGGG + Intronic
1140916122 16:79494830-79494852 GACAAACTGGCTATAAATTGGGG + Intergenic
1141029839 16:80578136-80578158 CACCAACAGGCTTCAACTTTGGG + Intergenic
1141194140 16:81847083-81847105 GACTGACTGGCTATAAATTGGGG + Intronic
1142295136 16:89216570-89216592 TACCCACAGGCTTCGAATTGGGG - Intergenic
1203078481 16_KI270728v1_random:1134656-1134678 GACCGCCTGGCTTCCAAATGTGG - Intergenic
1143009634 17:3858835-3858857 GTCCCACCGGCTTCAAGTTGGGG - Intergenic
1143212104 17:5196034-5196056 GACAAACTGGCTCTAAAGTGAGG + Intergenic
1143216048 17:5225807-5225829 GAGCAACCAGCTTCAAGTTGGGG - Intronic
1143240613 17:5439966-5439988 GACCAACCCGCTTCAAGTTGGGG - Intronic
1143976012 17:10830389-10830411 GGCAAACTGTGTTCAAATTGTGG - Intronic
1144405519 17:14949262-14949284 GACCAACTGGCTATAAATTCAGG - Intergenic
1145099817 17:20065360-20065382 GACCAACTGGCTTCAAGTTGGGG + Intronic
1145257529 17:21335009-21335031 GGCCAACTAGCTTGAAATTGGGG + Intergenic
1145319111 17:21753026-21753048 GGCCAACTAGCTTGAAATTGGGG - Intergenic
1146809787 17:35894010-35894032 GACCAGCTGGCTTCAAGTTGGGG + Intergenic
1147569019 17:41556041-41556063 AACAAACTGGCTTCAGAGTGTGG + Intergenic
1147738374 17:42655393-42655415 GACCAGCAGGCTTTAAGTTGGGG - Intergenic
1147893418 17:43733666-43733688 GATCAACTGGCTACAAATTTGGG - Intergenic
1148983769 17:51602444-51602466 GACCAACTGACTATAAACTGGGG - Intergenic
1149268229 17:54951103-54951125 GACTGACTGGCTTCAAGTTGGGG + Intronic
1149347658 17:55754270-55754292 GACCAACTGGCTGTAAATAGGGG + Intronic
1149390922 17:56189533-56189555 GACCAACTGGCTATAAAGTGAGG - Intronic
1150430420 17:65111360-65111382 GGGCAACTGGTTACAAATTGGGG + Intergenic
1150666864 17:67148086-67148108 GACCGGCTGGCTTCAAGTTGAGG - Intronic
1151498825 17:74475793-74475815 GACCAACTGGATGCAAATTTGGG + Intronic
1151607080 17:75144635-75144657 GACCGACTGGCTTCAAATTGGGG - Intronic
1151798979 17:76366329-76366351 GACCAGATGGCCTCAAATTCAGG - Intronic
1151996528 17:77612810-77612832 GACCAACTAGCTACAAATTCAGG + Intergenic
1152852019 17:82642552-82642574 GACTGACTGGCTTCAAGTTGGGG - Intronic
1153415165 18:4838338-4838360 GACCAACTGACTTCAAGTTGGGG + Intergenic
1153503393 18:5770969-5770991 AACCAACTGGCTTCAAGTTGGGG + Intergenic
1153640193 18:7150129-7150151 GACCAGCTGGCTGCAAATTTGGG + Intergenic
1153827692 18:8891589-8891611 GACCAACTGGTTACAAGTTCGGG - Intergenic
1153837410 18:8976412-8976434 GACCAACTGGCCACAAATTCGGG + Intergenic
1153880859 18:9420671-9420693 GAACAAATGGCTTCATTTTGTGG - Intergenic
1154334859 18:13457165-13457187 GACCGACTGGCTTCAGGTTGGGG + Intronic
1155332435 18:24731751-24731773 GACCAGCTGGCTACAAATTTAGG + Intergenic
1155971433 18:32087361-32087383 GACCAACCAGCTTCAAGTTGCGG - Intergenic
1156595872 18:38546978-38547000 GATGAACTGGCTACAAATTCAGG + Intergenic
1156646355 18:39166478-39166500 GACCAACTGGCTGTAAATTGGGG - Intergenic
1156813645 18:41282216-41282238 GACCAAACAGCTTCAAGTTGTGG + Intergenic
1156962619 18:43051013-43051035 GACCAACTGGCTTCACGTTGGGG - Intronic
1157807344 18:50667978-50668000 GATGGACTGGCTTCAAGTTGGGG + Intronic
1157959015 18:52131743-52131765 GACTGACTGGCTTCAAGTTGGGG + Intergenic
1158521496 18:58175039-58175061 GACCAACTGTCTGCAAACTTTGG - Intronic
1158573538 18:58616840-58616862 GACTGACTGGCTTCAAGTTGGGG - Intronic
1158889864 18:61862797-61862819 GACCCACCAGCTTCAAGTTGGGG - Intronic
1159017672 18:63114916-63114938 GACCAACAAGCTTCAAGTTGGGG - Intergenic
1159056752 18:63473430-63473452 GTCAAACTGACTTCAAATTTTGG + Intergenic
1159587879 18:70299272-70299294 GACCGACTGGCTACAAATCAGGG + Intronic
1161823520 19:6546160-6546182 GACTGATTGGCTTCAAGTTGGGG + Intergenic
1161909087 19:7179277-7179299 GACTAACTGGCTCTAAATTGGGG - Intronic
1162042389 19:7978706-7978728 GACCAGCTGGCTACAAATTCAGG - Intronic
1162661609 19:12173713-12173735 GACCAACAGGCTTCAAATTGAGG - Intronic
1162987175 19:14278044-14278066 GTCCAGCTGGCTTCACATAGTGG - Intergenic
1164093036 19:21977823-21977845 GATCCACTGGCTTGAAATTCTGG + Intronic
1164112735 19:22184609-22184631 GACCCACTGGCTTGAAATTCTGG + Intronic
1164538132 19:29101916-29101938 GACCAATTGGCTTCAAGTTGGGG - Intergenic
1164717597 19:30404892-30404914 GACCAACAGGCTTCACGTTGGGG + Intronic
1164718006 19:30407562-30407584 GACCAACAGGCTTCACTTTGGGG + Intronic
1165582829 19:36883962-36883984 GACCAGCTGACTACAAATTTGGG + Intronic
1165592361 19:36980532-36980554 GACCAGCTAGCTACAAATTCAGG + Intronic
1165959930 19:39525368-39525390 GACCAACAGGCTACAAATTCAGG - Intergenic
1165985906 19:39768686-39768708 GACCAACTGGCTATAAATTGGGG + Intergenic
1166614651 19:44232400-44232422 GACCAAGTAGCTACAAATTTGGG + Intronic
1166634578 19:44438973-44438995 GACCAACCAGCTGCAAGTTGGGG - Intronic
1167861202 19:52285413-52285435 GACCAACTGGCTTCCAGTTGAGG + Intronic
1167869619 19:52357095-52357117 GACCAACTGGCTTCAAAAGTTGG + Intronic
1167869925 19:52359842-52359864 GACCAACTAGCTTCCATTTGTGG + Intronic
1167881043 19:52457506-52457528 GACCACCCAGCTTCAAACTGGGG - Intronic
1168125967 19:54283090-54283112 GACTGACTGGCTTCAAGTTGGGG - Intergenic
1168171308 19:54591698-54591720 GACTGACTGGCTTCAAGTTGGGG + Intronic
1168176006 19:54628463-54628485 GACTGACTGGCTTCAAGTTGGGG + Intronic
925405317 2:3602212-3602234 GGCCAGCTGGCTTGGAATTGTGG + Intronic
926007564 2:9384531-9384553 GACCAACCGGCTTCAAGTTGGGG + Intronic
926022976 2:9513411-9513433 GACCAACTGGCTTCAAGTTGGGG - Intronic
926259045 2:11239836-11239858 GACTTACTGGCTACAAATTCAGG + Intronic
926374093 2:12209572-12209594 GATCAACTGGCTTCAAGTTAAGG - Intergenic
927293320 2:21425511-21425533 GACTAACTGGCTACAAATCCAGG - Intergenic
927666859 2:25038894-25038916 GACCAACTGGCTTCAAGTTGGGG + Intergenic
928330789 2:30356455-30356477 GACCAACCGGCTATAAATTGGGG + Intergenic
928444690 2:31322562-31322584 GGCCAACTGGCTATAAATAGGGG - Intergenic
929280477 2:40072609-40072631 GACCCACTGGCTTGGAATTCCGG - Intergenic
929983742 2:46705224-46705246 GACCAACCGGCTATAAACTGGGG - Intronic
930194655 2:48497065-48497087 GACTAACCGGCTTTAAATTGAGG - Intronic
931613050 2:64124910-64124932 GACCAACTAGCTATAAATTGGGG + Intronic
932014575 2:68011426-68011448 GACCAACTGACTTCAAGTCAGGG + Intergenic
932049313 2:68383104-68383126 GACCACCTTGGTTCAAATTCTGG + Intronic
932651873 2:73566780-73566802 GACCAACTAGCTCCAAATTGGGG + Intronic
932902127 2:75712012-75712034 GCCCAACTGGCTTCACCTAGTGG - Intergenic
933149829 2:78901305-78901327 GACCAACTGGTTATAGATTGAGG + Intergenic
933281875 2:80340878-80340900 GACCGACTGTCTATAAATTGGGG + Intronic
933476903 2:82803044-82803066 GACCCACTGGCTTGAAATTCAGG + Intergenic
933530348 2:83501986-83502008 GACCAACTGGGTACAAATCTAGG - Intergenic
933553808 2:83807699-83807721 GACTGACCAGCTTCAAATTGGGG + Intergenic
933572150 2:84026268-84026290 GATCAGCTGGCTGCAAATTTTGG - Intergenic
933725845 2:85426798-85426820 GACCAACTGGCTTCAAGCTGGGG - Intronic
935045929 2:99482427-99482449 GACCAACTGGCTACAACTTTCGG - Intronic
935242387 2:101189996-101190018 GACCAACTGGCTTCAAGTTGGGG - Intronic
935493255 2:103746587-103746609 GACCAACTGGCTAAAAAGTCAGG - Intergenic
935695608 2:105768471-105768493 GATCAACTGGCTGTAAATTGGGG + Intronic
935740585 2:106143979-106144001 AACCAGCTGGCTTTAAAATGAGG - Intronic
936002805 2:108851031-108851053 GACCAACTGGCTTCAAATTGGGG + Intronic
936595151 2:113840476-113840498 GACCAACCAGCTTCAAGCTGGGG - Intergenic
937156250 2:119721534-119721556 GACCAGCTGGCTACAAATCTGGG - Intergenic
937356145 2:121199361-121199383 GACATACTGACTTCAAGTTGGGG - Intergenic
937920660 2:127127293-127127315 GACCAACTGGCTACAAACCTGGG - Intergenic
937968812 2:127534547-127534569 GACCAATTGGCTATAAATCGGGG + Intergenic
938185689 2:129229983-129230005 GACTAACTGGCTACAAATTTGGG + Intergenic
938739023 2:134213607-134213629 GACCAATTGGCTGTATATTGAGG + Intronic
939061014 2:137421379-137421401 GACCAACTGGCTTCAAGTTGGGG + Intronic
939575213 2:143887269-143887291 GAGCCACTGGCTATAAATTGGGG - Intergenic
941310647 2:163926488-163926510 GACCAACTAACTATAAATTGTGG - Intergenic
942224355 2:173802319-173802341 GACCAACTAGCTTCAAGTTGGGG + Intergenic
942505186 2:176634522-176634544 GTCCAACTGGCTTGAAATAAAGG + Intergenic
942645003 2:178101153-178101175 AACTAACTGGCTACAAATTTGGG + Intronic
942745284 2:179224989-179225011 GACTGACTGGCTATAAATTGGGG - Intronic
943074651 2:183179439-183179461 GAACCACTGGCTTGAAATTGTGG - Intergenic
943521182 2:188950760-188950782 GACCAACTGGCTACAAATTTGGG - Intergenic
943771511 2:191722517-191722539 GACCAGCTGGTTTCAAGTTGGGG + Intergenic
944621026 2:201516443-201516465 GACCAGCTGGTTTAAAAGTGTGG - Intronic
944783314 2:203042208-203042230 GACCAACTGGCTATAAATTCTGG + Intronic
944861416 2:203819110-203819132 GACTGACTGGCTATAAATTGGGG + Intergenic
945549158 2:211197693-211197715 GAACAGCTGGCTTCAAGTTGGGG - Intergenic
945951391 2:216042058-216042080 GACTGACTAGCTTCAAGTTGGGG - Intronic
946476543 2:220011638-220011660 GACCAGCCTGCTTCAAGTTGGGG - Intergenic
946586694 2:221196897-221196919 GACCAACTGGCTATAAATCAAGG - Intergenic
946811635 2:223531398-223531420 GACCCACTGGCTTCAAGTTGGGG - Intergenic
948065724 2:235077536-235077558 GACCTACTGACTATAAATTGAGG + Intergenic
1169140723 20:3226122-3226144 GACACACTGTCTTCAACTTGGGG - Intergenic
1169307854 20:4508590-4508612 GACCAACTGGCTGTAAATTTGGG + Intergenic
1169312831 20:4561657-4561679 GATCAACTGGCTACAAATTCAGG + Intergenic
1170199984 20:13732086-13732108 GATTGACTGGCTTCAAGTTGGGG - Intronic
1170687787 20:18584997-18585019 GACCAACTGGCTACACAGTCAGG + Intronic
1172377737 20:34459093-34459115 GACCAACTGTCTACAAATTTGGG + Intronic
1172986240 20:38993155-38993177 GACTACCTGGGTTCAAATTCTGG + Intronic
1173290327 20:41709274-41709296 GATCAACTGGCTACAAACTCGGG - Intergenic
1173348500 20:42222851-42222873 GTCCAACAGGCTTCAAGTTGGGG - Intronic
1174108026 20:48176884-48176906 GACCAACTGGCTACAAATAAGGG - Intergenic
1174108107 20:48177354-48177376 GACCAACTGGCTACAAATCAAGG + Intergenic
1175012539 20:55754306-55754328 GACCAACCTCCTTCAAGTTGGGG + Intergenic
1176149069 20:63579751-63579773 GACCAATTGGCTATAAATTGAGG - Intergenic
1176305771 21:5122353-5122375 GACCAGTTGACTTCAAGTTGGGG - Intronic
1177592027 21:23183704-23183726 GACCAACTGGCTACAAATCAGGG - Intergenic
1178421142 21:32444349-32444371 GAACAACAAGCTTCAAGTTGAGG + Intronic
1178660419 21:34503164-34503186 GACCAACCAGCTACAAATTGAGG + Intergenic
1179618424 21:42596634-42596656 GACCAACTGGCTATAAATCAGGG + Intergenic
1179851287 21:44139678-44139700 GACCAATTGGCTTCAAGTTGGGG + Intronic
1181378598 22:22480927-22480949 GACTGACTGACTTCAAGTTGGGG - Intergenic
1181588507 22:23867975-23867997 GACCAACTGGCCATCAATTGGGG - Intronic
1181696926 22:24597962-24597984 GACTAACTGGCTTCTAGTTGGGG + Intronic
1183006295 22:34905471-34905493 GACCAACAAGCTTCAAGTTGGGG - Intergenic
1183304304 22:37074155-37074177 GAACATCTGGCTTCAAGTTCTGG - Intronic
1183626369 22:39005113-39005135 GACCAACAGGCTTCAAGTTGAGG - Intergenic
1184334201 22:43843879-43843901 CACCCACTGGCTATAAATTGGGG - Intronic
1185019280 22:48364450-48364472 GACCAGCTGGCTACAAAGTCGGG - Intergenic
949312254 3:2713079-2713101 GCCTGACTGGCTTCAAGTTGAGG - Intronic
949397313 3:3628817-3628839 GCCCAACTGGCTACAAATTCAGG + Intergenic
949451771 3:4193415-4193437 GATCAACTGGCTGCAAATTCAGG - Intronic
949966208 3:9358690-9358712 GACCAACAGGCTTTAAGTTGGGG + Intronic
950071369 3:10155444-10155466 GACCAACCAGCTTCAAGTTGGGG - Intergenic
950822444 3:15775547-15775569 CACCAACTGGCTATAAATTGAGG + Intronic
951266007 3:20568026-20568048 GACCAACTGGCTATAAATTGAGG + Intergenic
951348140 3:21571684-21571706 GACAAATTGGCTACAAATTTTGG + Intronic
951487627 3:23231707-23231729 GACTGACTTGCTTCAAATTAGGG + Intronic
951891955 3:27575801-27575823 GACCAACCAGCTTTAACTTGGGG + Intergenic
952377368 3:32779019-32779041 GCCCGACTGGCTTCAAATCTTGG + Intergenic
953441914 3:42925528-42925550 GAAAAACTGGCTATAAATTGGGG + Intronic
953752579 3:45620256-45620278 GAGAAACTGGCTTCAAAATCTGG + Intronic
953882438 3:46697644-46697666 GACCAACTGGCTTCACGCTGGGG - Intergenic
955400675 3:58589036-58589058 CACCATCTGGGTTCAAATTCTGG - Intronic
955955313 3:64282949-64282971 GACTGACTGGGTTCAAATTCTGG - Intronic
956183860 3:66544567-66544589 GACCAGCTGGCTTCACCTAGTGG + Intergenic
956370047 3:68549480-68549502 GACTGACTGGCTACAAACTGAGG + Intergenic
957026965 3:75193131-75193153 GACCAACCAGCTTCAAGTTGGGG + Intergenic
957050251 3:75406188-75406210 GAACAACCAGCTTCAAGTTGAGG - Intergenic
957303100 3:78419466-78419488 GACTAACTGGCTATAAATTAGGG + Intergenic
957540439 3:81562464-81562486 GACCAGCTGGGTTCAAATTCTGG + Intronic
957837539 3:85617233-85617255 GACCAACTGGCCTCAAGTTGGGG + Intronic
957997608 3:87710074-87710096 GAACCACTTGTTTCAAATTGGGG - Intergenic
959428008 3:106217478-106217500 GACCAACTGACTATAAATTTAGG + Intergenic
959971644 3:112416595-112416617 GACCAACCAGCTTCAAGTTGGGG + Intergenic
960240172 3:115331527-115331549 GACCAACCAGCTTCAAGTAGAGG - Intergenic
960803299 3:121559901-121559923 GACCCACTGGCTATAAATTTGGG + Intergenic
960865143 3:122192208-122192230 TACCACCTGGATTCAAATTCTGG + Intronic
961227417 3:125264234-125264256 GACCAACTGGCTATAAATCATGG - Intronic
961431040 3:126883283-126883305 GACCAATCGGCTTCGAGTTGGGG - Intronic
961620852 3:128223388-128223410 GACCAGCTGGCTGCAAATCCAGG - Intronic
961694227 3:128693095-128693117 GACCAATTGGCTATAAACTGGGG + Intergenic
961841689 3:129719475-129719497 GACCAACTGGCTGTAAATTGGGG - Intronic
961931935 3:130543293-130543315 GACAAACTGTCTTTTAATTGGGG + Intergenic
962326702 3:134440480-134440502 GACTGACTGGCTTCAAGTTGGGG + Intergenic
962712603 3:138100506-138100528 GACTAACTGGCTACAAATTGAGG - Intronic
962923250 3:139969793-139969815 CACCCACTGGCTCCAAATTCGGG + Intronic
963022789 3:140888042-140888064 GATCAACTGGCTACAAATTTAGG - Intergenic
963154942 3:142086404-142086426 GACCAACCAGCTATAAATTGGGG + Intronic
963192161 3:142484644-142484666 GACCAACTGGCTTCAAGTTGGGG - Intronic
963994020 3:151685541-151685563 GACCAACTGGTTTCAAACTGGGG - Intergenic
964109311 3:153072716-153072738 GACTGACTGGCTTCAAATTGGGG + Intergenic
964138555 3:153371508-153371530 GACCCACTGGCTTCAAGTTGGGG - Intergenic
964741920 3:159975331-159975353 AACTGACTGGCTACAAATTGAGG - Intergenic
964745225 3:160006065-160006087 GATCCACTGGCTACAAATTGGGG - Intergenic
964776718 3:160287294-160287316 GACCAACTGGCTGTAAATTCTGG - Intronic
964777489 3:160294105-160294127 GACCAACTGGCTAAAAATTTGGG - Intronic
964807993 3:160632431-160632453 GACAAACTGACTTTAAATTTGGG - Intergenic
966567338 3:181397649-181397671 GACTAACTGACTGTAAATTGGGG + Intergenic
966760206 3:183411086-183411108 GACCACCTGGGTTCAAATCCTGG + Intronic
967163488 3:186759790-186759812 GACCAACAGGCTTCAGGTTGGGG + Intergenic
967629021 3:191721178-191721200 GACTGACTGGCTATAAATTGGGG - Intergenic
967863406 3:194170429-194170451 GACAAGCTGGCTTTAAAATGGGG + Intergenic
969862289 4:10047010-10047032 AACCAGGTGGCTTCAAATAGCGG - Intronic
969862742 4:10050646-10050668 AACCAACTGGCTATAAATTGGGG + Intronic
971067193 4:23046400-23046422 GACCACCTGAGTTCAAATTCTGG - Intergenic
971252392 4:24984312-24984334 GACCACCTGGATTCAAATCGTGG + Intergenic
971394127 4:26213157-26213179 GACCTACTGACTTCAAGTTGGGG - Intronic
971493574 4:27240060-27240082 GAACAACTTGTTTCAATTTGAGG + Intergenic
971640517 4:29126313-29126335 GACCAACAGGTTTCAAGTTGGGG - Intergenic
972557971 4:40199499-40199521 TACCAAATGGCTTAAAATAGCGG - Intronic
972755558 4:42042300-42042322 GATCCACTGGCTTGAAATTCTGG + Intronic
972766947 4:42159933-42159955 GACCTACTGGCTTCACGTTGGGG + Intergenic
973744052 4:53946197-53946219 GACTGACTGGCTTCAAGTTGAGG - Intronic
973797964 4:54448280-54448302 GCCTAACTGGCTTCAGAATGAGG - Intergenic
974179407 4:58364334-58364356 GACCTACTGACTATAAATTGAGG - Intergenic
974816212 4:67007065-67007087 GATCAGCTGGCTTCAAATTCCGG + Intergenic
975639794 4:76488930-76488952 GACCACCTGGGCTCACATTGTGG - Intronic
975849777 4:78560317-78560339 GGCCAACTGGCTATAAATTTAGG + Intronic
975852483 4:78586953-78586975 AACCAGCTGGCTACAAATTCAGG + Intronic
976282743 4:83341316-83341338 TACCAACATGCTTCAAGTTGGGG + Intergenic
976317301 4:83672458-83672480 GATCAACTGGCTCCAAATTTGGG + Intergenic
976335528 4:83881239-83881261 GACCACCTGGGTTCACATTCCGG + Intergenic
977718384 4:100209627-100209649 GACCAACTGGCTTCAAGTTGGGG - Intergenic
978132464 4:105214932-105214954 GACCAACCAGCTTCGAGTTGGGG - Intronic
978232093 4:106412100-106412122 GACCAACTAGCTATGAATTGGGG + Intergenic
978846986 4:113285411-113285433 GACCTACTGGCTTCAAGTTGGGG + Intronic
979642429 4:123024637-123024659 GACAAACTGGCTACAAAATCTGG + Intronic
980312687 4:131154180-131154202 GACCAACCAGCTTCGAGTTGGGG + Intergenic
980809436 4:137855799-137855821 GAACAATTGGCTTCATATTCTGG + Intergenic
981483783 4:145263681-145263703 GATCAACTGGCTTCAAGCTGGGG + Intergenic
981598536 4:146456487-146456509 GACCAACTGGCTATAAATTCAGG + Intronic
981643531 4:146972735-146972757 GATCAACTGGCTATAAGTTGGGG + Intergenic
981731969 4:147909074-147909096 GGCTAACTGGCTATAAATTGGGG + Intronic
981889399 4:149717173-149717195 CAACAACTGGCTATAAATTGGGG - Intergenic
982084484 4:151819712-151819734 GACCCACTGGCTTCAACTTGGGG - Intergenic
982393616 4:154892234-154892256 GAACAACTGGTTTGAAATTCTGG + Intergenic
982486645 4:155974527-155974549 GACCAGCTGGCTACACATTTGGG - Intergenic
982664547 4:158245419-158245441 GTCCAACTGGGTTCAAATCCTGG + Intronic
982985394 4:162200427-162200449 GACCAACTGACTTCAGGTTGAGG + Intergenic
983127977 4:163978589-163978611 GACTGACTGGGTTCAAATTTGGG - Intronic
983129269 4:163995143-163995165 GAACTTCTGACTTCAAATTGGGG + Intronic
983490673 4:168385518-168385540 GACCAACTGGCTTCAAGTTGGGG - Intronic
983602751 4:169548868-169548890 GATCCACTGGCTTGAAATTCTGG - Intronic
983768609 4:171519340-171519362 GACTGACTGGCTTCAAGTTGGGG + Intergenic
983789108 4:171772654-171772676 GACCAGCTGGCTACAAATTCAGG - Intergenic
984210320 4:176839526-176839548 GACCAACTGGCTATAAATTCAGG + Intergenic
984232493 4:177115628-177115650 GACCAACCAGCTATAAATTGGGG - Intergenic
984517456 4:180758093-180758115 GACCCACTGGCTTCCAGTTGGGG - Intergenic
984595612 4:181664066-181664088 GACCATCTGGATTCCAATTCTGG + Intergenic
984744699 4:183203049-183203071 GTCTAACTGGGTTCAAATTCAGG - Intronic
984977478 4:185242421-185242443 TACCAACCAGCTTCAATTTGAGG + Intronic
985406109 4:189639793-189639815 GATCAATGGGCTTCAATTTGGGG - Intergenic
986512741 5:8525422-8525444 GACCAACTGGCTTCAAGTTGAGG - Intergenic
987203084 5:15597013-15597035 AATCAACTGGCTACAAAATGAGG - Intronic
987640004 5:20600606-20600628 GATTAAATGGCTTAAAATTGTGG - Intergenic
988099024 5:26655133-26655155 GACCAACTGGCTTCATGATGGGG + Intergenic
988400275 5:30752794-30752816 GACTGACTGGCTTCAAGTTGGGG + Intergenic
989186628 5:38632377-38632399 GATCAACCAGCTTCAAGTTGGGG - Intergenic
989624431 5:43415757-43415779 GAACAGCTGGCTCCAAGTTGGGG - Intergenic
990355484 5:54962293-54962315 GACAAACTGGCTTCAAGTTGAGG + Intergenic
990604524 5:57395499-57395521 GACTGACTGGCTTCAAGTTGGGG + Intergenic
990724740 5:58740976-58740998 GACCAGCTGTCTACAAATTTGGG + Intronic
990866686 5:60387927-60387949 GACCAACCAACTTCAAGTTGGGG + Intronic
991914211 5:71589866-71589888 GACCACCTGGCTTCAAATTCAGG - Intronic
992712722 5:79476515-79476537 GACCAACTGGCTTTGAGTTGGGG + Intronic
992927756 5:81607667-81607689 GGACAACTGGATTCAAATTTAGG - Intronic
993336843 5:86670438-86670460 GACCAACTTGCTTCAAGTTGGGG - Intergenic
993857791 5:93097429-93097451 GACCGACTGTCTTTAAGTTGGGG + Intergenic
994196207 5:96925587-96925609 GACCAACTGAATTGAAATTTCGG + Intronic
995795461 5:115936675-115936697 GACCAACTGGCTTCAAGTTGGGG - Intergenic
996092408 5:119363855-119363877 GACCAACTGGGTATAAATTGGGG + Intronic
996567295 5:124892868-124892890 GCCCAACTGGCTTCACCTAGTGG - Intergenic
996866108 5:128124419-128124441 GACCAACTGGCTATATATTGGGG + Intronic
997005764 5:129814637-129814659 GACTGACTGGTTTCAACTTGGGG + Intergenic
997016528 5:129941852-129941874 GACCAACTGGCTTCAAGCTGGGG + Intronic
997316647 5:132942184-132942206 GACCAACTGGCTAAAAATCAGGG + Intronic
997565907 5:134886270-134886292 GACCAACTGACTTCAAAGTTGGG - Intronic
998093966 5:139386909-139386931 GGCCTACTGGCTTCAAGATGAGG - Intergenic
999132883 5:149298064-149298086 GATCACCTGGGTTCAAATTCAGG - Intronic
999432404 5:151535675-151535697 GACCAACCAGCTTCAAGTTGGGG - Intronic
999652595 5:153782274-153782296 GACTATCTGGGTTCAAATTCTGG - Intronic
999837616 5:155391547-155391569 GAGCATCTGGCATCAAAATGAGG + Intergenic
1000053153 5:157579325-157579347 GACCAACTGGCTTCCAGTTGGGG + Intergenic
1000417487 5:160998157-160998179 GATCCACTGGCTTGAAATTCTGG - Intergenic
1000813555 5:165891682-165891704 GACCTACTGGCTATAAATTGGGG - Intergenic
1000982380 5:167829745-167829767 GACCAACTGGATTCTAATCCAGG - Intronic
1001217207 5:169867006-169867028 GACTGACTAGCTTCAAGTTGGGG + Intronic
1001467744 5:171983434-171983456 GACCAACTTGCTTCAAGTTGGGG - Intronic
1001612684 5:173016118-173016140 GACCAACTGGCTATAAATCGGGG - Intronic
1001835845 5:174831701-174831723 GACCAACTGGTTGCAAATTTGGG + Intergenic
1001985369 5:176070062-176070084 GGCCAACTGTCTTCAAATTGGGG - Intronic
1002124231 5:177029819-177029841 GACCAACCGGCTATAAATCGAGG - Intronic
1002231501 5:177768057-177768079 GGCCAACTGTCTTCAAATTGGGG + Intronic
1002263840 5:178015691-178015713 GGCCAACTGTCTTCAAATTGAGG - Intronic
1002288217 5:178179837-178179859 GACCAATTGGCTATACATTGGGG + Intergenic
1002295144 5:178226383-178226405 GACCGACTGGCTTCAAGTTGAGG + Intronic
1002659759 5:180783744-180783766 GACCAACTGGGTTCAAGTTGGGG - Intergenic
1002837770 6:879775-879797 GACAAACTGGCTTCAAGTTGGGG - Intergenic
1003160931 6:3633654-3633676 GCCCAGCTGGCTACAAATTCAGG - Intergenic
1003192843 6:3889419-3889441 GACCTATTAGCTTCAAGTTGGGG - Intergenic
1003352316 6:5329638-5329660 GACCAACCAGCTATAAATTGGGG + Intronic
1003400137 6:5784137-5784159 GACCCATTGGCTTCAAGTTGGGG - Intergenic
1003610886 6:7614172-7614194 GATGAACTGGCTATAAATTGGGG + Intergenic
1004687169 6:17957542-17957564 GACCTACCAGCTTCAAGTTGGGG - Intronic
1005005077 6:21279784-21279806 GGCCATCTGGCTTCATATTTTGG + Intergenic
1005194825 6:23270779-23270801 GAACAACTGGTTTCAAGTGGTGG + Intergenic
1005643730 6:27821645-27821667 GAGCAACTGGCTTCAAATCCAGG + Intergenic
1005716019 6:28549377-28549399 GACCAACCAGCTTCAAATTAGGG + Intergenic
1005746889 6:28846587-28846609 GACTGACTGGTTTCAATTTGGGG - Intergenic
1005982600 6:30847871-30847893 GACCAACTGGCTACTAATCTGGG + Intergenic
1006723806 6:36181139-36181161 GACCAATTGGCTATAAATTGAGG + Intergenic
1007118429 6:39360991-39361013 GACCACCTGGGTTCAAATCCTGG - Intronic
1007572781 6:42905274-42905296 GACTGACTGGCTACAAATTTGGG - Intergenic
1007674816 6:43584727-43584749 GAACAGCTGGCTTTAAGTTGGGG + Intronic
1007783538 6:44267521-44267543 GACCAACTGGGTTCAAAATTTGG + Intergenic
1008119331 6:47592946-47592968 GATCAATTGGCTATAAATTGGGG - Intronic
1008357137 6:50568234-50568256 AACCAATTGCCTTCAAATTGAGG + Intergenic
1008634123 6:53392492-53392514 GACTGACTGGCTTCAAGTTGGGG + Intergenic
1008738305 6:54574146-54574168 GACCAACTGGCTTCAAGTTGGGG - Intergenic
1008952492 6:57175897-57175919 GACCAACTGGCTTCAAATTGGGG - Intronic
1009276587 6:61689370-61689392 GACCGGCTGGCTACAAATTCGGG - Intronic
1009594453 6:65716565-65716587 GACCAATAAGCTTCAAGTTGGGG + Intergenic
1009927251 6:70134990-70135012 GACCAACTGGCTATAAATCGGGG + Intronic
1010238111 6:73591781-73591803 GACCTGCTGGCTTCAAGTTGAGG + Intergenic
1010382305 6:75239171-75239193 GACTGACTGGCTTTAAGTTGGGG - Intronic
1010970087 6:82253799-82253821 GACTGATTGGCTTCAAGTTGGGG - Intergenic
1011353199 6:86445730-86445752 GACTAACTGGCTGTAAATTGGGG - Intergenic
1012074248 6:94664299-94664321 GACCAAATGGCTGCAATTTCAGG + Intergenic
1012464505 6:99502419-99502441 GACCAACTGTCCACAAATTTGGG - Intronic
1012467369 6:99530552-99530574 GACCAACTAGCTGTAAATCGGGG + Intergenic
1012543512 6:100390872-100390894 GACCAACTGGCTTCCATTAATGG - Exonic
1013510509 6:110840394-110840416 GATCGACTGGCTTCAAGGTGGGG + Intronic
1013939437 6:115644367-115644389 GATCAACTGGCTTCAAGTTGGGG - Intergenic
1014074627 6:117222154-117222176 AACCAACTGGCTATAAATTAGGG + Intergenic
1014107582 6:117584392-117584414 GACTGAATGGCTTCAAGTTGGGG + Intronic
1014155041 6:118100416-118100438 GACCAGCTGGCTACCAATTTAGG + Intronic
1014679866 6:124415249-124415271 GACCAACTGACTACAAATTGGGG + Intronic
1014753693 6:125280479-125280501 GATCCACTGGCTTGAAATTCTGG + Intronic
1015593397 6:134843597-134843619 AACCTACTGGCTTCGAGTTGGGG - Intergenic
1015640659 6:135328032-135328054 GACCAACCGGCTTCAAGTTGGGG - Intronic
1016456366 6:144235017-144235039 GACCAACTGGCTACAAATTTGGG - Intergenic
1016798556 6:148144217-148144239 GACCATCTGGCTTCTGACTGGGG - Intergenic
1017141789 6:151197333-151197355 GACCAGCTGGCAACAAAGTGAGG + Intergenic
1017375718 6:153765784-153765806 GGCAAACTGGCTTTAAATTCAGG + Intergenic
1017782177 6:157724064-157724086 CACCAACTGGCTATAAAGTGGGG + Intronic
1017846071 6:158259739-158259761 GACCAACTGGCTGTAAATTTGGG + Intronic
1018047109 6:159975170-159975192 GACCAACTGGCTTCAATTTGGGG + Intronic
1018743350 6:166746666-166746688 AACCAACTGGCTATAAATAGGGG + Intronic
1018781108 6:167066427-167066449 GACCAACCAGCTTTAAGTTGAGG - Intergenic
1019678536 7:2330541-2330563 GACTGACTGGCTTCATGTTGAGG - Intronic
1019798198 7:3067711-3067733 GACAAACTGGCTACACATTCGGG - Intergenic
1020334618 7:7053069-7053091 GACTGACCGGCTTCAAGTTGGGG - Intergenic
1021097690 7:16551856-16551878 GACCAACTGGCTGTTAATTGGGG - Intronic
1021420141 7:20437708-20437730 GACCATCTGGCTCCAAATTCAGG - Intergenic
1021737344 7:23653070-23653092 GACCAATTGGCTATAAACTGGGG + Intergenic
1022485604 7:30775261-30775283 GACCAACTAGCTATAAATTGAGG + Intronic
1022987697 7:35675019-35675041 GACCAACTGGTTATAAATTGGGG - Intronic
1023040934 7:36172829-36172851 GACCAACTGGCTTCAAGTTGAGG - Intronic
1023178368 7:37456063-37456085 GAGCAACTGGGTTGAAATGGAGG - Intergenic
1023584048 7:41710346-41710368 GACTGACTGGGTTCAAATTTAGG + Intergenic
1024072649 7:45799489-45799511 GACCAACCTGTTACAAATTGGGG + Intergenic
1026912272 7:74097852-74097874 GACCGACTGGCTACAAATTCAGG + Intronic
1027355173 7:77347279-77347301 GACCAACTGTCTTTAAGTTGGGG - Intronic
1027803224 7:82782057-82782079 GACCGACTGGCTTCAAGTTGGGG - Intronic
1028003499 7:85531733-85531755 GACCAAATTGCTTTAAATTTAGG - Intergenic
1028311855 7:89348299-89348321 GACCAACTGGCAACAAATCTGGG - Intergenic
1028392853 7:90335676-90335698 GACTGACTGGCTACAAATTCAGG + Intronic
1028808081 7:95052221-95052243 TACGAACTGGCTTGAAATTTAGG + Intronic
1029189437 7:98761245-98761267 GACCCAGTGGCTTCAATTTAGGG + Intergenic
1031308252 7:120161402-120161424 GACCAACTAGCTATAAAGTGGGG + Intergenic
1031479168 7:122257546-122257568 GACCAACAGGCTTCAAACTGGGG - Intergenic
1032043903 7:128586278-128586300 AAACAACTGACTTCAAATTTTGG - Intergenic
1032109492 7:129063404-129063426 GACCAACTGGCTGCAAACTCAGG - Intergenic
1032566941 7:132956172-132956194 GGCCAACAGGCTTCAGATTCAGG - Intronic
1033067884 7:138173322-138173344 GACCAATCAGCTTCAAGTTGGGG - Intergenic
1033147784 7:138885831-138885853 GACCGACTGGCTTCAAGTTGAGG - Intronic
1034051618 7:147990041-147990063 GACCAACTGACTACAAATTTGGG + Intronic
1034191785 7:149218733-149218755 GACCAGCTGGCTACAAATTCTGG + Intronic
1034995697 7:155575903-155575925 GACCAACTTGCTACAAATCCAGG - Intergenic
1035325492 7:158063008-158063030 GCCCAACTGGCTTCACCTAGTGG - Intronic
1035875548 8:3185094-3185116 GACCAACTGGCTATAAATTTAGG - Intronic
1036427010 8:8654230-8654252 GATCAATGGGCTTCAAGTTGGGG + Intergenic
1037189238 8:16101350-16101372 GAACAAATGGCTTCAAGTTGGGG + Intergenic
1037560733 8:20072447-20072469 GGCCAACTGGCTACAAATAAGGG + Intergenic
1037736626 8:21572104-21572126 GACCAACTGGCTATAAATCAGGG - Intergenic
1038418029 8:27411870-27411892 GACCAATTGGCTACAAGTTTGGG + Intronic
1038427327 8:27472267-27472289 AACCCACTGGCTATAAATTGGGG - Intronic
1038625669 8:29190639-29190661 GACCTACTGGCTTCCAATTAGGG - Intronic
1038985283 8:32802476-32802498 GACCAGCTGGCTATAAACTGGGG + Intergenic
1039598848 8:38816525-38816547 GAGCAACTGGCTATAAATTTGGG + Intronic
1039757672 8:40540633-40540655 GACCAATTGGCTACAAATTTGGG - Intronic
1039803893 8:40982665-40982687 GACCAACCAGCTTCAAGCTGGGG - Intergenic
1041350859 8:56946639-56946661 GACTAACCAGCTTCAAATTGGGG - Intergenic
1041950507 8:63495664-63495686 GACCACCTGGCTTCAAGTTGGGG - Intergenic
1042111811 8:65389097-65389119 GATCGACTGGCTTCAAGTTGGGG - Intergenic
1042283455 8:67080615-67080637 GACCATCTGGCTATAAATTTGGG + Intronic
1042304532 8:67317291-67317313 GACCAACTGGCTACAAATTCAGG - Intronic
1042342248 8:67692790-67692812 GACCTCTTCGCTTCAAATTGGGG + Intronic
1042344672 8:67715284-67715306 GACCAACTGGCTATAAACTGGGG + Intronic
1042803406 8:72745404-72745426 GACCAACTGGCCACAAATTCAGG + Intronic
1042898051 8:73692639-73692661 GACCAACTGGCTATAAACCGGGG - Intronic
1043085015 8:75819172-75819194 GACCACCTGGCAAAAAATTGTGG - Intergenic
1043305376 8:78787194-78787216 GACCAACTGGCTGTACAATGGGG - Intronic
1043486695 8:80704918-80704940 GACCAACTGGCTATAAATCAGGG - Intronic
1043559014 8:81468949-81468971 GACCAACAGGCTTCAAGCTGGGG + Intergenic
1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG + Intergenic
1043709963 8:83403385-83403407 GACCAGCTGGCTTCACCTAGTGG - Intergenic
1043913316 8:85890327-85890349 GACCAACTGGCTCTAAATCAGGG - Intergenic
1044444983 8:92265234-92265256 GACCCACCAGCTTCAAGTTGGGG + Intergenic
1044553347 8:93536034-93536056 AACTAACTGGCTTCATGTTGGGG + Intergenic
1044581505 8:93830412-93830434 GACAGACTGGCTTCAATTTGGGG - Intergenic
1045414650 8:101953823-101953845 GACCAACTGGCTACAAATTTGGG - Intronic
1045517395 8:102872184-102872206 GACCTACAGGCTTCAAGTTGGGG + Intronic
1045991582 8:108314684-108314706 GACCCACTGGCTTCAAGTTGGGG - Intronic
1046118344 8:109812502-109812524 GTCTAACTGGCATGAAATTGAGG + Intergenic
1046190447 8:110788577-110788599 GACCACCTGGCTCCGAATTGAGG - Intergenic
1046198056 8:110888949-110888971 GACCGACTGGCTTCATGTTGGGG - Intergenic
1046845393 8:118909506-118909528 GACTGACTGGCCACAAATTGGGG - Intergenic
1047004164 8:120602545-120602567 GACTAGCTGGCTGGAAATTGTGG - Intronic
1048078347 8:131097805-131097827 GGCCACCTGGGTTCAAATTCTGG - Intergenic
1048797054 8:138160308-138160330 GAACAACTGGCTATAAATTGTGG - Intronic
1049872768 8:144993928-144993950 GACCAAAAGGATTCAAGTTGGGG - Intergenic
1049966442 9:784538-784560 GACCAACTAGCTGTAAATTGGGG + Intergenic
1051447466 9:17155663-17155685 GATCTACTGGCTTTAAATTCTGG - Intronic
1051466600 9:17385003-17385025 GACCAACTGAGTTTAAATTGGGG + Intronic
1051724193 9:20071815-20071837 GACCAATAGTCTTCAAGTTGGGG + Intergenic
1051875725 9:21791202-21791224 GACTGACTGGCTTCAAATTGGGG - Intergenic
1052787151 9:32839369-32839391 GACCAGCTGGCTACAAATCTGGG - Intergenic
1052816996 9:33109480-33109502 GACCAACCAGCTATAAATTGGGG - Intronic
1054794563 9:69288360-69288382 GACCAACCAGCTATAAATTGGGG + Intergenic
1054892757 9:70270150-70270172 GACCAACCAGCTGTAAATTGAGG + Intronic
1055042778 9:71893363-71893385 GACTAACTGGCTATAAATTGGGG + Intronic
1055185093 9:73441896-73441918 GACCAACTGGCTACAAATTGGGG + Intergenic
1055200029 9:73648162-73648184 GACTACCTGGGATCAAATTGTGG + Intergenic
1055300819 9:74879893-74879915 AACTGACTGGCTTCAAGTTGGGG - Intronic
1056625082 9:88246191-88246213 GACCAACTGGCTGTAAATCAGGG - Intergenic
1056632491 9:88305305-88305327 AACTAACTGGCTATAAATTGAGG + Intergenic
1056722837 9:89086316-89086338 GACTAACTGGCTACAAATCAGGG + Intronic
1057021280 9:91699410-91699432 GACTGACTGGCTTCAAGTTGAGG - Intronic
1057035296 9:91807530-91807552 GACCTACTGGCTTCAGGTTGGGG - Intronic
1057102802 9:92379007-92379029 GACCAACTGGCCATAAATTCTGG + Intronic
1057327335 9:94077438-94077460 GACTGACTGGCTATAAATTGGGG + Intronic
1057526818 9:95810414-95810436 GCCCAACTGACTTCAAATTGGGG + Intergenic
1057598392 9:96436325-96436347 GACCAGCTAGCTGCAAATTAGGG + Intergenic
1057614062 9:96572295-96572317 GACTGACTGGCTTCAAGTTGGGG - Intronic
1057711453 9:97449405-97449427 GACTGACCAGCTTCAAATTGGGG + Intronic
1058864990 9:109153648-109153670 GACCAACTGGCTATAAATGTGGG - Intronic
1059108252 9:111530458-111530480 GACCAACAAGATACAAATTGGGG - Intronic
1059142896 9:111870832-111870854 GACCAACTGGTTTCAATCTGAGG - Intergenic
1059206775 9:112474650-112474672 GACCAACTGGCTTCAAGTTGGGG - Intronic
1059263210 9:112999565-112999587 GACCAACTGGCTACAAGTTGAGG + Intergenic
1059308820 9:113374578-113374600 GACAGACTGGGTTCAAATTCTGG + Intronic
1060317480 9:122526289-122526311 GACAAACGGGCTTCATTTTGGGG - Intergenic
1061262869 9:129489693-129489715 GACCACCTAGGTTCAAATTCTGG + Intergenic
1061672490 9:132196865-132196887 GTCCAATTGGCTGTAAATTGGGG + Intronic
1062585901 9:137249906-137249928 GACCAACTAGCTTCAATTTGGGG - Intergenic
1062642461 9:137526646-137526668 GACCAACTGGTTACAACTTCAGG - Intronic
1186129544 X:6451830-6451852 GACCAAGTGACTTCAAGTTGTGG + Intergenic
1186143710 X:6603678-6603700 GACCAATCAGCTTCAACTTGGGG - Intergenic
1186487180 X:9942483-9942505 GACCAACCACCTTCAAGTTGGGG + Intronic
1186697047 X:12046538-12046560 GACCAACCTGCATCAAGTTGGGG + Intergenic
1187862021 X:23691935-23691957 GACTGACTGACTTCAAGTTGGGG + Intergenic
1188397279 X:29701211-29701233 GACCACTTGGTTTCAAAATGTGG + Intronic
1188597801 X:31922443-31922465 GACCCATGGGCTTCAAGTTGGGG - Intronic
1189091177 X:38084413-38084435 GACCAACTGTCTTCAATTTGGGG - Intronic
1189890816 X:45600429-45600451 GACCAACTGGCTATAAATTGGGG + Intergenic
1189948486 X:46204297-46204319 GACAGACTGGCTTTAAGTTGGGG - Intergenic
1189999934 X:46676152-46676174 GACTGCCTGGCTTCAAGTTGGGG - Intronic
1190111900 X:47595334-47595356 GACCAACTAGCTATAAATCGGGG - Intronic
1190413708 X:50161852-50161874 TACCTACCGGCTTCAAGTTGGGG + Intergenic
1190441535 X:50479869-50479891 GACCAACTGGCTACCAACTTGGG + Intergenic
1190505871 X:51125467-51125489 GATCCACTGGCTTGAAATTCTGG + Intergenic
1190633415 X:52411307-52411329 TACCAGCTGGGTCCAAATTGGGG + Intergenic
1191635699 X:63373670-63373692 GACCAACTGGCCTGAAATGGGGG + Intergenic
1191881713 X:65849159-65849181 GACAGACTGGCTACAAACTGAGG - Intergenic
1194118990 X:89937635-89937657 GATCCACTGGCTTGAAATTCTGG - Intergenic
1194811922 X:98397953-98397975 GACCAACTAGCTATAAATTCAGG - Intergenic
1194819798 X:98491408-98491430 CACCAACAGGCTTTAAATTGGGG - Intergenic
1195607069 X:106818313-106818335 GACTAACTGGGTTTAAATTCTGG - Intronic
1195799990 X:108697790-108697812 AAACAACTGGCTTCTATTTGGGG + Intergenic
1195811320 X:108833792-108833814 AACCACTTGGCTACAAATTGTGG + Intergenic
1196783703 X:119404318-119404340 GACCAACCAGCTTCAAGTTGGGG + Intronic
1196802024 X:119552355-119552377 GACCAACCAGCTTCAAGTTGGGG + Intronic
1197070553 X:122291583-122291605 GACCAACTGTCTGCAAATTGGGG - Intergenic
1197210628 X:123825437-123825459 GACTAACCGGCTTTAAGTTGGGG - Intergenic
1198409758 X:136354684-136354706 GACTAACTGACTTCAACTTGGGG + Intronic
1198503675 X:137280080-137280102 GCTCTACTGGCTTCAAAATGAGG + Intergenic
1200471866 Y:3595189-3595211 GATCCACTGGCTTGAAATTCTGG - Intergenic
1200838350 Y:7754652-7754674 GGCCAAATGGCTTCCAATTTTGG + Intergenic
1201564025 Y:15347356-15347378 GATTGACTGGCTACAAATTGGGG - Intergenic
1201891566 Y:18948491-18948513 GCCCAACCACCTTCAAATTGGGG + Intergenic