ID: 1008952493

View in Genome Browser
Species Human (GRCh38)
Location 6:57175898-57175920
Sequence TGACCAACTGGCTTCAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 3, 1: 36, 2: 134, 3: 235, 4: 490}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952493_1008952499 9 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952499 6:57175930-57175952 GAGGCCTAGACTTGCAACGGTGG 0: 1
1: 1
2: 2
3: 6
4: 44
1008952493_1008952500 12 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952500 6:57175933-57175955 GCCTAGACTTGCAACGGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1008952493_1008952504 17 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952504 6:57175938-57175960 GACTTGCAACGGTGGAGGGTGGG No data
1008952493_1008952498 6 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952493_1008952505 18 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952505 6:57175939-57175961 ACTTGCAACGGTGGAGGGTGGGG No data
1008952493_1008952507 25 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952507 6:57175946-57175968 ACGGTGGAGGGTGGGGTCTTGGG No data
1008952493_1008952503 16 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952503 6:57175937-57175959 AGACTTGCAACGGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 192
1008952493_1008952506 24 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952506 6:57175945-57175967 AACGGTGGAGGGTGGGGTCTTGG No data
1008952493_1008952502 13 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952502 6:57175934-57175956 CCTAGACTTGCAACGGTGGAGGG No data
1008952493_1008952497 -10 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952497 6:57175911-57175933 CAGTTGGTCAGAAGTTCTGGAGG 0: 16
1: 29
2: 95
3: 185
4: 443
1008952493_1008952508 26 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952508 6:57175947-57175969 CGGTGGAGGGTGGGGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952493 Original CRISPR TGACCAACTGGCTTCAAATT GGG (reversed) Intronic
900009067 1:89765-89787 TGAGAAACTTGCTTCAAATAGGG - Intergenic
900025220 1:266578-266600 TGAGAAACTTGCTTCAAATAGGG - Intergenic
900028822 1:355960-355982 TGAGAAACTTGCTTCAAATAGGG - Intergenic
900327435 1:2115633-2115655 TGACCAACTGGCTGTGAATCGGG + Intronic
900708705 1:4097154-4097176 TGACCACCTGGCTTCAAGCTGGG + Intergenic
901295914 1:8160772-8160794 TAACCAACTGGCTTGAAATATGG - Intergenic
901385195 1:8903585-8903607 TGAGTCACTGGCTTCAATTTGGG - Intergenic
902285139 1:15403404-15403426 TGACGGACAGGCTTCAAGTTGGG + Intergenic
902585164 1:17434593-17434615 TGACCAACTAGCCTCTAGTTGGG - Intronic
903102215 1:21040499-21040521 TGACTGACTGGCTTCAATTTGGG - Intronic
903341372 1:22656809-22656831 TGACCAATCAGCTTCAAGTTGGG + Intronic
903519076 1:23933836-23933858 TGACCGACTGGCTTCAAGCTGGG + Intergenic
904186834 1:28712053-28712075 TGACCAACTGGCTATAAATTGGG + Intronic
904218279 1:28942360-28942382 TGACCAACTGGCTCCAAATTGGG + Intronic
904542837 1:31245052-31245074 TGATAAACTGGCTATAAATTGGG + Intergenic
904934967 1:34123542-34123564 TGACCAATTGGCTTCAAGTTGGG - Intronic
905412067 1:37777532-37777554 AGACCAACTCGCTATAAATTGGG + Intergenic
905565592 1:38961871-38961893 TGACCAACTGGCTACAAATCTGG - Intergenic
905685989 1:39908723-39908745 TGACCAAATGACTACAAATCTGG - Intergenic
905691026 1:39942888-39942910 TGACCTACTGGCTTCAAGTGGGG + Intergenic
905764247 1:40586998-40587020 TGACCAACTGGCTATACATCAGG + Intergenic
906234176 1:44194008-44194030 TGTCCAGCTGGCTTCAAATCTGG - Intergenic
906433211 1:45772929-45772951 TGACTGACTGGCTTCAAGTTAGG - Intergenic
906482739 1:46210528-46210550 TGACCAACCAGCTTCAAATTGGG + Intronic
907983126 1:59504348-59504370 TGAACTACTGGCTTCAAGTTGGG - Intronic
908211593 1:61906046-61906068 TGACCAACTGGCTACAAACCAGG + Intronic
908505254 1:64790982-64791004 TGACCAACTAACTACAAATTTGG + Intronic
908622618 1:66001550-66001572 TCACCAACTGGATCAAAATTTGG + Intronic
909023032 1:70452978-70453000 TGACTGACTGGCTTCAAGTTGGG + Intergenic
909130068 1:71723768-71723790 TGCCCAACTGGCTACAAATAGGG - Intronic
909381741 1:75006332-75006354 TGACCAACCACCTACAAATTGGG - Intergenic
909446882 1:75757927-75757949 TGGCTGACTGGCTTCAAGTTGGG + Intronic
910163693 1:84300079-84300101 AGTCCAACTCGCTTCCAATTTGG + Intronic
910169152 1:84359202-84359224 TGACCAACTGGCTATAAATCAGG - Intronic
910327739 1:86029282-86029304 AGATCACCTGGCTTCAAATCTGG + Intronic
910881328 1:91924674-91924696 TAACCAACTGGCTTCAAGTTGGG + Intergenic
911747117 1:101452324-101452346 TGACTGACTGTCTTCAAATTGGG + Intergenic
911890961 1:103371297-103371319 TGATCAACTGGCTGCAAATTGGG - Intergenic
912261592 1:108116148-108116170 TGACTGACTGGCTATAAATTGGG - Intergenic
912667813 1:111598888-111598910 CGACCAACTGACTTCAAGTTGGG + Intronic
912913679 1:113789547-113789569 TGACCAACTGGCTTCAAGTTGGG - Intronic
913107936 1:115632050-115632072 TGGCCAACTGGCTATAAATCAGG + Intergenic
913171876 1:116240525-116240547 TCATCAACTGGCTCCAAGTTGGG - Intergenic
913237510 1:116797583-116797605 TGACCACCTGACTTCCAGTTGGG - Intergenic
914934835 1:151969141-151969163 TGACCAACTGGCTATAAATTAGG - Intergenic
915183454 1:154083457-154083479 TGACCAACTGGCCTCTAGTTGGG - Intronic
915263093 1:154693684-154693706 TGACTGACTGGCTATAAATTAGG + Intergenic
915273670 1:154773448-154773470 TGACCAAGTGGCTATAAATCAGG - Intronic
915377789 1:155412674-155412696 TGACCAACCAGCTTCAAGTTGGG - Intronic
915696984 1:157753337-157753359 TGACCAAATGGCTATAAACTGGG + Intronic
915727339 1:158027128-158027150 TGACTGGCTGGCTACAAATTGGG + Intronic
916027893 1:160850891-160850913 TGACCAACTAGCTATAAACTGGG + Intronic
916480455 1:165209815-165209837 GGATCAACTGGCTATAAATTGGG - Intronic
916769538 1:167894761-167894783 TGACCAACTACCTACAAATCTGG - Intronic
917050274 1:170914802-170914824 TGATCAGCTGGCTACAAATCTGG - Intergenic
917155307 1:171991353-171991375 TGACTGACTGGCTATAAATTGGG + Intronic
917474243 1:175354557-175354579 GGAGCAACTGGCTTGCAATTTGG + Intronic
918272266 1:182913242-182913264 TGACTGACTGACTTCAAGTTGGG - Intronic
918490234 1:185073987-185074009 TGACCAATTGGCTATAAGTTGGG + Intronic
918741554 1:188138265-188138287 TGACCAACTGACTCCAATTCAGG + Intergenic
918983509 1:191594608-191594630 TGACTAATTGCCTTAAAATTTGG - Intergenic
919829274 1:201528880-201528902 TGCCTAACTGCCTTCAAACTGGG + Intergenic
920809017 1:209264735-209264757 TGACCTAATGGCTTCAAGTTGGG - Intergenic
921295434 1:213696990-213697012 TGACCCACTGGCTATAAACTGGG + Intergenic
921525463 1:216211250-216211272 TAACCCACTGGCTATAAATTGGG - Intronic
921703583 1:218294394-218294416 TGACCAACTGACTTAAAATTGGG + Intronic
921830490 1:219723141-219723163 TGGCCAATTGGCTTCAAGTTGGG - Intronic
922032251 1:221812696-221812718 TGACCAACTGTCATTAACTTTGG - Intergenic
922173205 1:223174674-223174696 AGATCAGCTGGCTACAAATTTGG + Intergenic
922761415 1:228134216-228134238 TGACCAACTGGCTTCAAGTTGGG + Intergenic
922805273 1:228383439-228383461 TGACCAACTGGCTTTAAGTTGGG + Intergenic
922843976 1:228668361-228668383 TCATCAACTGGCTATAAATTGGG - Intergenic
922966846 1:229697628-229697650 TGACCCACCAGCTTCAAGTTGGG + Intergenic
923065052 1:230509879-230509901 TGACTCACTGGCTACAAATTCGG + Intergenic
923301292 1:232643010-232643032 TGACCAACTGGCTTCAAGCTGGG - Intergenic
923746377 1:236704519-236704541 TGACCAACCAACTTAAAATTGGG + Intronic
923804464 1:237243318-237243340 TAACCAACTGGCTTTGAGTTGGG + Intronic
923856197 1:237848075-237848097 TGATCAGCCGGCTTCAAGTTGGG + Intergenic
923863048 1:237911622-237911644 TGACCAACTCGATACAAATTTGG + Intergenic
923913529 1:238477106-238477128 TGACCAACTGGCTATAAATCAGG + Intergenic
924177718 1:241409550-241409572 TGACTAACTGCCTTCAAGCTGGG + Intergenic
924708361 1:246516200-246516222 TGCCCAACTGGCTTCCAAAGTGG + Intergenic
924855177 1:247868644-247868666 TGACCAACTGACTGTAAACTGGG + Intronic
1063355335 10:5393776-5393798 TGTCCAACTGGTTTCAAGGTGGG - Exonic
1063507925 10:6618480-6618502 TGACCAACTGGCATCAAGTCAGG - Intergenic
1063906972 10:10790899-10790921 AGATCACCTGGCTTCAAATTTGG + Intergenic
1064065080 10:12174754-12174776 TGACCAACTGGCTTAGGCTTGGG + Intronic
1064655518 10:17551771-17551793 TGACCGACCGGCTTCAATTTGGG - Intergenic
1065034412 10:21622888-21622910 TCACCAACTGGTTATAAATTGGG + Intronic
1065053643 10:21820711-21820733 TGACCAACTGGTTTCAAGTTGGG + Intronic
1065208092 10:23375885-23375907 TGACAAACCAGCTTCAAGTTGGG - Intergenic
1065221441 10:23500002-23500024 TGATGAACTGGCTTAAAGTTTGG - Intergenic
1065545009 10:26810048-26810070 TGGCCAACTAGCTACAAATCTGG - Intronic
1065990669 10:31006606-31006628 TGACCAACCTGCTATAAATTGGG - Intronic
1067137482 10:43624273-43624295 TGACCCACCAGCTTCAAGTTGGG + Intergenic
1067315841 10:45161193-45161215 TAACCAGCTGGTTTCAAGTTGGG - Intergenic
1068459337 10:57306782-57306804 TGACCAACCAGCTTCAAGTTGGG + Intergenic
1068512422 10:57983683-57983705 TGGCCATCTGGCTACAAATATGG - Intergenic
1068530423 10:58179948-58179970 TGACCAACTGGTTACAAATCTGG + Intergenic
1068758664 10:60682924-60682946 TGAGCAACTGGCTTCAAGTTGGG - Intronic
1068889977 10:62138481-62138503 TGATCAAATGGCTACAGATTTGG - Intergenic
1069125838 10:64631828-64631850 TAACCAACTGGGTTAATATTAGG - Intergenic
1069176784 10:65300143-65300165 TGACCAACTGGCTTCACATTGGG - Intergenic
1069576495 10:69533723-69533745 TGACCAACTGACTATAAATTGGG - Intergenic
1070892378 10:79951392-79951414 TGATCATTTGGCTTCAATTTTGG + Intronic
1071664840 10:87544136-87544158 TGACTGACTGGCTTCAAGTTGGG + Intronic
1071849770 10:89557060-89557082 TGACCAATCAGCTTCAAGTTGGG - Intergenic
1072098716 10:92208531-92208553 TGCCCAACTTCCTTAAAATTTGG - Intronic
1072464201 10:95648065-95648087 TGACTGACTGGCTTCAAGTTGGG - Intronic
1073148298 10:101294683-101294705 TGCCCAAGTGCCTTCAATTTAGG - Intergenic
1073160858 10:101393365-101393387 TGACTGACTGGCTTCAAGTTGGG - Intronic
1073498382 10:103914941-103914963 TGACCAACTGGTTATAAATTTGG + Intronic
1074265105 10:111893857-111893879 TGACCAGCTGGCTTCAAATTTGG - Intergenic
1075195666 10:120356703-120356725 TAAGCAATTGGCTTCAAATAAGG + Intergenic
1075940191 10:126384967-126384989 TGACCAACTAGCTATAAGTTGGG + Intronic
1077083857 11:737769-737791 TCACCAAATGGCATTAAATTGGG + Intergenic
1077086224 11:752827-752849 TGATCCACTGGCTTCAACTTGGG - Intronic
1079187870 11:18253709-18253731 TGACTGACTGGCTTCAAGTTGGG - Intergenic
1080244384 11:30163262-30163284 TGCCTGACTGGCTTCAAGTTGGG - Intergenic
1081018733 11:37915938-37915960 TAACCAACTGGCTATAAATCTGG - Intergenic
1081150015 11:39616455-39616477 TGACCAACTGGCTATAAATGAGG - Intergenic
1081322960 11:41713777-41713799 TGACCGACTGGCATTAAATTGGG + Intergenic
1081471037 11:43371345-43371367 TAACCAACCAGCTTCAAGTTGGG + Intronic
1082632888 11:55561641-55561663 TGAGAAACTGGTTTGAAATTGGG - Intergenic
1083006391 11:59350832-59350854 CAACCAACTGGCTTCATTTTTGG + Intergenic
1083286459 11:61662312-61662334 TGACCGACTGGTTTCAAGTTGGG - Intergenic
1083810829 11:65105762-65105784 TGACCAACTGGCTCCAGGTAGGG + Intronic
1085012618 11:73151886-73151908 TTGCCAACTGGCTTCCACTTCGG + Intergenic
1085354396 11:75822557-75822579 TTACCGACTGGCTATAAATTGGG + Intronic
1085488605 11:76891579-76891601 TGACCAACTGGCTTCAAGTTGGG - Intronic
1086575158 11:88331317-88331339 TGATGGACTGGCTTCAAATTGGG + Intronic
1086734043 11:90283693-90283715 TGCCCCACTGGCTTCAAGGTTGG + Intergenic
1087023739 11:93629195-93629217 TGACCAATGGTCTTCAAGTTGGG - Intergenic
1087349615 11:97015102-97015124 CGACCAACTGGCTACAAATTTGG + Intergenic
1087362462 11:97178109-97178131 TGACAAACTGGCTATACATTGGG + Intergenic
1087933149 11:104001474-104001496 TGACCAATTGGTTATAAATTTGG - Intronic
1088205100 11:107383186-107383208 TGACCACCCAGCTTCAAGTTGGG - Intronic
1089186848 11:116623325-116623347 TGGCCAACTGTCTTCAAGCTGGG - Intergenic
1089532959 11:119143525-119143547 TGACCAACTGGCTATAAATCAGG - Intergenic
1089970555 11:122689739-122689761 TCACTAACTGCCTTCAAGTTGGG + Intronic
1090037048 11:123258274-123258296 TGACCAATTGGCTTCAAATCTGG + Intergenic
1090706024 11:129337696-129337718 TGATCAACTGGCTATAAATCAGG + Intergenic
1090742201 11:129674565-129674587 TGACCAACTAGCTATAAAATTGG - Intergenic
1090981714 11:131728285-131728307 TGACCAACCTGCTACAAATCAGG + Intronic
1091116506 11:133018546-133018568 TGGCCATCTGGCTTCAAAAGGGG - Intronic
1091577205 12:1748995-1749017 TGACCAACCAGCTTCAAGTTGGG + Intronic
1092177105 12:6417573-6417595 TGATCAACTGGCTTCAAGTTGGG + Intergenic
1092395193 12:8119863-8119885 TGATCAACTGACTACAAATTTGG + Intergenic
1092470148 12:8770853-8770875 TGACCAACTGGCTTCAAGTTGGG + Intronic
1092495063 12:8985555-8985577 TGACCAATAAGCTTCAAGTTGGG + Intronic
1092502509 12:9063320-9063342 TGACCAACTGGCCTGAAATGGGG + Intergenic
1092546551 12:9457083-9457105 TGACCCACCAGCTTCAAGTTGGG + Intergenic
1092612192 12:10184367-10184389 TGACCTACTGGTTATAAATTGGG - Intronic
1093654099 12:21675241-21675263 TGAGCAACTGGCTATAAATCAGG - Intronic
1093703200 12:22246108-22246130 TGACTGACTGGCTTCAAGTTGGG - Intronic
1093708181 12:22298277-22298299 TGACTGACTGGCTATAAATTGGG - Intronic
1093927197 12:24920786-24920808 TGACCAACAGGTTTCAAGTTGGG + Intronic
1093942217 12:25067524-25067546 TGACCAACTCTCTATAAATTGGG + Intronic
1093971244 12:25377988-25378010 TGACTCACTGGTTTCTAATTTGG - Intergenic
1094506391 12:31064999-31065021 TGACCCACCAGCTTCAAGTTGGG - Intergenic
1095043690 12:37474410-37474432 TGACCTACTGGCTTCAAGTTGGG + Intergenic
1095861577 12:46923740-46923762 TAACCAACTGGCGATAAATTGGG + Intergenic
1096127143 12:49128253-49128275 TGCCCCACTGGCTTCAAGGTTGG - Exonic
1096134095 12:49185305-49185327 TGCCCCACTGGCTTCAAGGTTGG - Exonic
1096145044 12:49272916-49272938 TGCCCCACTGGCTTCAAGGTTGG + Exonic
1097729854 12:63116265-63116287 TGACTGACTGGCTTCAAGCTGGG + Intergenic
1097798118 12:63885209-63885231 TGACCAACCAGATTCAACTTGGG + Intronic
1098132255 12:67362970-67362992 TGACCAACTGGCTATAAATCAGG - Intergenic
1098296700 12:69011353-69011375 TGACTGACCGGCTTCAAGTTGGG + Intergenic
1098493266 12:71106735-71106757 TGACCAACTGGCTATAAATTAGG - Intronic
1099371041 12:81829991-81830013 TGACCAAGTGGCTTCAATTTGGG - Intergenic
1100187884 12:92157073-92157095 TGGTCTACTGGCTTCAAGTTGGG - Intergenic
1100615142 12:96225679-96225701 GGACCAGCTGGGTTCAAATCCGG - Intronic
1100705453 12:97195696-97195718 TGACCAACTGGCTATAAATCAGG - Intergenic
1100836626 12:98572712-98572734 TGACCAACTGGCTTCAAGTTGGG + Intergenic
1101419502 12:104538221-104538243 TGACCAACATGCCTCAAAATGGG - Intronic
1101462669 12:104912710-104912732 TGACCAACTGGCTTTAAGCTGGG - Intronic
1101582129 12:106050857-106050879 TGACCAAGTGGCTTCAAGTTGGG + Intergenic
1101772821 12:107767266-107767288 TGACCAATTGGCTTCAAATTGGG + Intergenic
1102489577 12:113281885-113281907 TCACCAACTGGATACACATTTGG + Intronic
1102840623 12:116116604-116116626 TGACCAATTGGCTATAAATCTGG - Intronic
1103286904 12:119810113-119810135 TCGCTGACTGGCTTCAAATTGGG - Intronic
1105923211 13:24984058-24984080 TGACCCATTGGCTTCAAGTTGGG - Intergenic
1106324953 13:28680182-28680204 TGACCGACTGGTTGCAAATTGGG + Intergenic
1106427934 13:29650895-29650917 TGACCAACTAGCTATAAATCAGG - Intergenic
1106937105 13:34735072-34735094 TGACCAACTGTTTAAAAATTTGG - Intergenic
1107018790 13:35730856-35730878 CTACCAACTGGCTTCAAGTTGGG + Intergenic
1107332549 13:39317314-39317336 TGACCAACTGGCTACAAATTTGG - Intergenic
1107360030 13:39607769-39607791 TGACAAACTGGCTTCAAATTGGG - Intergenic
1107655956 13:42592289-42592311 TGACCAACCAGCTACAAATCGGG + Intronic
1108086927 13:46803519-46803541 TGACCTACCTGCTTCAAGTTGGG + Intergenic
1108151792 13:47543539-47543561 AGACCAACAGTCCTCAAATTAGG + Intergenic
1108233032 13:48370466-48370488 TGACCAAAGGGCTTCAAGTTGGG + Intronic
1108239131 13:48444150-48444172 TGACCTACTGGCTTCAAATTGGG + Intronic
1108252778 13:48583449-48583471 TGACCTACTGGCTACAAATTGGG + Intergenic
1108830718 13:54475021-54475043 TGACCTACTGGTTTCAAGGTGGG + Intergenic
1109459572 13:62638457-62638479 TGACCCACTGGTTTCAAGTTGGG + Intergenic
1109560815 13:64047776-64047798 TGACAGACTGGCTTCAAGTTGGG + Intergenic
1110647659 13:77906911-77906933 AGACCATCTGGGTTCAAATGTGG - Intronic
1111005674 13:82245023-82245045 TGAACTACTGGCTTCAGATCTGG + Intergenic
1111094550 13:83495850-83495872 TTACTCTCTGGCTTCAAATTTGG + Intergenic
1111245136 13:85527711-85527733 AGATCAACTTGCTTCAAAATAGG + Intergenic
1111509397 13:89241674-89241696 TGACCAACTGGCTTCAAGTTGGG + Intergenic
1111706886 13:91761524-91761546 TGACCAACTGGCTTCAAGTTGGG + Intronic
1111812473 13:93108036-93108058 TGACCAAATGGCTACAAATTGGG - Intergenic
1112498405 13:99923402-99923424 TTACCACCTGTCTTCAAATAGGG + Intergenic
1112592451 13:100776155-100776177 TGACTGACAGGCTTCAAGTTGGG + Intergenic
1113272126 13:108685327-108685349 TGACCAACCAGCTACAAATTGGG - Intronic
1114043151 14:18698171-18698193 TGACCAAATGGCATCCAACTAGG + Intergenic
1114047441 14:18888616-18888638 TGACCAAATGGCATCCAACTAGG + Intergenic
1114116773 14:19630792-19630814 TGACCAAATGGCATCCAACTAGG - Intergenic
1114596662 14:23918066-23918088 TGACCAAGTGGCTACAAATTTGG - Intergenic
1116847760 14:49880673-49880695 TGACCCACTGGCTATAAATCAGG + Intergenic
1117272928 14:54163455-54163477 TGACCAGCTGACTACAAATTGGG + Intergenic
1117353990 14:54906078-54906100 TGATTGACTGGCTTCAAGTTGGG - Intergenic
1118830416 14:69426276-69426298 TGACCAACTGGCTTCAAGTTGGG + Intronic
1118834186 14:69464550-69464572 TGACTAGCTGGCTGCAAATTTGG + Intergenic
1118955035 14:70473225-70473247 TGATCAACAAGCTTCAATTTGGG + Intergenic
1119127087 14:72137517-72137539 TGAGCAACTGGCCATAAATTGGG + Intronic
1119308512 14:73627442-73627464 TGACTAACTGGCTTCACGTTGGG + Intergenic
1119340314 14:73871541-73871563 TGACAAACTGGCTATAAATCAGG - Intronic
1119653763 14:76402045-76402067 TGCCCAATGGCCTTCAAATTGGG - Intronic
1119844258 14:77816741-77816763 TGACCAACCAGCTTCAAGCTGGG - Intronic
1119922570 14:78459978-78460000 TGACCAACTGGCTATAAATCGGG + Intronic
1120163336 14:81168685-81168707 TGACCAATCAGCTTCAAGTTGGG - Intergenic
1120171953 14:81255037-81255059 TGACCAACTGGTTATAAATAGGG - Intergenic
1120513025 14:85438437-85438459 TGACCAACTGGCTTCCAGTTGGG - Intergenic
1121359741 14:93245789-93245811 TCAGTAACTTGCTTCAAATTCGG - Intronic
1121440859 14:93948266-93948288 AGACCATCTGGGTTCAAGTTTGG - Intronic
1121458745 14:94056670-94056692 TGACCAACCAGCTTCAAGTTGGG - Intronic
1122554265 14:102568608-102568630 TGACCTACAAGCTTCAAGTTGGG + Intergenic
1122584598 14:102796468-102796490 TGACCCACCAGCTTCAAGTTGGG - Intronic
1123159310 14:106262628-106262650 TGACCAACTGGATTTTCATTAGG - Intergenic
1202847317 14_GL000009v2_random:191639-191661 TGACCAACTGTCTATAAATTAGG + Intergenic
1202916782 14_GL000194v1_random:182196-182218 TGACCAACTGGCTATAAATTAGG + Intergenic
1202876009 14_KI270722v1_random:1000-1022 TGACCAACTGGCTATAAATTAGG - Intergenic
1123479763 15:20620241-20620263 TAATCAACTGGCTTCAAGCTGGG - Intergenic
1123638243 15:22380123-22380145 TAATCAACTGGCTTCAAGCTGGG + Intergenic
1124038190 15:26076208-26076230 TGACCAGCTGGCTCCTGATTAGG + Intergenic
1124141670 15:27082540-27082562 TGCCCAAGTGGCTTCTAATCAGG - Intronic
1124183744 15:27502659-27502681 TGACCAACGGGCTTCAAGTTGGG + Intronic
1124391491 15:29262751-29262773 TGACCAATGGTCTTCAAGTTGGG - Intronic
1124434320 15:29634719-29634741 TGCCTGACTGGCTTCAAGTTGGG + Intergenic
1124530773 15:30503742-30503764 TGACCAACTGGCTACAAAGCTGG - Intergenic
1124767887 15:32503953-32503975 TGACCAACTGGCTACAAAGCTGG + Intergenic
1124836330 15:33199120-33199142 TGACCAACCAGCTTCAAGCTGGG - Intergenic
1124956680 15:34364910-34364932 TGAAGAACTGGCCTCAAAGTGGG - Intronic
1125378540 15:39060569-39060591 TGACCAACTGGCTATAAATCAGG - Intergenic
1125648299 15:41291907-41291929 CGACCAAGTGGCTACAGATTTGG + Intergenic
1125756055 15:42065715-42065737 AGACCAGCTGGCTGCAAATTTGG + Intergenic
1126187010 15:45840698-45840720 TGACCAATTGGCTATAAACTGGG + Intergenic
1126291192 15:47081450-47081472 TGACCTACTGGCTTCAAGTTGGG - Intergenic
1126313133 15:47339274-47339296 TGAGTAACTGGCTTCAAGCTGGG - Intronic
1126506043 15:49405976-49405998 TAACCAACTGGCTTCATTTCTGG + Intronic
1126545194 15:49865456-49865478 TGGCCAGCTGGCTATAAATTGGG - Intronic
1127029366 15:54844946-54844968 TGACTAACTGGCTACAAGTTGGG + Intergenic
1127533245 15:59865423-59865445 TGACCAACTGGCTTCAAGTTGGG - Intergenic
1127787768 15:62371435-62371457 TGACCAACTGGCTTCAAGTTGGG + Intergenic
1127890489 15:63246363-63246385 TGACCAACTGGCTATAAATTGGG + Intronic
1128073462 15:64811551-64811573 TGACCGACTGGCTTCAAGTTGGG - Intergenic
1128286673 15:66442803-66442825 TGACTGACTGGCTTTAAGTTGGG + Intronic
1128461208 15:67869123-67869145 GGACCAACTGACTTCAAGTTGGG - Intergenic
1128465823 15:67910238-67910260 TGATTAACTGGCTACAAAGTTGG - Intergenic
1128571840 15:68739306-68739328 TGACCAACTGGCTGTAAATCAGG - Intergenic
1128624494 15:69185890-69185912 TGACCAACTGGTTTCAAGTTGGG + Intronic
1128825329 15:70710602-70710624 TGACCAACTGCCTGTAAATCAGG + Intronic
1128864628 15:71105213-71105235 TGACCAACCAGCTGCAAATTGGG + Intronic
1129064490 15:72889607-72889629 TGATCACCTGGCTTCAAGTTGGG - Intergenic
1129197270 15:73976306-73976328 TGGCCAACTGGCTATAAATCAGG - Intergenic
1129579642 15:76793780-76793802 TGACCAACTAGCTATAAATCAGG - Intronic
1130074345 15:80675845-80675867 TGACTGACTGGCTATAAATTGGG - Intergenic
1130127173 15:81103737-81103759 TGACCTTCTGGCTTCAAGTTGGG - Intronic
1130160589 15:81395231-81395253 TGACCAGCTTGCTACAAATTTGG - Intergenic
1130303192 15:82695753-82695775 TGACCAACTGGCTATAAATCAGG - Intronic
1130740231 15:86591457-86591479 TGACCCACTGGCTTGAAGTTGGG + Intronic
1130854351 15:87828019-87828041 TGTCCAATTTGCTTCAAATGTGG - Intergenic
1131206684 15:90454933-90454955 TGAACAACTGGCTGCAAATTTGG + Intronic
1131353340 15:91721702-91721724 TGACCAACCAGCTTCAAGTTGGG + Intergenic
1131353512 15:91723213-91723235 TGACCCACTGGCTATAAATCAGG + Intergenic
1131581932 15:93651891-93651913 AGAGCAGCTGGCTACAAATTAGG - Intergenic
1131640005 15:94282770-94282792 TAGCCAACTGGCTTCATTTTTGG + Intronic
1131696588 15:94883122-94883144 TGACCAACCAGCTTCAAGTATGG - Intergenic
1131698233 15:94903531-94903553 TGACCAACTAGCTAAGAATTGGG - Intergenic
1131709228 15:95034684-95034706 TGGCCAACTGGCTTCAAATTGGG - Intergenic
1131835683 15:96388397-96388419 TGTCCCACTGGCTTCAAGGTTGG - Intergenic
1131901235 15:97089958-97089980 TGACCATCTGGCCTCAAATCTGG + Intergenic
1132425236 15:101710393-101710415 TGACCTACAGGCTACAAATCGGG - Intronic
1132920187 16:2385214-2385236 TGACAAACTGGCTGCAATTGTGG + Intergenic
1133867659 16:9659207-9659229 TGACCAACCAGCTATAAATTAGG + Intergenic
1134164652 16:11920380-11920402 TGACCAACTGGCTATGAATTGGG + Intergenic
1134485031 16:14651211-14651233 TGACCCACCAGCTTCAAGTTGGG + Intronic
1134755087 16:16660075-16660097 TGACCAACTGGCTATAAATTAGG + Intergenic
1134804691 16:17114295-17114317 TGACCAAATGGTTTCAAACTGGG - Intronic
1134990976 16:18699098-18699120 TGACCAACTGGCTATAAATTAGG - Intergenic
1135082961 16:19452109-19452131 TGACCAACCAGCTTCAAGTTGGG + Intronic
1135116479 16:19728010-19728032 TAACCAGCTGACTTTAAATTAGG + Intronic
1135256768 16:20947456-20947478 TGACCAACCAGCTTCACGTTGGG - Intronic
1135304345 16:21355642-21355664 TGACCACATAGCTTCAAATCAGG - Intergenic
1135955994 16:26956627-26956649 TGACCAACTGGCTTCAAGCTGGG + Intergenic
1136181743 16:28557566-28557588 TGACCAACTGACTATAAATCAGG - Intronic
1136301089 16:29334772-29334794 TGACCACATAGCTTCAAATCAGG - Intergenic
1136423256 16:30150848-30150870 TGACCGACTGGCTTCAAATTGGG + Intergenic
1137697634 16:50472620-50472642 TAACTAACTGGCTTCAGGTTGGG - Intergenic
1137997363 16:53233194-53233216 TGACTGACTGGCTTCAAGTTAGG + Intronic
1138216903 16:55212513-55212535 TGACCAACTGGCTAGAAATCAGG + Intergenic
1139077343 16:63467758-63467780 TGAGCAAGTGGTTTGAAATTAGG + Intergenic
1140389502 16:74572820-74572842 TGACCAACCTGCTATAAATTGGG - Intronic
1140765097 16:78150107-78150129 TGACTCACTGGCTACAAATTGGG + Intronic
1140916121 16:79494829-79494851 TGACAAACTGGCTATAAATTGGG + Intergenic
1141029838 16:80578135-80578157 ACACCAACAGGCTTCAACTTTGG + Intergenic
1141194139 16:81847082-81847104 TGACTGACTGGCTATAAATTGGG + Intronic
1142062791 16:88041509-88041531 TGACCACATAGCTTCAAATCAGG - Intronic
1142063877 16:88049203-88049225 TGGCCAACCGGCTTCAGGTTGGG + Intronic
1142295137 16:89216571-89216593 TTACCCACAGGCTTCGAATTGGG - Intergenic
1142455269 16:90217196-90217218 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1143009635 17:3858836-3858858 TGTCCCACCGGCTTCAAGTTGGG - Intergenic
1143204870 17:5134420-5134442 TGCCCAACTGGCTGCCAATGTGG - Intronic
1143240614 17:5439967-5439989 CGACCAACCCGCTTCAAGTTGGG - Intronic
1144106631 17:11992158-11992180 TGACAAATTGGCTATAAATTCGG - Intronic
1144941604 17:18946155-18946177 TGACCCACAAGCTTCAAGTTGGG + Intergenic
1145081080 17:19894877-19894899 TGACCAACTGGCTATTTATTGGG - Intergenic
1145099816 17:20065359-20065381 TGACCAACTGGCTTCAAGTTGGG + Intronic
1145257528 17:21335008-21335030 TGGCCAACTAGCTTGAAATTGGG + Intergenic
1145285114 17:21499921-21499943 TGCCCAACTGGCTGCAAATCAGG + Intergenic
1145319112 17:21753027-21753049 TGGCCAACTAGCTTGAAATTGGG - Intergenic
1145392413 17:22465826-22465848 TGCCCAACTGGCTGCAAATCAGG - Intergenic
1146138886 17:30347541-30347563 TGACAAACTGCCTATAAATTAGG - Intergenic
1146809786 17:35894009-35894031 TGACCAGCTGGCTTCAAGTTGGG + Intergenic
1147230845 17:39016669-39016691 TGGCCAACAGGCTTCAAGTTAGG - Intergenic
1147738375 17:42655394-42655416 TGACCAGCAGGCTTTAAGTTGGG - Intergenic
1147893419 17:43733667-43733689 TGATCAACTGGCTACAAATTTGG - Intergenic
1148132369 17:45269908-45269930 TGACCAACTGGCTATAAGTCAGG - Intronic
1148184392 17:45631166-45631188 TGGCCAGATGGCTACAAATTTGG + Intergenic
1148378031 17:47167886-47167908 TGATCAACTAGCTATAAATTGGG + Intronic
1149268228 17:54951102-54951124 GGACTGACTGGCTTCAAGTTGGG + Intronic
1149347657 17:55754269-55754291 TGACCAACTGGCTGTAAATAGGG + Intronic
1149457187 17:56797446-56797468 TGGCCAGCTGGCTTCTGATTGGG - Intronic
1149727700 17:58913137-58913159 TGACCAACTCACTATAAATTAGG - Intronic
1150430419 17:65111359-65111381 TGGGCAACTGGTTACAAATTGGG + Intergenic
1150630853 17:66879502-66879524 TGACCAATTAGCTCCAAATATGG + Intronic
1150762416 17:67974574-67974596 TGACCATCTGGCTATAAATCAGG + Intronic
1151498824 17:74475792-74475814 TGACCAACTGGATGCAAATTTGG + Intronic
1151607081 17:75144636-75144658 TGACCGACTGGCTTCAAATTGGG - Intronic
1152051291 17:77980699-77980721 TGACCCACTAGCTTCAAGTTGGG + Intergenic
1152413460 17:80143376-80143398 TGACCAAGCAGCTTCAAGTTGGG - Intronic
1152852020 17:82642553-82642575 AGACTGACTGGCTTCAAGTTGGG - Intronic
1152950936 17:83230597-83230619 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1153118683 18:1692947-1692969 TGAACAACTGGTCTCAGATTGGG + Intergenic
1153282190 18:3425022-3425044 TGACCAACTGGCTATACATCAGG - Intronic
1153415164 18:4838337-4838359 TGACCAACTGACTTCAAGTTGGG + Intergenic
1153503392 18:5770968-5770990 TAACCAACTGGCTTCAAGTTGGG + Intergenic
1153640192 18:7150128-7150150 TGACCAGCTGGCTGCAAATTTGG + Intergenic
1153827693 18:8891590-8891612 TGACCAACTGGTTACAAGTTCGG - Intergenic
1153837409 18:8976411-8976433 TGACCAACTGGCCACAAATTCGG + Intergenic
1153926676 18:9840779-9840801 TGCCCAACAGACTACAAATTTGG + Intronic
1154334858 18:13457164-13457186 TGACCGACTGGCTTCAGGTTGGG + Intronic
1154476842 18:14768432-14768454 TAACCAGCTGGTTTCAAGTTGGG - Intronic
1155409925 18:25532703-25532725 TTACTAACAGGCTTCAACTTGGG + Intergenic
1156646356 18:39166479-39166501 TGACCAACTGGCTGTAAATTGGG - Intergenic
1156962620 18:43051014-43051036 TGACCAACTGGCTTCACGTTGGG - Intronic
1157807343 18:50667977-50667999 TGATGGACTGGCTTCAAGTTGGG + Intronic
1157959014 18:52131742-52131764 TGACTGACTGGCTTCAAGTTGGG + Intergenic
1157981620 18:52388158-52388180 TCACCAACTTGCTTCATGTTAGG + Intronic
1158573539 18:58616841-58616863 TGACTGACTGGCTTCAAGTTGGG - Intronic
1158889865 18:61862798-61862820 TGACCCACCAGCTTCAAGTTGGG - Intronic
1158927170 18:62279368-62279390 TGACCAACAGGGTACAAACTGGG - Intronic
1159017673 18:63114917-63114939 TGACCAACAAGCTTCAAGTTGGG - Intergenic
1159587878 18:70299271-70299293 TGACCGACTGGCTACAAATCAGG + Intronic
1160104510 18:75959908-75959930 TAACCAACTGGTTTGAAAATGGG - Intergenic
1160418587 18:78728683-78728705 TGACCAACCAGCTTCAAATTGGG - Intergenic
1161823519 19:6546159-6546181 TGACTGATTGGCTTCAAGTTGGG + Intergenic
1161909088 19:7179278-7179300 TGACTAACTGGCTCTAAATTGGG - Intronic
1162881310 19:13661763-13661785 TGACCAACTGGCTTCCTAAATGG - Intergenic
1163584617 19:18157052-18157074 TGACCAACTGGTTTCAAGTACGG - Intronic
1164538133 19:29101917-29101939 TGACCAATTGGCTTCAAGTTGGG - Intergenic
1164717596 19:30404891-30404913 TGACCAACAGGCTTCACGTTGGG + Intronic
1164718005 19:30407561-30407583 TGACCAACAGGCTTCACTTTGGG + Intronic
1165038900 19:33054946-33054968 TGACCAACAGTCTTCAACTGTGG - Intronic
1165366091 19:35366079-35366101 TGATCAACTGGCTTCATTTCTGG - Intergenic
1165582828 19:36883961-36883983 AGACCAGCTGACTACAAATTTGG + Intronic
1165985905 19:39768685-39768707 TGACCAACTGGCTATAAATTGGG + Intergenic
1166614650 19:44232399-44232421 TGACCAAGTAGCTACAAATTTGG + Intronic
1166632360 19:44418339-44418361 TGACCAACTGGGTATAAATCAGG + Intronic
1166634579 19:44438974-44438996 TGACCAACCAGCTGCAAGTTGGG - Intronic
1167751322 19:51382067-51382089 TGATCCACTGGCTACAAACTAGG - Intronic
1167881044 19:52457507-52457529 TGACCACCCAGCTTCAAACTGGG - Intronic
1168125968 19:54283091-54283113 TGACTGACTGGCTTCAAGTTGGG - Intergenic
1168171307 19:54591697-54591719 TGACTGACTGGCTTCAAGTTGGG + Intronic
1168176005 19:54628462-54628484 TGACTGACTGGCTTCAAGTTGGG + Intronic
1168573112 19:57487012-57487034 TGAGGAACTGGCTTTATATTTGG + Intergenic
1202674652 1_KI270710v1_random:31810-31832 TGACCAACTGGCTATAAATTAGG + Intergenic
926007563 2:9384530-9384552 TGACCAACCGGCTTCAAGTTGGG + Intronic
926022977 2:9513412-9513434 TGACCAACTGGCTTCAAGTTGGG - Intronic
927666858 2:25038893-25038915 TGACCAACTGGCTTCAAGTTGGG + Intergenic
928330788 2:30356454-30356476 TGACCAACCGGCTATAAATTGGG + Intergenic
928444691 2:31322563-31322585 TGGCCAACTGGCTATAAATAGGG - Intergenic
928491307 2:31786116-31786138 TGACTTACTGGCTATAAATTGGG - Intergenic
929983743 2:46705225-46705247 TGACCAACCGGCTATAAACTGGG - Intronic
930085738 2:47495842-47495864 TGCCCAACTGACTATAAATTTGG + Intronic
930590043 2:53316210-53316232 TGCTCCACTGACTTCAAATTTGG - Intergenic
931438993 2:62274029-62274051 TGACCAACTGGCCATAAATTGGG - Intergenic
931562376 2:63576290-63576312 TGACCAACTGGCTATATATCAGG + Intronic
931613049 2:64124909-64124931 TGACCAACTAGCTATAAATTGGG + Intronic
932014574 2:68011425-68011447 AGACCAACTGACTTCAAGTCAGG + Intergenic
932047281 2:68362483-68362505 TGACCAAGTGACTTCTAATTTGG - Intergenic
932093906 2:68830058-68830080 TGAAAAACTGGCATCATATTAGG - Intergenic
932651872 2:73566779-73566801 TGACCAACTAGCTCCAAATTGGG + Intronic
932844183 2:75118092-75118114 TTTCCATCTGGTTTCAAATTTGG + Intronic
932969175 2:76517568-76517590 TGACCAACTGCATATAAATTTGG - Intergenic
933264389 2:80166653-80166675 TGATCAACTGGCTATAAATCAGG - Intronic
933281874 2:80340877-80340899 TGACCGACTGTCTATAAATTGGG + Intronic
933553807 2:83807698-83807720 TGACTGACCAGCTTCAAATTGGG + Intergenic
933725846 2:85426799-85426821 TGACCAACTGGCTTCAAGCTGGG - Intronic
935242388 2:101189997-101190019 TGACCAACTGGCTTCAAGTTGGG - Intronic
935398938 2:102640444-102640466 TGACCAGCTGGCTACAAACTGGG + Intronic
935695607 2:105768470-105768492 TGATCAACTGGCTGTAAATTGGG + Intronic
936002804 2:108851030-108851052 TGACCAACTGGCTTCAAATTGGG + Intronic
936229447 2:110687276-110687298 TGACCAACTGGCCACTAAATTGG + Intergenic
936292606 2:111238060-111238082 TGACCATCTGGTTTCAAGGTGGG + Intergenic
937156251 2:119721535-119721557 TGACCAGCTGGCTACAAATCTGG - Intergenic
937205145 2:120231602-120231624 GGACCACCTGGGTTCAAACTTGG + Intergenic
937356146 2:121199362-121199384 TGACATACTGACTTCAAGTTGGG - Intergenic
937511032 2:122595159-122595181 TGACTGACTGGCTATAAATTGGG + Intergenic
937920661 2:127127294-127127316 TGACCAACTGGCTACAAACCTGG - Intergenic
937968811 2:127534546-127534568 TGACCAATTGGCTATAAATCGGG + Intergenic
938185688 2:129229982-129230004 TGACTAACTGGCTACAAATTTGG + Intergenic
938424816 2:131177143-131177165 TGACCAAATGGCATCCAACTAGG + Intronic
938541903 2:132289946-132289968 TGACCAACTGGCTATAAATCAGG - Intergenic
938708600 2:133955764-133955786 TGACCAACAGGCTATAAATTGGG - Intergenic
938774737 2:134531515-134531537 TGACCCACTGGCTAGGAATTAGG + Intronic
938881225 2:135591723-135591745 TGATCAGCTGGCTACAAATTTGG + Intronic
939061013 2:137421378-137421400 TGACCAACTGGCTTCAAGTTGGG + Intronic
940058938 2:149543388-149543410 TAACCAACTGACTTAAAATAAGG - Intergenic
941299862 2:163787794-163787816 TTACCAAATGGCTACAAGTTGGG + Intergenic
941790451 2:169547063-169547085 TGAGCAACCGGCTTCAAGTTGGG + Intronic
941992031 2:171566963-171566985 TGAACTCCTGGCTTCAAACTTGG - Intergenic
942224354 2:173802318-173802340 GGACCAACTAGCTTCAAGTTGGG + Intergenic
942645002 2:178101152-178101174 CAACTAACTGGCTACAAATTTGG + Intronic
942745285 2:179224990-179225012 TGACTGACTGGCTATAAATTGGG - Intronic
942815034 2:180042819-180042841 TGACTGACTGGCTATAAATTAGG - Intergenic
943521183 2:188950761-188950783 AGACCAACTGGCTACAAATTTGG - Intergenic
943771510 2:191722516-191722538 TGACCAGCTGGTTTCAAGTTGGG + Intergenic
943886792 2:193228410-193228432 TGACCAACCTGTTTCAAGTTGGG - Intergenic
944861415 2:203819109-203819131 TGACTGACTGGCTATAAATTGGG + Intergenic
945517645 2:210782867-210782889 TGACCAATTGGTTTCCAGTTGGG + Intergenic
945549159 2:211197694-211197716 TGAACAGCTGGCTTCAAGTTGGG - Intergenic
945951392 2:216042059-216042081 TGACTGACTAGCTTCAAGTTGGG - Intronic
946476544 2:220011639-220011661 TGACCAGCCTGCTTCAAGTTGGG - Intergenic
946811636 2:223531399-223531421 TGACCCACTGGCTTCAAGTTGGG - Intergenic
946966047 2:225039583-225039605 TCAACAACTGCCTTAAAATTTGG + Intronic
947964402 2:234267367-234267389 TGACCAACTGGCTGTATATCAGG - Intergenic
948346745 2:237305071-237305093 TAAGCAATTTGCTTCAAATTGGG - Intergenic
949086750 2:242161922-242161944 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1169140724 20:3226123-3226145 TGACACACTGTCTTCAACTTGGG - Intergenic
1169307853 20:4508589-4508611 CGACCAACTGGCTGTAAATTTGG + Intergenic
1170199985 20:13732087-13732109 TGATTGACTGGCTTCAAGTTGGG - Intronic
1171045499 20:21806425-21806447 AGATCATCAGGCTTCAAATTTGG - Intergenic
1171318206 20:24214516-24214538 TGGCCAACTGGCTGTAAATTGGG - Intergenic
1171538147 20:25917143-25917165 TGACCTACTGGGTTCAAGTTGGG + Intergenic
1171802993 20:29644298-29644320 TGACCTACTGGCTTCAAGTTGGG - Intergenic
1171841088 20:30212444-30212466 TGACCTACTGGCTTCAAGTTGGG + Intergenic
1171870782 20:30522824-30522846 TGACCAACTGGCTATAAATCAGG - Intergenic
1172377736 20:34459092-34459114 AGACCAACTGTCTACAAATTTGG + Intronic
1173290328 20:41709275-41709297 TGATCAACTGGCTACAAACTCGG - Intergenic
1173348501 20:42222852-42222874 TGTCCAACAGGCTTCAAGTTGGG - Intronic
1174031498 20:47632107-47632129 TGACTGACTGGCTATAAATTGGG + Intronic
1174108027 20:48176885-48176907 TGACCAACTGGCTACAAATAAGG - Intergenic
1175012538 20:55754305-55754327 TGACCAACCTCCTTCAAGTTGGG + Intergenic
1175438291 20:58971366-58971388 TGAAAAATTGGCTTCAAATCAGG + Intergenic
1175498607 20:59433065-59433087 TGATCTCCTGACTTCAAATTGGG - Intergenic
1175576582 20:60065099-60065121 TGACCAACTGGCCAAAAATTTGG - Intronic
1175615481 20:60394539-60394561 TGATCAGCTGGCTTTAAAATAGG - Intergenic
1176305772 21:5122354-5122376 TGACCAGTTGACTTCAAGTTGGG - Intronic
1177063414 21:16400389-16400411 TGACCAACTGTCTGTAAATCAGG + Intergenic
1177592028 21:23183705-23183727 TGACCAACTGGCTACAAATCAGG - Intergenic
1178000616 21:28158540-28158562 CAACCAACTGGCTTCAAGTTGGG + Intergenic
1178264391 21:31129207-31129229 TGAGAACTTGGCTTCAAATTAGG + Intronic
1178856784 21:36257024-36257046 TGACTGACTAGCTTCAAGTTGGG + Intronic
1179024875 21:37671570-37671592 TGACCAACTGGCTGTAAATTGGG - Intronic
1179618423 21:42596633-42596655 TGACCAACTGGCTATAAATCAGG + Intergenic
1179842252 21:44084775-44084797 TGACCAACTAGCTAGAAATCAGG + Intronic
1179851286 21:44139677-44139699 TGACCAATTGGCTTCAAGTTGGG + Intronic
1180465974 22:15611287-15611309 TGACCAAATGGCATCCAACTAGG + Intergenic
1181093571 22:20491003-20491025 TGACCAATAGGCTATAAATTGGG + Intronic
1181378599 22:22480928-22480950 TGACTGACTGACTTCAAGTTGGG - Intergenic
1181588508 22:23867976-23867998 TGACCAACTGGCCATCAATTGGG - Intronic
1181696925 22:24597961-24597983 TGACTAACTGGCTTCTAGTTGGG + Intronic
1181875075 22:25934342-25934364 TGACCAACTGATTTAAAATTTGG - Intronic
1182251683 22:29005647-29005669 TGCCCACCAGGCTTGAAATTTGG + Intronic
1183006296 22:34905472-34905494 TGACCAACAAGCTTCAAGTTGGG - Intergenic
1184334202 22:43843880-43843902 TCACCCACTGGCTATAAATTGGG - Intronic
1184725417 22:46342190-46342212 TGACCAACTGGCTTCCAGTTGGG + Intronic
1185019281 22:48364451-48364473 TGACCAGCTGGCTACAAAGTCGG - Intergenic
949100139 3:133465-133487 TGATCAACTGGCTACAAAACTGG + Intergenic
949321845 3:2820194-2820216 TGACTAACTGGCTATAAAGTGGG + Intronic
949343940 3:3059229-3059251 TGACCAATTGGCTTCATCATCGG + Intergenic
949487293 3:4552349-4552371 TGACTGACTGGCTTTAAGTTTGG + Intronic
949792813 3:7811874-7811896 TGACCAGCTGACCCCAAATTTGG - Intergenic
949835369 3:8263671-8263693 TGACCAACAGTCTACAAATCAGG + Intergenic
949966207 3:9358689-9358711 TGACCAACAGGCTTTAAGTTGGG + Intronic
950071370 3:10155445-10155467 TGACCAACCAGCTTCAAGTTGGG - Intergenic
951344552 3:21531326-21531348 TGACAAACTGTCTTCCAATGTGG - Intronic
951478234 3:23131137-23131159 TGACCCACTGGCTATAAACTCGG - Intergenic
951487626 3:23231706-23231728 TGACTGACTTGCTTCAAATTAGG + Intronic
951723331 3:25725481-25725503 TGACCAACTGGCTATAAATCAGG - Intronic
951891954 3:27575800-27575822 TGACCAACCAGCTTTAACTTGGG + Intergenic
952223763 3:31352503-31352525 TCAACAACTGGTTACAAATTTGG - Intergenic
953400275 3:42608289-42608311 TGACCAACCAGCTGTAAATTAGG + Intronic
953441913 3:42925527-42925549 TGAAAAACTGGCTATAAATTGGG + Intronic
953650531 3:44798939-44798961 AGACCAACTGGCTGTAAATCAGG + Intronic
953882439 3:46697645-46697667 TGACCAACTGGCTTCACGCTGGG - Intergenic
956272501 3:67462732-67462754 TCACCAACCGGCTATAAATTGGG - Intronic
956617323 3:71185386-71185408 TGAGCAAATGCCTTCGAATTTGG + Intronic
956840534 3:73135802-73135824 TGACCAAGTGGCTGCAACTGTGG + Intergenic
956875228 3:73456558-73456580 ACATCATCTGGCTTCAAATTTGG - Intronic
957026964 3:75193130-75193152 TGACCAACCAGCTTCAAGTTGGG + Intergenic
957103603 3:75858575-75858597 TGACCAACTGGCTATAAATTAGG + Intergenic
957303099 3:78419465-78419487 GGACTAACTGGCTATAAATTAGG + Intergenic
957319026 3:78605463-78605485 TAAGCAAATGGCTACAAATTAGG + Intronic
957837538 3:85617232-85617254 TGACCAACTGGCCTCAAGTTGGG + Intronic
959020231 3:101180929-101180951 TGACTGACTGGCTTCAAGTTGGG - Intergenic
959303012 3:104626626-104626648 TGACAGACTCGCTTCAAGTTAGG - Intergenic
959468713 3:106721763-106721785 TGAGAAACTGTCTTCACATTTGG - Intergenic
959971643 3:112416594-112416616 TGACCAACCAGCTTCAAGTTGGG + Intergenic
960738261 3:120804144-120804166 TGACTGACTGGCTATAAATTAGG + Intergenic
960803298 3:121559900-121559922 TGACCCACTGGCTATAAATTTGG + Intergenic
961431041 3:126883284-126883306 TGACCAATCGGCTTCGAGTTGGG - Intronic
961694226 3:128693094-128693116 TGACCAATTGGCTATAAACTGGG + Intergenic
961841690 3:129719476-129719498 TGACCAACTGGCTGTAAATTGGG - Intronic
962056010 3:131872428-131872450 TGCCTAACTGCCTTCAAACTGGG - Intronic
962182298 3:133220830-133220852 TGACCAACTGGCTGTAAATTGGG + Intronic
962326701 3:134440479-134440501 TGACTGACTGGCTTCAAGTTGGG + Intergenic
962723283 3:138196326-138196348 TTTCCAACTGACTACAAATTTGG - Intronic
962856878 3:139354790-139354812 TGAACTACTGGCTTCCAGTTGGG - Intronic
962923249 3:139969792-139969814 TCACCCACTGGCTCCAAATTCGG + Intronic
963154941 3:142086403-142086425 TGACCAACCAGCTATAAATTGGG + Intronic
963192162 3:142484645-142484667 TGACCAACTGGCTTCAAGTTGGG - Intronic
963994021 3:151685542-151685564 TGACCAACTGGTTTCAAACTGGG - Intergenic
964109310 3:153072715-153072737 TGACTGACTGGCTTCAAATTGGG + Intergenic
964138556 3:153371509-153371531 TGACCCACTGGCTTCAAGTTGGG - Intergenic
964745226 3:160006066-160006088 TGATCCACTGGCTACAAATTGGG - Intergenic
964777490 3:160294106-160294128 TGACCAACTGGCTAAAAATTTGG - Intronic
964807994 3:160632432-160632454 TGACAAACTGACTTTAAATTTGG - Intergenic
965082578 3:164053769-164053791 TGACCAACCAGCTTCACATTGGG + Intergenic
965944858 3:174227886-174227908 TGACTAATTGCCTTTAAATTTGG + Intronic
966567337 3:181397648-181397670 TGACTAACTGACTGTAAATTGGG + Intergenic
967163487 3:186759789-186759811 TGACCAACAGGCTTCAGGTTGGG + Intergenic
967233660 3:187364956-187364978 TGACCAACTGGTTATACATTAGG - Intergenic
967370729 3:188742867-188742889 TCACCAATTGGTTTGAAATTCGG + Intronic
967469901 3:189849302-189849324 TGACCAACCAGCTTCAAATTGGG - Intronic
967659576 3:192090386-192090408 TGACCAACTTTTTTCAAAATTGG + Intergenic
967708906 3:192683152-192683174 TCACCAACTGAATACAAATTTGG - Intronic
967776405 3:193390874-193390896 TGACCAACTGGGTATAAACTGGG + Intergenic
967863405 3:194170428-194170450 TGACAAGCTGGCTTTAAAATGGG + Intergenic
967910989 3:194542325-194542347 TGAGCAACTGGCTTCAAGTTGGG - Intergenic
968217454 3:196905475-196905497 TGACCAACAGACTTCAAGTGAGG + Intronic
968669386 4:1840740-1840762 TGACAGACTGGCTTCAAGTTAGG - Intronic
969128358 4:4971550-4971572 TGACCCACTGGCTATAAATTGGG + Intergenic
969862741 4:10050645-10050667 TAACCAACTGGCTATAAATTGGG + Intronic
970024352 4:11606305-11606327 TGACCAACTGGCTATAAACAAGG + Intergenic
970226952 4:13868879-13868901 TGATCAACTGACTCCAAATCTGG - Intergenic
970529949 4:16971226-16971248 TGACCCACTGGCTTCAAGTTGGG + Intergenic
971394128 4:26213158-26213180 TGACCTACTGACTTCAAGTTGGG - Intronic
971640518 4:29126314-29126336 TGACCAACAGGTTTCAAGTTGGG - Intergenic
972207245 4:36789618-36789640 TGACAAACTGGTTTCCAAATTGG + Intergenic
972766946 4:42159932-42159954 AGACCTACTGGCTTCACGTTGGG + Intergenic
973588388 4:52414730-52414752 TGGCCAACGGGCTTCACTTTAGG - Intergenic
975848672 4:78549910-78549932 TTACCAACTAGCTGTAAATTAGG - Intergenic
976243565 4:82985462-82985484 TGACCAACTAGCTTCATACCAGG + Intronic
976282742 4:83341315-83341337 TTACCAACATGCTTCAAGTTGGG + Intergenic
976317300 4:83672457-83672479 TGATCAACTGGCTCCAAATTTGG + Intergenic
976946951 4:90782291-90782313 TGATCTACTGTCTTCTAATTAGG - Intronic
977718385 4:100209628-100209650 TGACCAACTGGCTTCAAGTTGGG - Intergenic
978132465 4:105214933-105214955 TGACCAACCAGCTTCGAGTTGGG - Intronic
978846985 4:113285410-113285432 TGACCTACTGGCTTCAAGTTGGG + Intronic
979610856 4:122687407-122687429 TGACCAATCGGCTATAAATTAGG - Intergenic
979927892 4:126590697-126590719 TGAACAACTGGCTGTTAATTAGG + Intergenic
980121796 4:128735261-128735283 TGACCCATTGGCTTCAAATTGGG + Intergenic
980312686 4:131154179-131154201 TGACCAACCAGCTTCGAGTTGGG + Intergenic
980729100 4:136804380-136804402 TGAGAAACTGTCTTCACATTTGG + Intergenic
981396193 4:144252663-144252685 TGACTAACTGGCTCTAAATTGGG - Intergenic
981483782 4:145263680-145263702 TGATCAACTGGCTTCAAGCTGGG + Intergenic
981643530 4:146972734-146972756 TGATCAACTGGCTATAAGTTGGG + Intergenic
981731968 4:147909073-147909095 TGGCTAACTGGCTATAAATTGGG + Intronic
981889400 4:149717174-149717196 TCAACAACTGGCTATAAATTGGG - Intergenic
982036633 4:151352587-151352609 GGACCAACTGGTTGCAAGTTAGG + Intergenic
982084485 4:151819713-151819735 TGACCCACTGGCTTCAACTTGGG - Intergenic
982486646 4:155974528-155974550 AGACCAGCTGGCTACACATTTGG - Intergenic
982772980 4:159415058-159415080 TGACCAAAAGGCTTCCAGTTGGG - Intergenic
983127978 4:163978590-163978612 AGACTGACTGGGTTCAAATTTGG - Intronic
983247188 4:165301206-165301228 GGATCAAATGGATTCAAATTTGG + Intronic
983312552 4:166083089-166083111 TTACCAACTGGCTTCATTATGGG + Intronic
983490674 4:168385519-168385541 TGACCAACTGGCTTCAAGTTGGG - Intronic
983768608 4:171519339-171519361 TGACTGACTGGCTTCAAGTTGGG + Intergenic
983780406 4:171663367-171663389 TTACCAACTCCCTGCAAATTAGG - Intergenic
984209237 4:176825265-176825287 TGAGCAACCGGCTACAAATTTGG + Intergenic
984232494 4:177115629-177115651 TGACCAACCAGCTATAAATTGGG - Intergenic
984270988 4:177548551-177548573 TAATGCACTGGCTTCAAATTGGG - Intergenic
984505224 4:180609412-180609434 TGACCAACAGGCTAGAAATCTGG + Intergenic
984517457 4:180758094-180758116 TGACCCACTGGCTTCCAGTTGGG - Intergenic
984983150 4:185302319-185302341 TGACCAACCAGCTTCAAGTCAGG - Intronic
985406110 4:189639794-189639816 TGATCAATGGGCTTCAATTTGGG - Intergenic
1202752176 4_GL000008v2_random:16797-16819 TGACCAACTGGCTATAAATTAGG - Intergenic
986707160 5:10461706-10461728 TGACCGACTGGCTCTAAATCAGG + Intronic
986844128 5:11733188-11733210 TGACCAACAGGCTTCAGCTGGGG - Intronic
987014672 5:13805828-13805850 TGACCAAGTGGCTACAAATTAGG - Intronic
988058238 5:26129727-26129749 TAAACAACTGCATTCAAATTTGG + Intergenic
988099023 5:26655132-26655154 TGACCAACTGGCTTCATGATGGG + Intergenic
988400274 5:30752793-30752815 TGACTGACTGGCTTCAAGTTGGG + Intergenic
989186629 5:38632378-38632400 TGATCAACCAGCTTCAAGTTGGG - Intergenic
989623934 5:43411816-43411838 TGGCCAGCTGCGTTCAAATTAGG - Intronic
989624432 5:43415758-43415780 TGAACAGCTGGCTCCAAGTTGGG - Intergenic
990604523 5:57395498-57395520 TGACTGACTGGCTTCAAGTTGGG + Intergenic
990724739 5:58740975-58740997 TGACCAGCTGTCTACAAATTTGG + Intronic
990866685 5:60387926-60387948 TGACCAACCAACTTCAAGTTGGG + Intronic
992129272 5:73675054-73675076 TGACCAACTGACTATAAATCAGG - Intronic
992712721 5:79476514-79476536 TGACCAACTGGCTTTGAGTTGGG + Intronic
993336844 5:86670439-86670461 TGACCAACTTGCTTCAAGTTGGG - Intergenic
993857790 5:93097428-93097450 TGACCGACTGTCTTTAAGTTGGG + Intergenic
994017931 5:94990083-94990105 TGACCAACCAGCTACAAATCAGG - Intronic
995379636 5:111517829-111517851 TGACCTACTGGCTTCAAGTTGGG - Intergenic
995795462 5:115936676-115936698 TGACCAACTGGCTTCAAGTTGGG - Intergenic
996092407 5:119363854-119363876 TGACCAACTGGGTATAAATTGGG + Intronic
996144395 5:119955894-119955916 TAAACAACTGGCTACAAATTTGG - Intergenic
996585782 5:125086641-125086663 TGACCAGCTGGCTACAAGTGTGG - Intergenic
996866107 5:128124418-128124440 TGACCAACTGGCTATATATTGGG + Intronic
996953608 5:129157348-129157370 TGACCAACTAGCTTCAAGATGGG - Intergenic
997005763 5:129814636-129814658 TGACTGACTGGTTTCAACTTGGG + Intergenic
997016527 5:129941851-129941873 TGACCAACTGGCTTCAAGCTGGG + Intronic
997316646 5:132942183-132942205 TGACCAACTGGCTAAAAATCAGG + Intronic
997565908 5:134886271-134886293 TGACCAACTGACTTCAAAGTTGG - Intronic
998605701 5:143632538-143632560 TGACCAACCAGCTTCAAGTTGGG + Intergenic
998741142 5:145203406-145203428 TTACCATCTGGATTCAAGTTGGG - Intergenic
999432405 5:151535676-151535698 TGACCAACCAGCTTCAAGTTGGG - Intronic
1000053152 5:157579324-157579346 TGACCAACTGGCTTCCAGTTGGG + Intergenic
1000273028 5:159704954-159704976 TGACCAACCAGCTATAAATTAGG + Intergenic
1000736784 5:164913043-164913065 TGAATAACTCGATTCAAATTTGG + Intergenic
1000813556 5:165891683-165891705 TGACCTACTGGCTATAAATTGGG - Intergenic
1001217206 5:169867005-169867027 TGACTGACTAGCTTCAAGTTGGG + Intronic
1001467745 5:171983435-171983457 TGACCAACTTGCTTCAAGTTGGG - Intronic
1001612685 5:173016119-173016141 TGACCAACTGGCTATAAATCGGG - Intronic
1001755245 5:174163606-174163628 CGACAGACTGGCTTCAAGTTGGG + Intronic
1001835844 5:174831700-174831722 TGACCAACTGGTTGCAAATTTGG + Intergenic
1001985370 5:176070063-176070085 TGGCCAACTGTCTTCAAATTGGG - Intronic
1002231500 5:177768056-177768078 TGGCCAACTGTCTTCAAATTGGG + Intronic
1002288216 5:178179836-178179858 TGACCAATTGGCTATACATTGGG + Intergenic
1002659760 5:180783745-180783767 TGACCAACTGGGTTCAAGTTGGG - Intergenic
1002745168 5:181464411-181464433 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1002808497 6:602516-602538 TTACCAGCTGCCTTAAAATTGGG - Intronic
1002837771 6:879776-879798 TGACAAACTGGCTTCAAGTTGGG - Intergenic
1003099336 6:3165124-3165146 TGACCAACTGGCCATAAATCCGG + Intergenic
1003188903 6:3855832-3855854 TGATCAACTGGCTATAAATTGGG - Intergenic
1003192844 6:3889420-3889442 TGACCTATTAGCTTCAAGTTGGG - Intergenic
1003352315 6:5329637-5329659 TGACCAACCAGCTATAAATTGGG + Intronic
1003367253 6:5486670-5486692 TGACCTCCTGGCATCACATTTGG - Intronic
1003400138 6:5784138-5784160 TGACCCATTGGCTTCAAGTTGGG - Intergenic
1003610885 6:7614171-7614193 TGATGAACTGGCTATAAATTGGG + Intergenic
1004496250 6:16165956-16165978 TGACCAACTGGCTATACACTAGG + Intergenic
1004687170 6:17957543-17957565 TGACCTACCAGCTTCAAGTTGGG - Intronic
1005132584 6:22526817-22526839 TGACTAAATGTGTTCAAATTGGG + Intergenic
1005206851 6:23414743-23414765 TGGCCAGCTGGCCTCAAACTTGG - Intergenic
1005716018 6:28549376-28549398 TGACCAACCAGCTTCAAATTAGG + Intergenic
1005746890 6:28846588-28846610 TGACTGACTGGTTTCAATTTGGG - Intergenic
1005976602 6:30804881-30804903 TGACCCACCAGCTTCAAGTTGGG + Intergenic
1005982599 6:30847870-30847892 TGACCAACTGGCTACTAATCTGG + Intergenic
1006421005 6:33934111-33934133 TGACCAACCGGCTCTAAATCAGG + Intergenic
1006483597 6:34319342-34319364 TGACCAACTAGCTTCAAGTTGGG + Intronic
1007572782 6:42905275-42905297 TGACTGACTGGCTACAAATTTGG - Intergenic
1007674815 6:43584726-43584748 TGAACAGCTGGCTTTAAGTTGGG + Intronic
1007979603 6:46137849-46137871 TGAAAAACTGACTTAAAATTAGG - Intronic
1008119332 6:47592947-47592969 TGATCAATTGGCTATAAATTGGG - Intronic
1008586820 6:52958230-52958252 TGACCAATCAGCTTCAAGTTGGG + Intergenic
1008634122 6:53392491-53392513 TGACTGACTGGCTTCAAGTTGGG + Intergenic
1008738306 6:54574147-54574169 TGACCAACTGGCTTCAAGTTGGG - Intergenic
1008952493 6:57175898-57175920 TGACCAACTGGCTTCAAATTGGG - Intronic
1009276588 6:61689371-61689393 TGACCGGCTGGCTACAAATTCGG - Intronic
1009462634 6:63932920-63932942 TGACCAATTGGCTATAAATCAGG + Intronic
1009594452 6:65716564-65716586 TGACCAATAAGCTTCAAGTTGGG + Intergenic
1009927250 6:70134989-70135011 TGACCAACTGGCTATAAATCGGG + Intronic
1010382306 6:75239172-75239194 TGACTGACTGGCTTTAAGTTGGG - Intronic
1010908540 6:81523241-81523263 TGATCAATTGGCTACATATTGGG - Intronic
1010970088 6:82253800-82253822 TGACTGATTGGCTTCAAGTTGGG - Intergenic
1011353200 6:86445731-86445753 TGACTAACTGGCTGTAAATTGGG - Intergenic
1011381127 6:86743300-86743322 TGACCAACCAGCTTTAAGTTGGG + Intergenic
1011391130 6:86854807-86854829 TGACCAACTAGCTTTAAGCTGGG + Intergenic
1012444651 6:99295534-99295556 TGCCTAACTGCCTTCAAACTGGG + Intronic
1012464506 6:99502420-99502442 TGACCAACTGTCCACAAATTTGG - Intronic
1012467368 6:99530551-99530573 TGACCAACTAGCTGTAAATCGGG + Intergenic
1013510508 6:110840393-110840415 TGATCGACTGGCTTCAAGGTGGG + Intronic
1013939438 6:115644368-115644390 TGATCAACTGGCTTCAAGTTGGG - Intergenic
1013971986 6:116030831-116030853 TGACCAACTAGCTATAAATTGGG - Intronic
1014074626 6:117222153-117222175 CAACCAACTGGCTATAAATTAGG + Intergenic
1014107581 6:117584391-117584413 TGACTGAATGGCTTCAAGTTGGG + Intronic
1014679865 6:124415248-124415270 TGACCAACTGACTACAAATTGGG + Intronic
1015135597 6:129866067-129866089 TGGTCAACTGGCTTAAAAGTAGG - Intergenic
1015593398 6:134843598-134843620 TAACCTACTGGCTTCGAGTTGGG - Intergenic
1015640660 6:135328033-135328055 TGACCAACCGGCTTCAAGTTGGG - Intronic
1015739918 6:136442794-136442816 AGACCATCTGCCTTCAAACTGGG + Intronic
1016456367 6:144235018-144235040 TGACCAACTGGCTACAAATTTGG - Intergenic
1016705543 6:147102495-147102517 TGACCCACTGGCTTCCAACTGGG - Intergenic
1017084426 6:150700670-150700692 TAACCGCCTGGGTTCAAATTCGG + Intronic
1017782176 6:157724063-157724085 TCACCAACTGGCTATAAAGTGGG + Intronic
1017846070 6:158259738-158259760 TGACCAACTGGCTGTAAATTTGG + Intronic
1018047108 6:159975169-159975191 TGACCAACTGGCTTCAATTTGGG + Intronic
1018601611 6:165549675-165549697 TCACCAACTGAATGCAAATTAGG + Intronic
1018626343 6:165782449-165782471 TCACCAACTGCCTACAAAATCGG + Intronic
1018743349 6:166746665-166746687 TAACCAACTGGCTATAAATAGGG + Intronic
1018780477 6:167059539-167059561 TGACCAACTGGCTCCAAATCGGG + Intergenic
1019001040 6:168752394-168752416 TGACCCACTGGCTTCAAGTTGGG + Intergenic
1019082095 6:169441309-169441331 TGATCAACTGTCTTGAAATTAGG - Intergenic
1019250076 6:170737957-170737979 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1019798199 7:3067712-3067734 TGACAAACTGGCTACACATTCGG - Intergenic
1020043247 7:5020121-5020143 TCACCAACTGCCTGCAAATTTGG - Intronic
1020334619 7:7053070-7053092 TGACTGACCGGCTTCAAGTTGGG - Intergenic
1020454802 7:8359731-8359753 TGACCAAATGGCCTCAAGTTTGG - Intergenic
1020941298 7:14541783-14541805 TGACTTACTGACGTCAAATTGGG - Intronic
1021097691 7:16551857-16551879 TGACCAACTGGCTGTTAATTGGG - Intronic
1021737059 7:23649846-23649868 TTACTAACTTGCTTCAAATGAGG + Intergenic
1021737343 7:23653069-23653091 TGACCAATTGGCTATAAACTGGG + Intergenic
1022727634 7:32995547-32995569 TGAGCTACTGTCTTCAAAATTGG + Intronic
1022987698 7:35675020-35675042 TGACCAACTGGTTATAAATTGGG - Intronic
1023826237 7:44011716-44011738 TCACCAACTGGCTGCAAATTTGG + Intergenic
1024072648 7:45799488-45799510 TGACCAACCTGTTACAAATTGGG + Intergenic
1024175472 7:46836154-46836176 TGATCATCTGGCTACAAACTTGG - Intergenic
1024925147 7:54604730-54604752 TGACCGACTGGCTTCAACTTGGG - Intergenic
1025289602 7:57703969-57703991 TGACCTACTGGCTTCAAGTTGGG + Intergenic
1026089817 7:67290589-67290611 TCACCAACTGGCTGCAAATTTGG + Intergenic
1026724479 7:72859927-72859949 TCACCAACCGGCTGCAAATTTGG - Intergenic
1026746639 7:73018268-73018290 TCACCAACTGGCTGCAAATTTGG - Intergenic
1026750291 7:73046411-73046433 TCACCAACTGGCTGCAAATTTGG - Intergenic
1026753938 7:73074521-73074543 TCACCAACTGGCTGCAAATTTGG - Intergenic
1026757589 7:73102557-73102579 TCACCAACTGGCTGCAAATTTGG - Intergenic
1027032743 7:74902826-74902848 TCACCAACTGGCTGCAAATTTGG - Intergenic
1027089814 7:75290929-75290951 TCACCAACTGGCTGCAAATTTGG + Intergenic
1027093459 7:75318857-75318879 TCACCAACTGGCTGCAAATTTGG + Intergenic
1027097102 7:75346824-75346846 TCACCAACTGGCTGCAAATTTGG + Intergenic
1027119408 7:75505901-75505923 TCACCAACTGGCTGCAAATTTGG + Intergenic
1027272420 7:76529707-76529729 TCACCAACTGGCTGCAAATTTGG - Intergenic
1027322245 7:77020846-77020868 TCACCAACTGGCTGCAAATTTGG - Intergenic
1027325873 7:77048780-77048802 TCACCAACTGGCTGCAAATTTGG - Intergenic
1027355174 7:77347280-77347302 TGACCAACTGTCTTTAAGTTGGG - Intronic
1027803225 7:82782058-82782080 TGACCGACTGGCTTCAAGTTGGG - Intronic
1028311856 7:89348300-89348322 TGACCAACTGGCAACAAATCTGG - Intergenic
1029036650 7:97529373-97529395 TGACAGACTGGCTTCAAGTTGGG + Intergenic
1029146890 7:98452753-98452775 TGACCAACTGGCCACCAATCTGG - Intergenic
1029189436 7:98761244-98761266 TGACCCAGTGGCTTCAATTTAGG + Intergenic
1029398212 7:100323825-100323847 TCACCAACTGGCTGCAAATTTGG + Intergenic
1029718088 7:102344131-102344153 TCACCAACTGGCTGCAAATTTGG - Intergenic
1029754527 7:102565125-102565147 TCACCAACTGGCTGCAAATTTGG + Intronic
1029772477 7:102664208-102664230 TCACCAACTGGCTGCAAATTTGG + Intronic
1030077278 7:105747603-105747625 TGGCCTACTGGCTTCAAGTTGGG - Intronic
1030521793 7:110606893-110606915 TAACCAACTTCCTTAAAATTTGG + Intergenic
1031099992 7:117467911-117467933 TGAAAAACTAGCTTCAAGTTGGG - Intronic
1031149551 7:118037247-118037269 ATACCAACTGGCTTCCTATTAGG - Intergenic
1031308251 7:120161401-120161423 TGACCAACTAGCTATAAAGTGGG + Intergenic
1031479169 7:122257547-122257569 TGACCAACAGGCTTCAAACTGGG - Intergenic
1033067885 7:138173323-138173345 TGACCAATCAGCTTCAAGTTGGG - Intergenic
1034051617 7:147990040-147990062 TGACCAACTGACTACAAATTTGG + Intronic
1034172722 7:149075174-149075196 TAACCAACTTGCTTTAAAATTGG - Intronic
1035497959 8:69347-69369 TGAGAAACTTGCTTCAAATAGGG - Intergenic
1036427009 8:8654229-8654251 TGATCAATGGGCTTCAAGTTGGG + Intergenic
1037012611 8:13862741-13862763 TGATCATCTGGCTATAAATTGGG + Intergenic
1037189237 8:16101349-16101371 TGAACAAATGGCTTCAAGTTGGG + Intergenic
1037560732 8:20072446-20072468 TGGCCAACTGGCTACAAATAAGG + Intergenic
1037736627 8:21572105-21572127 TGACCAACTGGCTATAAATCAGG - Intergenic
1038125163 8:24665272-24665294 TTTCCAGCTGGCTTCAATTTGGG + Intergenic
1038153731 8:24967072-24967094 AGAGCAACTGTCTTCAAACTGGG + Intergenic
1038418028 8:27411869-27411891 TGACCAATTGGCTACAAGTTTGG + Intronic
1038427328 8:27472268-27472290 TAACCCACTGGCTATAAATTGGG - Intronic
1038625670 8:29190640-29190662 TGACCTACTGGCTTCCAATTAGG - Intronic
1038726161 8:30084223-30084245 TGACCAACCAGCTATAAATTAGG + Intergenic
1038859250 8:31368249-31368271 TGACTATCTGGCTACAAATGTGG - Intergenic
1038985282 8:32802475-32802497 TGACCAGCTGGCTATAAACTGGG + Intergenic
1039039619 8:33395057-33395079 TGGACAACTGGCTTGCAATTAGG + Intronic
1039598847 8:38816524-38816546 TGAGCAACTGGCTATAAATTTGG + Intronic
1039757673 8:40540634-40540656 TGACCAATTGGCTACAAATTTGG - Intronic
1039803894 8:40982666-40982688 TGACCAACCAGCTTCAAGCTGGG - Intergenic
1040793998 8:51269488-51269510 TGACCAACTGACTTTTAATATGG + Intergenic
1041350860 8:56946640-56946662 TGACTAACCAGCTTCAAATTGGG - Intergenic
1041862997 8:62535499-62535521 TGACCACCGGGCTTCAAGTTGGG + Intronic
1041950508 8:63495665-63495687 TGACCACCTGGCTTCAAGTTGGG - Intergenic
1042111812 8:65389098-65389120 TGATCGACTGGCTTCAAGTTGGG - Intergenic
1042184187 8:66120870-66120892 TGACCAACTGGCTACAAATTTGG - Intergenic
1042283454 8:67080614-67080636 TGACCATCTGGCTATAAATTTGG + Intronic
1042342247 8:67692789-67692811 TGACCTCTTCGCTTCAAATTGGG + Intronic
1042344671 8:67715283-67715305 TGACCAACTGGCTATAAACTGGG + Intronic
1042346141 8:67730193-67730215 TGACCAACCAGCTATAAATTAGG + Intronic
1042533810 8:69839553-69839575 TGACCAACTAGCTTCAATTTGGG + Intergenic
1042898052 8:73692640-73692662 TGACCAACTGGCTATAAACCGGG - Intronic
1042918381 8:73897481-73897503 TGACCAACTGACTGTAAATCAGG - Intergenic
1043028810 8:75105751-75105773 TAACCAACTGGCTATAAATCAGG + Intergenic
1043248092 8:78031646-78031668 TGAGCTACTGGCTTCATATTTGG + Intergenic
1043305377 8:78787195-78787217 TGACCAACTGGCTGTACAATGGG - Intronic
1043486696 8:80704919-80704941 TGACCAACTGGCTATAAATCAGG - Intronic
1043559013 8:81468948-81468970 TGACCAACAGGCTTCAAGCTGGG + Intergenic
1043913317 8:85890328-85890350 TGACCAACTGGCTCTAAATCAGG - Intergenic
1044098697 8:88102263-88102285 TGACCAACTGGCCTCAAGTTAGG + Intronic
1044151424 8:88781169-88781191 TGGCCAAATGCTTTCAAATTTGG - Intergenic
1044444982 8:92265233-92265255 TGACCCACCAGCTTCAAGTTGGG + Intergenic
1044581506 8:93830413-93830435 TGACAGACTGGCTTCAATTTGGG - Intergenic
1044793617 8:95873054-95873076 TGGCCAACTGGCTTCATTTCTGG - Intergenic
1044951430 8:97439116-97439138 TGACAAACTGGCTACAAATTTGG - Intergenic
1045221189 8:100201976-100201998 TCACCAACAGGTTTCAAGTTAGG - Intronic
1045414651 8:101953824-101953846 TGACCAACTGGCTACAAATTTGG - Intronic
1045422926 8:102034580-102034602 TCACCAATTGGCTTCTTATTGGG + Intronic
1045436280 8:102168152-102168174 GGACCAACTAGCTTCACATTGGG + Intergenic
1045517394 8:102872183-102872205 TGACCTACAGGCTTCAAGTTGGG + Intronic
1045743623 8:105390219-105390241 TGACTAACAGGCTACAAATTTGG + Intronic
1045991583 8:108314685-108314707 TGACCCACTGGCTTCAAGTTGGG - Intronic
1046198057 8:110888950-110888972 TGACCGACTGGCTTCATGTTGGG - Intergenic
1046832963 8:118766920-118766942 TGAAAAAATAGCTTCAAATTTGG - Intergenic
1046845394 8:118909507-118909529 TGACTGACTGGCCACAAATTGGG - Intergenic
1047034977 8:120927657-120927679 TTACCAAATGGCTTCAAGTTAGG - Intergenic
1047572156 8:126110737-126110759 TGACTAACTGGCTATAAACTAGG - Intergenic
1047968469 8:130064779-130064801 TGACCAGTTGGCTTCAACTGGGG + Intronic
1048340787 8:133537092-133537114 TGACCAACTGGCTTCAAATTGGG + Intronic
1048477518 8:134756715-134756737 TGACCTTCTTGCTTCAATTTAGG + Intergenic
1049966441 9:784537-784559 TGACCAACTAGCTGTAAATTGGG + Intergenic
1049984134 9:932718-932740 TACCCAGCTGGCTACAAATTAGG + Intronic
1050264382 9:3874517-3874539 TGACAAACTGACTACAAATCAGG - Intronic
1051466599 9:17385002-17385024 TGACCAACTGAGTTTAAATTGGG + Intronic
1051724192 9:20071814-20071836 TGACCAATAGTCTTCAAGTTGGG + Intergenic
1051875726 9:21791203-21791225 GGACTGACTGGCTTCAAATTGGG - Intergenic
1052787152 9:32839370-32839392 AGACCAGCTGGCTACAAATCTGG - Intergenic
1052816997 9:33109481-33109503 TGACCAACCAGCTATAAATTGGG - Intronic
1053134270 9:35640261-35640283 TGAACAACTAGCTATAAATTTGG + Intronic
1053431423 9:38044100-38044122 TGGCCAACTGGCTTCAAGGCAGG + Intronic
1053534239 9:38910322-38910344 TGAACAACTGGCTAGAAATGTGG + Intergenic
1054206463 9:62134741-62134763 TGAACAACTGGCTAGAAATGTGG + Intergenic
1054631895 9:67453605-67453627 TGAACAACTGGCTAGAAATGTGG - Intergenic
1054794562 9:69288359-69288381 TGACCAACCAGCTATAAATTGGG + Intergenic
1054918940 9:70522611-70522633 TGACTGACTGGCTACAAATCTGG + Intergenic
1055042777 9:71893362-71893384 TGACTAACTGGCTATAAATTGGG + Intronic
1055185092 9:73441895-73441917 TGACCAACTGGCTACAAATTGGG + Intergenic
1055300820 9:74879894-74879916 TAACTGACTGGCTTCAAGTTGGG - Intronic
1055450994 9:76431333-76431355 TGACCTACTCGCTACAGATTTGG + Intronic
1055982131 9:82014539-82014561 AGACCAGCTGGCTACAAATTTGG - Intergenic
1056173833 9:84014610-84014632 TGACCAACTGGGTATAAATCAGG - Intergenic
1056373206 9:85979986-85980008 TGACCCACTGGCTTTAAGTTGGG + Intronic
1056625083 9:88246192-88246214 TGACCAACTGGCTGTAAATCAGG - Intergenic
1056722836 9:89086315-89086337 TGACTAACTGGCTACAAATCAGG + Intronic
1057035297 9:91807531-91807553 TGACCTACTGGCTTCAGGTTGGG - Intronic
1057327334 9:94077437-94077459 TGACTGACTGGCTATAAATTGGG + Intronic
1057526817 9:95810413-95810435 TGCCCAACTGACTTCAAATTGGG + Intergenic
1057598391 9:96436324-96436346 AGACCAGCTAGCTGCAAATTAGG + Intergenic
1057614063 9:96572296-96572318 TGACTGACTGGCTTCAAGTTGGG - Intronic
1057711452 9:97449404-97449426 TGACTGACCAGCTTCAAATTGGG + Intronic
1057816694 9:98301165-98301187 TGACCAGCCAGCTTCAAGTTGGG - Intronic
1057964701 9:99491693-99491715 TGACCATCTTGCTCCAAATGAGG - Intergenic
1058021039 9:100089100-100089122 ATACCATCTTGCTTCAAATTAGG + Intronic
1058333610 9:103797122-103797144 TGACCAACTAGCTCAAAATCTGG - Intergenic
1058864991 9:109153649-109153671 AGACCAACTGGCTATAAATGTGG - Intronic
1059045850 9:110865419-110865441 TGACCAAGTGGATTTTAATTTGG - Intergenic
1059108253 9:111530459-111530481 TGACCAACAAGATACAAATTGGG - Intronic
1059206776 9:112474651-112474673 TGACCAACTGGCTTCAAGTTGGG - Intronic
1059244031 9:112834343-112834365 TGACCAGCCAGCTTCAAGTTGGG + Intronic
1060056263 9:120416281-120416303 TGACCAACTGACTAAAAATTCGG + Intronic
1060699595 9:125739229-125739251 TAACCAACTGGCTGAAAATGTGG + Intergenic
1061672489 9:132196864-132196886 TGTCCAATTGGCTGTAAATTGGG + Intronic
1062585902 9:137249907-137249929 TGACCAACTAGCTTCAATTTGGG - Intergenic
1203718252 Un_KI270742v1:176737-176759 TGACCAACTGGCTATAAATTAGG + Intergenic
1203532962 Un_KI270743v1:1485-1507 TGACCAACTGGCTATAAATTAGG - Intergenic
1203579638 Un_KI270745v1:30542-30564 TGAGAAACTTGCTTCAAATAGGG + Intergenic
1203610959 Un_KI270749v1:2972-2994 TGACCTACTGGCTTCAAGTTGGG - Intergenic
1203652470 Un_KI270751v1:140430-140452 TGACCAACTGTCTATAAATTAGG + Intergenic
1186143711 X:6603679-6603701 TGACCAATCAGCTTCAACTTGGG - Intergenic
1186487179 X:9942482-9942504 TGACCAACCACCTTCAAGTTGGG + Intronic
1186697046 X:12046537-12046559 TGACCAACCTGCATCAAGTTGGG + Intergenic
1187676297 X:21719828-21719850 AGAGAAACTGGCTTCACATTTGG + Intronic
1187862020 X:23691934-23691956 TGACTGACTGACTTCAAGTTGGG + Intergenic
1188597802 X:31922444-31922466 TGACCCATGGGCTTCAAGTTGGG - Intronic
1188611719 X:32107585-32107607 TGCCCGACTGCCTTCAAACTGGG - Intronic
1189091178 X:38084414-38084436 TGACCAACTGTCTTCAATTTGGG - Intronic
1189543831 X:42021160-42021182 TGCCCAGCTGGCTACATATTTGG + Intergenic
1189890815 X:45600428-45600450 AGACCAACTGGCTATAAATTGGG + Intergenic
1189948487 X:46204298-46204320 TGACAGACTGGCTTTAAGTTGGG - Intergenic
1189999935 X:46676153-46676175 TGACTGCCTGGCTTCAAGTTGGG - Intronic
1190111901 X:47595335-47595357 TGACCAACTAGCTATAAATCGGG - Intronic
1190441534 X:50479868-50479890 TGACCAACTGGCTACCAACTTGG + Intergenic
1190798651 X:53768822-53768844 TGACAAACTGGCTATATATTGGG + Intergenic
1191635698 X:63373669-63373691 TGACCAACTGGCCTGAAATGGGG + Intergenic
1191930701 X:66368272-66368294 TGACCAACTGGCTTTGAATTAGG + Intergenic
1194661443 X:96632465-96632487 TGCCAAACTGGCTTCAAAAGTGG - Intergenic
1194819799 X:98491409-98491431 TCACCAACAGGCTTTAAATTGGG - Intergenic
1195567049 X:106352403-106352425 TGGCCTAATGGCTTCAAATGGGG + Intergenic
1196783702 X:119404317-119404339 TGACCAACCAGCTTCAAGTTGGG + Intronic
1196802023 X:119552354-119552376 TGACCAACCAGCTTCAAGTTGGG + Intronic
1197070554 X:122291584-122291606 AGACCAACTGTCTGCAAATTGGG - Intergenic
1197210629 X:123825438-123825460 TGACTAACCGGCTTTAAGTTGGG - Intergenic
1197935366 X:131734922-131734944 AGACCAGCTGGCTCCAAACTGGG - Intergenic
1198409757 X:136354683-136354705 TGACTAACTGACTTCAACTTGGG + Intronic
1198588422 X:138148772-138148794 TGGCCAACTGGCTTCTAAAACGG - Intergenic
1198955116 X:142120768-142120790 TGACCCACAGGCTTCAAGTTGGG + Intergenic
1199230622 X:145433603-145433625 TGACCAACTAGCCAAAAATTTGG + Intergenic
1199898033 X:152143397-152143419 TGACAAACTGTCTTCAAAAGTGG + Intergenic
1201172407 Y:11281587-11281609 TGACCAACTGGCTATAAATTAGG + Intergenic
1201564026 Y:15347357-15347379 TGATTGACTGGCTACAAATTGGG - Intergenic
1201891565 Y:18948490-18948512 TGCCCAACCACCTTCAAATTGGG + Intergenic