ID: 1008952494

View in Genome Browser
Species Human (GRCh38)
Location 6:57175899-57175921
Sequence CTGACCAACTGGCTTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 3, 1: 33, 2: 95, 3: 192, 4: 396}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952494_1008952499 8 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952499 6:57175930-57175952 GAGGCCTAGACTTGCAACGGTGG 0: 1
1: 1
2: 2
3: 6
4: 44
1008952494_1008952500 11 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952500 6:57175933-57175955 GCCTAGACTTGCAACGGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1008952494_1008952502 12 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952502 6:57175934-57175956 CCTAGACTTGCAACGGTGGAGGG No data
1008952494_1008952504 16 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952504 6:57175938-57175960 GACTTGCAACGGTGGAGGGTGGG No data
1008952494_1008952503 15 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952503 6:57175937-57175959 AGACTTGCAACGGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 192
1008952494_1008952507 24 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952507 6:57175946-57175968 ACGGTGGAGGGTGGGGTCTTGGG No data
1008952494_1008952498 5 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952494_1008952506 23 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952506 6:57175945-57175967 AACGGTGGAGGGTGGGGTCTTGG No data
1008952494_1008952505 17 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952505 6:57175939-57175961 ACTTGCAACGGTGGAGGGTGGGG No data
1008952494_1008952508 25 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952508 6:57175947-57175969 CGGTGGAGGGTGGGGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952494 Original CRISPR CTGACCAACTGGCTTCAAAT TGG (reversed) Intronic
900009068 1:89766-89788 CTGAGAAACTTGCTTCAAATAGG - Intergenic
900025221 1:266579-266601 CTGAGAAACTTGCTTCAAATAGG - Intergenic
900028823 1:355961-355983 CTGAGAAACTTGCTTCAAATAGG - Intergenic
900327434 1:2115632-2115654 CTGACCAACTGGCTGTGAATCGG + Intronic
900708704 1:4097153-4097175 CTGACCACCTGGCTTCAAGCTGG + Intergenic
901295402 1:8157254-8157276 CTGACCGACTGACTGGAAATCGG - Intergenic
901385196 1:8903586-8903608 CTGAGTCACTGGCTTCAATTTGG - Intergenic
902285138 1:15403403-15403425 CTGACGGACAGGCTTCAAGTTGG + Intergenic
902585165 1:17434594-17434616 CTGACCAACTAGCCTCTAGTTGG - Intronic
903102216 1:21040500-21040522 TTGACTGACTGGCTTCAATTTGG - Intronic
903237483 1:21959582-21959604 CTGACCAACCAGCTATAAATTGG - Intergenic
903341371 1:22656808-22656830 CTGACCAATCAGCTTCAAGTTGG + Intronic
903519075 1:23933835-23933857 CTGACCGACTGGCTTCAAGCTGG + Intergenic
903696373 1:25210455-25210477 CTGACCAACTGGCTGTAAATTGG + Intergenic
904186833 1:28712052-28712074 CTGACCAACTGGCTATAAATTGG + Intronic
904218278 1:28942359-28942381 CTGACCAACTGGCTCCAAATTGG + Intronic
904542836 1:31245051-31245073 CTGATAAACTGGCTATAAATTGG + Intergenic
904726544 1:32552839-32552861 ATGATCATTTGGCTTCAAATTGG - Intronic
904934968 1:34123543-34123565 CTGACCAATTGGCTTCAAGTTGG - Intronic
904976926 1:34463799-34463821 CTGGCTAACTGGCTTCAATTGGG + Intergenic
905412066 1:37777531-37777553 CAGACCAACTCGCTATAAATTGG + Intergenic
905421471 1:37848717-37848739 CTGATAAAATGGCTTCATATGGG + Intronic
905691025 1:39942887-39942909 CTGACCTACTGGCTTCAAGTGGG + Intergenic
906482738 1:46210527-46210549 CTGACCAACCAGCTTCAAATTGG + Intronic
906853720 1:49281952-49281974 CTAACCAACTGCCTATAAATTGG - Intronic
907983127 1:59504349-59504371 CTGAACTACTGGCTTCAAGTTGG - Intronic
908008305 1:59749299-59749321 CTGACCAACTGACCGCAAATTGG - Intronic
909023031 1:70452977-70452999 CTGACTGACTGGCTTCAAGTTGG + Intergenic
909130069 1:71723769-71723791 TTGCCCAACTGGCTACAAATAGG - Intronic
909381742 1:75006333-75006355 CTGACCAACCACCTACAAATTGG - Intergenic
909446881 1:75757926-75757948 CTGGCTGACTGGCTTCAAGTTGG + Intronic
910881327 1:91924673-91924695 CTAACCAACTGGCTTCAAGTTGG + Intergenic
911747116 1:101452323-101452345 CTGACTGACTGTCTTCAAATTGG + Intergenic
911890962 1:103371298-103371320 CTGATCAACTGGCTGCAAATTGG - Intergenic
912261593 1:108116149-108116171 CTGACTGACTGGCTATAAATTGG - Intergenic
912667812 1:111598887-111598909 CCGACCAACTGACTTCAAGTTGG + Intronic
912731125 1:112106516-112106538 CTCACTCACTGGCATCAAATTGG + Intergenic
912913680 1:113789548-113789570 CTGACCAACTGGCTTCAAGTTGG - Intronic
913171877 1:116240526-116240548 CTCATCAACTGGCTCCAAGTTGG - Intergenic
913237511 1:116797584-116797606 CTGACCACCTGACTTCCAGTTGG - Intergenic
915183455 1:154083458-154083480 CTGACCAACTGGCCTCTAGTTGG - Intronic
915377790 1:155412675-155412697 CTGACCAACCAGCTTCAAGTTGG - Intronic
915696983 1:157753336-157753358 CTGACCAAATGGCTATAAACTGG + Intronic
915727338 1:158027127-158027149 CTGACTGGCTGGCTACAAATTGG + Intronic
916027892 1:160850890-160850912 CTGACCAACTAGCTATAAACTGG + Intronic
916211425 1:162363188-162363210 CTGACCAAGTGGCTATAAATTGG + Intronic
916480456 1:165209816-165209838 CGGATCAACTGGCTATAAATTGG - Intronic
917155306 1:171991352-171991374 CTGACTGACTGGCTATAAATTGG + Intronic
918272267 1:182913243-182913265 CTGACTGACTGACTTCAAGTTGG - Intronic
918490233 1:185073986-185074008 CTGACCAATTGGCTATAAGTTGG + Intronic
920452936 1:206073895-206073917 CTGACCAACTAGCCTTCAATGGG + Intronic
920809018 1:209264736-209264758 CTGACCTAATGGCTTCAAGTTGG - Intergenic
921224877 1:213008662-213008684 CTGACCAACAGGTTTAAAACAGG + Intronic
921295433 1:213696989-213697011 CTGACCCACTGGCTATAAACTGG + Intergenic
921701792 1:218276776-218276798 CTGACCACCTGCCTTCCCATTGG + Intergenic
921703582 1:218294393-218294415 CTGACCAACTGACTTAAAATTGG + Intronic
921830491 1:219723142-219723164 CTGGCCAATTGGCTTCAAGTTGG - Intronic
922761414 1:228134215-228134237 CTGACCAACTGGCTTCAAGTTGG + Intergenic
922805272 1:228383438-228383460 CTGACCAACTGGCTTTAAGTTGG + Intergenic
922843977 1:228668362-228668384 CTCATCAACTGGCTATAAATTGG - Intergenic
922966845 1:229697627-229697649 CTGACCCACCAGCTTCAAGTTGG + Intergenic
923074559 1:230598196-230598218 CTCACCAACTGGCTATAAATTGG + Intergenic
923301293 1:232643011-232643033 CTGACCAACTGGCTTCAAGCTGG - Intergenic
923804463 1:237243317-237243339 CTAACCAACTGGCTTTGAGTTGG + Intronic
923856196 1:237848074-237848096 CTGATCAGCCGGCTTCAAGTTGG + Intergenic
923884365 1:238138502-238138524 CGGACCAACTGGGTATAAATCGG + Intergenic
924177717 1:241409549-241409571 CTGACTAACTGCCTTCAAGCTGG + Intergenic
924676109 1:246179659-246179681 CTGACCATCTGGCTTCTTCTAGG - Intronic
924855176 1:247868643-247868665 CTGACCAACTGACTGTAAACTGG + Intronic
1064655519 10:17551772-17551794 CTGACCGACCGGCTTCAATTTGG - Intergenic
1064666146 10:17653987-17654009 CTGACCAACTGGATACAAACTGG - Intronic
1065053642 10:21820710-21820732 CTGACCAACTGGTTTCAAGTTGG + Intronic
1065208093 10:23375886-23375908 CTGACAAACCAGCTTCAAGTTGG - Intergenic
1065990670 10:31006607-31006629 CTGACCAACCTGCTATAAATTGG - Intronic
1067137481 10:43624272-43624294 CTGACCCACCAGCTTCAAGTTGG + Intergenic
1067169560 10:43895503-43895525 CTGACAGACTGGCTATAAATTGG - Intergenic
1067315842 10:45161194-45161216 CTAACCAGCTGGTTTCAAGTTGG - Intergenic
1067832579 10:49618859-49618881 GGGAACAACTGGCCTCAAATAGG - Intronic
1068459336 10:57306781-57306803 CTGACCAACCAGCTTCAAGTTGG + Intergenic
1068758665 10:60682925-60682947 CTGAGCAACTGGCTTCAAGTTGG - Intronic
1069176785 10:65300144-65300166 CTGACCAACTGGCTTCACATTGG - Intergenic
1069576496 10:69533724-69533746 CTGACCAACTGACTATAAATTGG - Intergenic
1070573741 10:77661253-77661275 CTGACCAAGTGGCTGTAAATTGG - Intergenic
1070764563 10:79048915-79048937 CTGAGCAAGTGGCTTCAGCTAGG + Intergenic
1071062468 10:81589126-81589148 CTGACCAACTAGATACAATTTGG + Intergenic
1071078558 10:81783345-81783367 CTGCCCAACTGGCAATAAATTGG + Intergenic
1071662484 10:87518680-87518702 CTGTTCAGCTGGCTTCAAGTTGG + Intronic
1071664839 10:87544135-87544157 CTGACTGACTGGCTTCAAGTTGG + Intronic
1071849771 10:89557061-89557083 CTGACCAATCAGCTTCAAGTTGG - Intergenic
1071928370 10:90437198-90437220 CTGACCAACTGGCCTAAGTTGGG - Intergenic
1072464202 10:95648066-95648088 CTGACTGACTGGCTTCAAGTTGG - Intronic
1073160859 10:101393366-101393388 CTGACTGACTGGCTTCAAGTTGG - Intronic
1073565088 10:104528080-104528102 CTGAACACCTGGCTGCACATGGG + Intergenic
1074065646 10:110010309-110010331 CTAACCAACTGCTTTGAAATGGG - Intronic
1074231017 10:111535480-111535502 AAGACCAACTGGCAGCAAATGGG - Intergenic
1075445973 10:122513308-122513330 CTGGCCAACTTGCTTATAATGGG - Intronic
1075940190 10:126384966-126384988 CTGACCAACTAGCTATAAGTTGG + Intronic
1076150257 10:128156273-128156295 CTGCCAAACTGTCTTCAAAGTGG + Intergenic
1076394067 10:130125694-130125716 CTGACCACCTGGCTGCTGATGGG + Intergenic
1077086225 11:752828-752850 CTGATCCACTGGCTTCAACTTGG - Intronic
1077551346 11:3201750-3201772 CTGACCAACTTGCTTCAAAGCGG - Intergenic
1078872144 11:15357594-15357616 CTGACCAACCAGCTTCAAGTTGG - Intergenic
1079187871 11:18253710-18253732 CTGACTGACTGGCTTCAAGTTGG - Intergenic
1079858949 11:25643383-25643405 CTGATTGACTGGCTTCAAGTTGG - Intergenic
1080121276 11:28680674-28680696 CTGAGAAACTGCCTGCAAATCGG - Intergenic
1080171406 11:29307585-29307607 CTGACCAACCGCCTATAAATGGG + Intergenic
1080244385 11:30163263-30163285 CTGCCTGACTGGCTTCAAGTTGG - Intergenic
1081306429 11:41517537-41517559 CTCACCAAATAGTTTCAAATTGG - Intergenic
1081322959 11:41713776-41713798 CTGACCGACTGGCATTAAATTGG + Intergenic
1081471036 11:43371344-43371366 CTAACCAACCAGCTTCAAGTTGG + Intronic
1082685324 11:56231531-56231553 TTGACCAACCTGCTTCAAGTTGG + Intergenic
1082853694 11:57787805-57787827 CTGACCACCTGGCTCTAATTTGG - Intronic
1083286460 11:61662313-61662335 CTGACCGACTGGTTTCAAGTTGG - Intergenic
1083810828 11:65105761-65105783 CTGACCAACTGGCTCCAGGTAGG + Intronic
1084719812 11:70897504-70897526 CTTACCTACTGATTTCAAATTGG + Intronic
1084993748 11:72955180-72955202 CTGACCAACCAGCTAAAAATTGG + Intronic
1085354395 11:75822556-75822578 CTTACCGACTGGCTATAAATTGG + Intronic
1085488606 11:76891580-76891602 CTGACCAACTGGCTTCAAGTTGG - Intronic
1086575157 11:88331316-88331338 CTGATGGACTGGCTTCAAATTGG + Intronic
1087023740 11:93629196-93629218 CTGACCAATGGTCTTCAAGTTGG - Intergenic
1087362461 11:97178108-97178130 CTGACAAACTGGCTATACATTGG + Intergenic
1088205101 11:107383187-107383209 CTGACCACCCAGCTTCAAGTTGG - Intronic
1089186849 11:116623326-116623348 CTGGCCAACTGTCTTCAAGCTGG - Intergenic
1089756853 11:120693704-120693726 CTGATAAACTGGCTTCCAAAAGG - Intronic
1089970554 11:122689738-122689760 CTCACTAACTGCCTTCAAGTTGG + Intronic
1091116507 11:133018547-133018569 TTGGCCATCTGGCTTCAAAAGGG - Intronic
1091577204 12:1748994-1749016 CTGACCAACCAGCTTCAAGTTGG + Intronic
1092177104 12:6417572-6417594 CTGATCAACTGGCTTCAAGTTGG + Intergenic
1092470147 12:8770852-8770874 CTGACCAACTGGCTTCAAGTTGG + Intronic
1092495062 12:8985554-8985576 CTGACCAATAAGCTTCAAGTTGG + Intronic
1092502508 12:9063319-9063341 ATGACCAACTGGCCTGAAATGGG + Intergenic
1092546550 12:9457082-9457104 CTGACCCACCAGCTTCAAGTTGG + Intergenic
1092612193 12:10184368-10184390 CTGACCTACTGGTTATAAATTGG - Intronic
1093703201 12:22246109-22246131 CTGACTGACTGGCTTCAAGTTGG - Intronic
1093708182 12:22298278-22298300 CTGACTGACTGGCTATAAATTGG - Intronic
1093762441 12:22925363-22925385 CCAACCAAATGGCTACAAATAGG + Intergenic
1093927196 12:24920785-24920807 CTGACCAACAGGTTTCAAGTTGG + Intronic
1093942216 12:25067523-25067545 CTGACCAACTCTCTATAAATTGG + Intronic
1094506392 12:31065000-31065022 CTGACCCACCAGCTTCAAGTTGG - Intergenic
1095043689 12:37474409-37474431 CTGACCTACTGGCTTCAAGTTGG + Intergenic
1095504131 12:42874496-42874518 CTGCCAAACTGTCTTCAAAGTGG + Intergenic
1095579806 12:43784476-43784498 CTGACCAACTGCCTTCAAGTTGG + Intronic
1095861576 12:46923739-46923761 CTAACCAACTGGCGATAAATTGG + Intergenic
1096393727 12:51249329-51249351 GTGACCAACCAGCTTCAAGTTGG - Intronic
1096710750 12:53453173-53453195 CTCAAGAAATGGCTTCAAATAGG + Intronic
1097729853 12:63116264-63116286 CTGACTGACTGGCTTCAAGCTGG + Intergenic
1097798117 12:63885208-63885230 CTGACCAACCAGATTCAACTTGG + Intronic
1098157800 12:67618290-67618312 CTGACCAACTAGCTACATATCGG + Intergenic
1098296699 12:69011352-69011374 CTGACTGACCGGCTTCAAGTTGG + Intergenic
1099371042 12:81829992-81830014 CTGACCAAGTGGCTTCAATTTGG - Intergenic
1100187885 12:92157074-92157096 CTGGTCTACTGGCTTCAAGTTGG - Intergenic
1100836625 12:98572711-98572733 CTGACCAACTGGCTTCAAGTTGG + Intergenic
1101462670 12:104912711-104912733 CTGACCAACTGGCTTTAAGCTGG - Intronic
1101567812 12:105925607-105925629 CTAATCAAATGGCTTCAAAGTGG + Intergenic
1101571581 12:105958635-105958657 CTGACCAATTGGCTATAAATTGG + Intergenic
1101582128 12:106050856-106050878 CTGACCAAGTGGCTTCAAGTTGG + Intergenic
1101772820 12:107767265-107767287 CTGACCAATTGGCTTCAAATTGG + Intergenic
1101879735 12:108618155-108618177 TTTAACAACTGGCTTCCAATGGG - Intergenic
1103286905 12:119810114-119810136 CTCGCTGACTGGCTTCAAATTGG - Intronic
1105501120 13:20972815-20972837 GTGACCAACTTGCGTAAAATGGG - Intergenic
1105923212 13:24984059-24984081 CTGACCCATTGGCTTCAAGTTGG - Intergenic
1106324952 13:28680181-28680203 CTGACCGACTGGTTGCAAATTGG + Intergenic
1106838232 13:33659170-33659192 CTGACCAACAGGCTATAAATTGG - Intergenic
1107018789 13:35730855-35730877 CCTACCAACTGGCTTCAAGTTGG + Intergenic
1107109665 13:36683135-36683157 CAGGCCAAATGGTTTCAAATGGG - Intronic
1107325271 13:39235267-39235289 GTGACCGACTGGCTATAAATCGG + Intergenic
1107360031 13:39607770-39607792 CTGACAAACTGGCTTCAAATTGG - Intergenic
1107655955 13:42592288-42592310 CTGACCAACCAGCTACAAATCGG + Intronic
1108233031 13:48370465-48370487 CTGACCAAAGGGCTTCAAGTTGG + Intronic
1108239130 13:48444149-48444171 CTGACCTACTGGCTTCAAATTGG + Intronic
1108252777 13:48583448-48583470 CTGACCTACTGGCTACAAATTGG + Intergenic
1108360043 13:49660829-49660851 CTGAACAACCTGTTTCAAATTGG - Exonic
1108830717 13:54475020-54475042 CTGACCTACTGGTTTCAAGGTGG + Intergenic
1109041164 13:57338823-57338845 CTGACCAACTGATTTCCAGTTGG - Intergenic
1109263249 13:60167745-60167767 CTGATCCACTGGCTTCAAGCAGG - Intergenic
1109459571 13:62638456-62638478 CTGACCCACTGGTTTCAAGTTGG + Intergenic
1109560814 13:64047775-64047797 GTGACAGACTGGCTTCAAGTTGG + Intergenic
1110381170 13:74852794-74852816 CTGAACGACTGACTTGAAATGGG - Intergenic
1110603583 13:77404400-77404422 CTGACCAACTGGCTTTGGAAAGG - Intergenic
1111509396 13:89241673-89241695 CTGACCAACTGGCTTCAAGTTGG + Intergenic
1111706885 13:91761523-91761545 CTGACCAACTGGCTTCAAGTTGG + Intronic
1111812474 13:93108037-93108059 CTGACCAAATGGCTACAAATTGG - Intergenic
1112285780 13:98103250-98103272 CTGACCAACTGGCTAGAAATGGG + Intergenic
1112498404 13:99923401-99923423 GTTACCACCTGTCTTCAAATAGG + Intergenic
1112592450 13:100776154-100776176 CTGACTGACAGGCTTCAAGTTGG + Intergenic
1113272127 13:108685328-108685350 CTGACCAACCAGCTACAAATTGG - Intronic
1114224766 14:20727349-20727371 CTGACCAACCAGCTATAAATTGG - Intergenic
1114273833 14:21123210-21123232 CTGACCAACTAGCTATAAATTGG - Intergenic
1115488895 14:33939806-33939828 CAGACCAACTGGGTTCAAAAAGG - Intronic
1115491727 14:33964732-33964754 CTGATCAACTGGCTATAAACCGG + Intronic
1115567694 14:34638892-34638914 CTGACTGACTGGCTTCAAGTTGG + Intergenic
1117272927 14:54163454-54163476 CTGACCAGCTGACTACAAATTGG + Intergenic
1118281952 14:64437654-64437676 CTGACCAACTGGTTATAAACTGG + Intronic
1118830415 14:69426275-69426297 CTGACCAACTGGCTTCAAGTTGG + Intronic
1118955034 14:70473224-70473246 CTGATCAACAAGCTTCAATTTGG + Intergenic
1119127086 14:72137516-72137538 CTGAGCAACTGGCCATAAATTGG + Intronic
1119308511 14:73627441-73627463 CTGACTAACTGGCTTCACGTTGG + Intergenic
1119572567 14:75688553-75688575 CTAACCACCTGGCTATAAATAGG - Intronic
1119653764 14:76402046-76402068 CTGCCCAATGGCCTTCAAATTGG - Intronic
1119844259 14:77816742-77816764 CTGACCAACCAGCTTCAAGCTGG - Intronic
1119922569 14:78459977-78459999 CTGACCAACTGGCTATAAATCGG + Intronic
1120163337 14:81168686-81168708 CTGACCAATCAGCTTCAAGTTGG - Intergenic
1120171954 14:81255038-81255060 CTGACCAACTGGTTATAAATAGG - Intergenic
1120513026 14:85438438-85438460 CTGACCAACTGGCTTCCAGTTGG - Intergenic
1121458746 14:94056671-94056693 CTGACCAACCAGCTTCAAGTTGG - Intronic
1121679881 14:95784664-95784686 CTGGCCAACCGGCTATAAATCGG - Intergenic
1122357679 14:101133303-101133325 CTGACCAGCTGGTTTCAGACGGG + Intergenic
1122584599 14:102796469-102796491 CTGACCCACCAGCTTCAAGTTGG - Intronic
1202916676 14_GL000194v1_random:180747-180769 ATTACCAACTGGCTTCTACTTGG + Intergenic
1202942223 14_KI270725v1_random:162006-162028 CTGACCTGCTGGCTTCGAGTTGG + Intergenic
1123479764 15:20620242-20620264 CTAATCAACTGGCTTCAAGCTGG - Intergenic
1123638242 15:22380122-22380144 CTAATCAACTGGCTTCAAGCTGG + Intergenic
1123775755 15:23578325-23578347 CTGACCAGTGGGCTTCAAGTTGG + Intronic
1124183743 15:27502658-27502680 CTGACCAACGGGCTTCAAGTTGG + Intronic
1124434319 15:29634718-29634740 CTGCCTGACTGGCTTCAAGTTGG + Intergenic
1124516157 15:30368818-30368840 CTGACCAAGTGTCTATAAATCGG - Intronic
1124726763 15:32161913-32161935 CTGACCAAGTGTCTATAAATCGG + Intronic
1124836331 15:33199121-33199143 CTGACCAACCAGCTTCAAGCTGG - Intergenic
1126187009 15:45840697-45840719 CTGACCAATTGGCTATAAACTGG + Intergenic
1126291193 15:47081451-47081473 CTGACCTACTGGCTTCAAGTTGG - Intergenic
1126312556 15:47334357-47334379 CTGACTGACAGGCTTTAAATGGG - Intronic
1126313134 15:47339275-47339297 CTGAGTAACTGGCTTCAAGCTGG - Intronic
1127029365 15:54844945-54844967 CTGACTAACTGGCTACAAGTTGG + Intergenic
1127533246 15:59865424-59865446 CTGACCAACTGGCTTCAAGTTGG - Intergenic
1127787767 15:62371434-62371456 CTGACCAACTGGCTTCAAGTTGG + Intergenic
1127890488 15:63246362-63246384 CTGACCAACTGGCTATAAATTGG + Intronic
1128073463 15:64811552-64811574 CTGACCGACTGGCTTCAAGTTGG - Intergenic
1128286672 15:66442802-66442824 CTGACTGACTGGCTTTAAGTTGG + Intronic
1128461209 15:67869124-67869146 CGGACCAACTGACTTCAAGTTGG - Intergenic
1128624493 15:69185889-69185911 CTGACCAACTGGTTTCAAGTTGG + Intronic
1128828072 15:70739499-70739521 CTTACAAACTGGCTTTATATTGG + Intronic
1128864627 15:71105212-71105234 TTGACCAACCAGCTGCAAATTGG + Intronic
1129064491 15:72889608-72889630 CTGATCACCTGGCTTCAAGTTGG - Intergenic
1130074346 15:80675846-80675868 CTGACTGACTGGCTATAAATTGG - Intergenic
1130127174 15:81103738-81103760 GTGACCTTCTGGCTTCAAGTTGG - Intronic
1130317232 15:82807173-82807195 CTGCCTAACTGCCTTCAAGTGGG - Intergenic
1130740230 15:86591456-86591478 CTGACCCACTGGCTTGAAGTTGG + Intronic
1130823449 15:87519185-87519207 CTGACCAACAGGCTATAAATTGG + Intergenic
1131012205 15:89027656-89027678 CTGACCAACTGGGGAGAAATAGG + Intergenic
1131353339 15:91721701-91721723 CTGACCAACCAGCTTCAAGTTGG + Intergenic
1131698234 15:94903532-94903554 CTGACCAACTAGCTAAGAATTGG - Intergenic
1131709229 15:95034685-95034707 CTGGCCAACTGGCTTCAAATTGG - Intergenic
1132257356 15:100387362-100387384 CTGACCAACTGGCTACACACTGG - Intergenic
1132277838 15:100584840-100584862 CTGATCAACTGGCTCTAAATTGG + Intronic
1132425237 15:101710394-101710416 TTGACCTACAGGCTACAAATCGG - Intronic
1133471565 16:6080971-6080993 ATGACAAACAGTCTTCAAATTGG - Intronic
1134098266 16:11434003-11434025 CTGACCAACTGGCTGTAACTTGG - Intronic
1134164651 16:11920379-11920401 CTGACCAACTGGCTATGAATTGG + Intergenic
1134485030 16:14651210-14651232 CTGACCCACCAGCTTCAAGTTGG + Intronic
1134804692 16:17114296-17114318 CTGACCAAATGGTTTCAAACTGG - Intronic
1135082960 16:19452108-19452130 CTGACCAACCAGCTTCAAGTTGG + Intronic
1135256769 16:20947457-20947479 CTGACCAACCAGCTTCACGTTGG - Intronic
1135955993 16:26956626-26956648 CTGACCAACTGGCTTCAAGCTGG + Intergenic
1136423255 16:30150847-30150869 CTGACCGACTGGCTTCAAATTGG + Intergenic
1137697635 16:50472621-50472643 CTAACTAACTGGCTTCAGGTTGG - Intergenic
1138998867 16:62484546-62484568 TTGACCAAATTGCTACAAATTGG + Intergenic
1139140820 16:64260427-64260449 CTGAACAACCTGTTTCAAATTGG - Intergenic
1140261576 16:73384939-73384961 CTGACCCACTGGGTTCCCATGGG + Intergenic
1140389503 16:74572821-74572843 CTGACCAACCTGCTATAAATTGG - Intronic
1140615994 16:76664565-76664587 CTAAACACCTGACTTCAAATGGG + Intergenic
1140671747 16:77286368-77286390 CTGACAAGCTTGCTTCAAAATGG - Intronic
1140765096 16:78150106-78150128 CTGACTCACTGGCTACAAATTGG + Intronic
1140774810 16:78239947-78239969 CTGTCCAACTGGCTTAGAACCGG - Intronic
1140916120 16:79494828-79494850 CTGACAAACTGGCTATAAATTGG + Intergenic
1142063876 16:88049202-88049224 CTGGCCAACCGGCTTCAGGTTGG + Intronic
1142455268 16:90217195-90217217 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1143009636 17:3858837-3858859 CTGTCCCACCGGCTTCAAGTTGG - Intergenic
1143240615 17:5439968-5439990 CCGACCAACCCGCTTCAAGTTGG - Intronic
1144941603 17:18946154-18946176 CTGACCCACAAGCTTCAAGTTGG + Intergenic
1145081081 17:19894878-19894900 CTGACCAACTGGCTATTTATTGG - Intergenic
1145099815 17:20065358-20065380 CTGACCAACTGGCTTCAAGTTGG + Intronic
1145257527 17:21335007-21335029 CTGGCCAACTAGCTTGAAATTGG + Intergenic
1145319113 17:21753028-21753050 CTGGCCAACTAGCTTGAAATTGG - Intergenic
1145923212 17:28626909-28626931 CTCACCAACTGGCTATAAACGGG - Intronic
1146401277 17:32501867-32501889 CTGACCAACCAGCTTCCAGTTGG - Intronic
1146809785 17:35894008-35894030 CTGACCAGCTGGCTTCAAGTTGG + Intergenic
1146995339 17:37315554-37315576 CTGACCAACCAGCTATAAATCGG + Intronic
1147722043 17:42545357-42545379 CTGACTAACTGGCTTCAAGTTGG + Intergenic
1147738376 17:42655395-42655417 CTGACCAGCAGGCTTTAAGTTGG - Intergenic
1147807224 17:43140399-43140421 CTGACCAACTGGCTATAAATTGG - Intergenic
1148169120 17:45504657-45504679 CTGACCAACTGGCTGTAAATTGG - Intergenic
1148279700 17:46338351-46338373 CTGACCAACTGGCTGTAAATTGG + Intronic
1148301918 17:46556207-46556229 CTGACCAACTGGCTGTAAATTGG + Exonic
1148366404 17:47058718-47058740 CTGACCAACTGGCTATAAATTGG + Intergenic
1148378030 17:47167885-47167907 CTGATCAACTAGCTATAAATTGG + Intronic
1149347656 17:55754268-55754290 CTGACCAACTGGCTGTAAATAGG + Intronic
1149457188 17:56797447-56797469 CTGGCCAGCTGGCTTCTGATTGG - Intronic
1149827907 17:59846578-59846600 CTGGGCAACTGACTTCAAGTGGG + Intergenic
1150400314 17:64851123-64851145 CTGACCAACTGGCTATAAATTGG - Intergenic
1150430418 17:65111358-65111380 CTGGGCAACTGGTTACAAATTGG + Intergenic
1151607082 17:75144637-75144659 CTGACCGACTGGCTTCAAATTGG - Intronic
1152051290 17:77980698-77980720 CTGACCCACTAGCTTCAAGTTGG + Intergenic
1152413461 17:80143377-80143399 CTGACCAAGCAGCTTCAAGTTGG - Intronic
1152852021 17:82642554-82642576 CAGACTGACTGGCTTCAAGTTGG - Intronic
1152950935 17:83230596-83230618 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1153215546 18:2817107-2817129 CTGTCCAAGTGGCTATAAATTGG - Intergenic
1153415163 18:4838336-4838358 CTGACCAACTGACTTCAAGTTGG + Intergenic
1153503391 18:5770967-5770989 CTAACCAACTGGCTTCAAGTTGG + Intergenic
1153694010 18:7622036-7622058 CTGCCCAACTGTCTTCTAAGTGG + Intronic
1153887839 18:9482838-9482860 CTGACCAAATAGCTATAAATAGG - Intronic
1154334857 18:13457163-13457185 CTGACCGACTGGCTTCAGGTTGG + Intronic
1154476843 18:14768433-14768455 CTAACCAGCTGGTTTCAAGTTGG - Intronic
1155101076 18:22610473-22610495 CTTACCTATTGGCTTTAAATTGG - Intergenic
1156646357 18:39166480-39166502 TTGACCAACTGGCTGTAAATTGG - Intergenic
1156962621 18:43051015-43051037 GTGACCAACTGGCTTCACGTTGG - Intronic
1157807342 18:50667976-50667998 CTGATGGACTGGCTTCAAGTTGG + Intronic
1157959013 18:52131741-52131763 CTGACTGACTGGCTTCAAGTTGG + Intergenic
1158573540 18:58616842-58616864 CTGACTGACTGGCTTCAAGTTGG - Intronic
1158889866 18:61862799-61862821 CTGACCCACCAGCTTCAAGTTGG - Intronic
1159017674 18:63114918-63114940 CTGACCAACAAGCTTCAAGTTGG - Intergenic
1160119838 18:76120523-76120545 CTGCCCTACTGCCTTCAAACTGG + Intergenic
1160418588 18:78728684-78728706 CTGACCAACCAGCTTCAAATTGG - Intergenic
1161909089 19:7179279-7179301 CTGACTAACTGGCTCTAAATTGG - Intronic
1162574340 19:11490101-11490123 CTGACCAATGGGCTCTAAATGGG + Intronic
1164538134 19:29101918-29101940 CTGACCAATTGGCTTCAAGTTGG - Intergenic
1164546433 19:29168508-29168530 CTGACCATGTGTCTTAAAATGGG + Intergenic
1164717595 19:30404890-30404912 CTGACCAACAGGCTTCACGTTGG + Intronic
1164718004 19:30407560-30407582 CTGACCAACAGGCTTCACTTTGG + Intronic
1165818804 19:38661176-38661198 CTGACCTACTGGCATCTAAGAGG - Intronic
1165985904 19:39768684-39768706 CTGACCAACTGGCTATAAATTGG + Intergenic
1167803292 19:51760588-51760610 CTGACTGACTGGCTATAAATCGG - Intronic
1167842623 19:52134455-52134477 CTGACCTACTGACTCCAAATTGG - Intronic
1168125969 19:54283092-54283114 CTGACTGACTGGCTTCAAGTTGG - Intergenic
1168171306 19:54591696-54591718 CTGACTGACTGGCTTCAAGTTGG + Intronic
1168176004 19:54628461-54628483 CTGACTGACTGGCTTCAAGTTGG + Intronic
926007562 2:9384529-9384551 CTGACCAACCGGCTTCAAGTTGG + Intronic
926022978 2:9513413-9513435 CTGACCAACTGGCTTCAAGTTGG - Intronic
926511382 2:13784369-13784391 CTGACAAACTGCCTTCCAAAAGG - Intergenic
927164037 2:20299122-20299144 CTGACCGACTGGCTTCAAGTTGG - Intronic
927666857 2:25038892-25038914 CTGACCAACTGGCTTCAAGTTGG + Intergenic
928330787 2:30356453-30356475 TTGACCAACCGGCTATAAATTGG + Intergenic
928444692 2:31322564-31322586 CTGGCCAACTGGCTATAAATAGG - Intergenic
928491308 2:31786117-31786139 CTGACTTACTGGCTATAAATTGG - Intergenic
929983744 2:46705226-46705248 CTGACCAACCGGCTATAAACTGG - Intronic
931414686 2:62070093-62070115 CTGACCAACTGGCTATAAATTGG + Intronic
931438994 2:62274030-62274052 CTGACCAACTGGCCATAAATTGG - Intergenic
931613048 2:64124908-64124930 CTGACCAACTAGCTATAAATTGG + Intronic
932651871 2:73566778-73566800 CTGACCAACTAGCTCCAAATTGG + Intronic
933281873 2:80340876-80340898 CTGACCGACTGTCTATAAATTGG + Intronic
933553806 2:83807697-83807719 CTGACTGACCAGCTTCAAATTGG + Intergenic
933725847 2:85426800-85426822 CTGACCAACTGGCTTCAAGCTGG - Intronic
934025543 2:87999063-87999085 CTGACCAAGTGGTTAGAAATTGG - Intergenic
934124345 2:88871981-88872003 CTGACCACCTGGAATCAAACTGG + Intergenic
935184344 2:100718072-100718094 CTGACTGAGTGGCTACAAATAGG + Intergenic
935242389 2:101189998-101190020 CTGACCAACTGGCTTCAAGTTGG - Intronic
935398937 2:102640443-102640465 TTGACCAGCTGGCTACAAACTGG + Intronic
935445705 2:103154201-103154223 CTGAGCAACTGTCTTCTAATGGG - Intergenic
935695606 2:105768469-105768491 CTGATCAACTGGCTGTAAATTGG + Intronic
936002803 2:108851029-108851051 CTGACCAACTGGCTTCAAATTGG + Intronic
937356147 2:121199363-121199385 CTGACATACTGACTTCAAGTTGG - Intergenic
937511031 2:122595158-122595180 CTGACTGACTGGCTATAAATTGG + Intergenic
937721169 2:125098706-125098728 CTGACTTACTGGCCTCAAAAGGG - Intergenic
937968810 2:127534545-127534567 CTGACCAATTGGCTATAAATCGG + Intergenic
938708601 2:133955765-133955787 CTGACCAACAGGCTATAAATTGG - Intergenic
939061012 2:137421377-137421399 CTGACCAACTGGCTTCAAGTTGG + Intronic
940327209 2:152437863-152437885 CTGAGTGAATGGCTTCAAATTGG - Intronic
941299861 2:163787793-163787815 CTTACCAAATGGCTACAAGTTGG + Intergenic
941790450 2:169547062-169547084 CTGAGCAACCGGCTTCAAGTTGG + Intronic
942224353 2:173802317-173802339 AGGACCAACTAGCTTCAAGTTGG + Intergenic
942483928 2:176419483-176419505 CTGTCCAAATGGCTTCAAGGAGG - Intergenic
942745286 2:179224991-179225013 CTGACTGACTGGCTATAAATTGG - Intronic
943471918 2:188305073-188305095 CTGACCCACTGACTTCAAGCTGG + Intronic
943619445 2:190131632-190131654 CTGATCAGCTGGCTATAAATTGG - Intronic
943771509 2:191722515-191722537 CTGACCAGCTGGTTTCAAGTTGG + Intergenic
943886793 2:193228411-193228433 CTGACCAACCTGTTTCAAGTTGG - Intergenic
944764039 2:202846464-202846486 CTGACCCACCAGCTTCAAGTGGG + Intronic
944861414 2:203819108-203819130 CTGACTGACTGGCTATAAATTGG + Intergenic
944925439 2:204459138-204459160 CTGGTCTCCTGGCTTCAAATAGG - Intergenic
945517644 2:210782866-210782888 CTGACCAATTGGTTTCCAGTTGG + Intergenic
945549160 2:211197695-211197717 CTGAACAGCTGGCTTCAAGTTGG - Intergenic
945951393 2:216042060-216042082 CTGACTGACTAGCTTCAAGTTGG - Intronic
946375304 2:219304679-219304701 CAGAGGAACTGGCTTTAAATAGG - Intronic
946476545 2:220011640-220011662 CTGACCAGCCTGCTTCAAGTTGG - Intergenic
946811637 2:223531400-223531422 CTGACCCACTGGCTTCAAGTTGG - Intergenic
947318255 2:228887719-228887741 CTGATAAACTGCCTTCTAATTGG + Intronic
948843104 2:240668237-240668259 CTGACAATCTGTCTTCTAATTGG - Intergenic
949086749 2:242161921-242161943 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1169232075 20:3896919-3896941 CTGATCAACTGGCTTCAAGTTGG - Intronic
1169714807 20:8603447-8603469 ATCACCAGCTGGCTCCAAATGGG + Intronic
1170024107 20:11870123-11870145 CTGACCGACCAGCTTCAAGTTGG - Intergenic
1170199986 20:13732088-13732110 CTGATTGACTGGCTTCAAGTTGG - Intronic
1170355030 20:15482637-15482659 CTGACAAACTGTCTTCTAAAGGG + Intronic
1171318207 20:24214517-24214539 CTGGCCAACTGGCTGTAAATTGG - Intergenic
1171480229 20:25449679-25449701 CTGACCAACTAGCTTCAAGTTGG + Intronic
1171538146 20:25917142-25917164 CTGACCTACTGGGTTCAAGTTGG + Intergenic
1171802994 20:29644299-29644321 CTGACCTACTGGCTTCAAGTTGG - Intergenic
1171841087 20:30212443-30212465 CTGACCTACTGGCTTCAAGTTGG + Intergenic
1172411039 20:34723135-34723157 CTGACTAGCTGGCTAAAAATTGG - Intronic
1173348502 20:42222853-42222875 CTGTCCAACAGGCTTCAAGTTGG - Intronic
1174031497 20:47632106-47632128 CTGACTGACTGGCTATAAATTGG + Intronic
1175012537 20:55754304-55754326 CTGACCAACCTCCTTCAAGTTGG + Intergenic
1176305773 21:5122355-5122377 CTGACCAGTTGACTTCAAGTTGG - Intronic
1176580950 21:8524924-8524946 CTGACCTGCTGGCTTCGAGTTGG - Intergenic
1176636031 21:9195394-9195416 ATTACCAACTGGCTTCTACTTGG + Intergenic
1177491557 21:21832149-21832171 CTGCCTGACTGCCTTCAAATTGG - Intergenic
1178000615 21:28158539-28158561 CCAACCAACTGGCTTCAAGTTGG + Intergenic
1178856783 21:36257023-36257045 CTGACTGACTAGCTTCAAGTTGG + Intronic
1179024876 21:37671571-37671593 CTGACCAACTGGCTGTAAATTGG - Intronic
1179258383 21:39737487-39737509 CTGACCGACCGGCTTCAAGCTGG + Intergenic
1179489059 21:41728453-41728475 CTGCCCAGCTGGCTCCAAAAGGG + Intergenic
1179851285 21:44139676-44139698 CTGACCAATTGGCTTCAAGTTGG + Intronic
1181093570 22:20491002-20491024 CTGACCAATAGGCTATAAATTGG + Intronic
1181378600 22:22480929-22480951 CTGACTGACTGACTTCAAGTTGG - Intergenic
1181588509 22:23867977-23867999 CTGACCAACTGGCCATCAATTGG - Intronic
1181696924 22:24597960-24597982 CTGACTAACTGGCTTCTAGTTGG + Intronic
1183006297 22:34905473-34905495 CTGACCAACAAGCTTCAAGTTGG - Intergenic
1184334203 22:43843881-43843903 CTCACCCACTGGCTATAAATTGG - Intronic
1184339587 22:43879007-43879029 CGGACCACCTGGCTCCAAGTGGG + Intergenic
1184725416 22:46342189-46342211 ATGACCAACTGGCTTCCAGTTGG + Intronic
949321844 3:2820193-2820215 CTGACTAACTGGCTATAAAGTGG + Intronic
949881756 3:8666810-8666832 CTGACCAACCTGCTTCAAGTTGG + Intronic
949966206 3:9358688-9358710 CTGACCAACAGGCTTTAAGTTGG + Intronic
950071371 3:10155446-10155468 CTGACCAACCAGCTTCAAGTTGG - Intergenic
951891953 3:27575799-27575821 CTGACCAACCAGCTTTAACTTGG + Intergenic
951904971 3:27696477-27696499 CAGTCCAACTGGCTGCACATAGG - Intergenic
952184558 3:30954560-30954582 ATGAGCAATTGGCCTCAAATGGG + Intergenic
952360702 3:32627471-32627493 CTGACCAGCTAGCTATAAATTGG + Intergenic
953441912 3:42925526-42925548 CTGAAAAACTGGCTATAAATTGG + Intronic
953882440 3:46697646-46697668 CTGACCAACTGGCTTCACGCTGG - Intergenic
954057786 3:48042122-48042144 CTGACTGACTGGCTATAAATTGG - Intronic
954797777 3:53170235-53170257 CTGCCCATCTGGCCTCCAATGGG - Intronic
955383693 3:58461606-58461628 CTGACCAACCAACTACAAATCGG - Intergenic
956272502 3:67462733-67462755 CTCACCAACCGGCTATAAATTGG - Intronic
956708085 3:72016587-72016609 CTGACCAACGAGCTACAAATTGG - Intergenic
957026963 3:75193129-75193151 CTGACCAACCAGCTTCAAGTTGG + Intergenic
957837537 3:85617231-85617253 CTGACCAACTGGCCTCAAGTTGG + Intronic
959020232 3:101180930-101180952 GTGACTGACTGGCTTCAAGTTGG - Intergenic
959477779 3:106832353-106832375 CTGACCACCTGGCTTCCTGTTGG - Intergenic
959943690 3:112105884-112105906 CTGACCAACCAGCTGCAAATTGG + Intronic
959971642 3:112416593-112416615 CTGACCAACCAGCTTCAAGTTGG + Intergenic
960848536 3:122027854-122027876 CTGACCGTCTGGCTATAAATTGG - Intergenic
961431042 3:126883285-126883307 CTGACCAATCGGCTTCGAGTTGG - Intronic
961572943 3:127813444-127813466 CTGGCCAAATGGCTTCCCATGGG + Intronic
961694225 3:128693093-128693115 CTGACCAATTGGCTATAAACTGG + Intergenic
961841691 3:129719477-129719499 CTGACCAACTGGCTGTAAATTGG - Intronic
962056011 3:131872429-131872451 CTGCCTAACTGCCTTCAAACTGG - Intronic
962182297 3:133220829-133220851 CTGACCAACTGGCTGTAAATTGG + Intronic
962326700 3:134440478-134440500 CTGACTGACTGGCTTCAAGTTGG + Intergenic
963154940 3:142086402-142086424 CTGACCAACCAGCTATAAATTGG + Intronic
963192163 3:142484646-142484668 CTGACCAACTGGCTTCAAGTTGG - Intronic
963313938 3:143738705-143738727 CTGACCCACTGTCTAGAAATTGG + Intronic
963994022 3:151685543-151685565 CTGACCAACTGGTTTCAAACTGG - Intergenic
964109309 3:153072714-153072736 CTGACTGACTGGCTTCAAATTGG + Intergenic
964138557 3:153371510-153371532 CTGACCCACTGGCTTCAAGTTGG - Intergenic
964745227 3:160006067-160006089 CTGATCCACTGGCTACAAATTGG - Intergenic
965082577 3:164053768-164053790 TTGACCAACCAGCTTCACATTGG + Intergenic
966567336 3:181397647-181397669 CTGACTAACTGACTGTAAATTGG + Intergenic
967163486 3:186759788-186759810 CTGACCAACAGGCTTCAGGTTGG + Intergenic
967195484 3:187022075-187022097 CTGACCAACCAGCTTCCATTGGG - Intronic
967252605 3:187557290-187557312 CTGACAATCTGTCTTTAAATTGG - Intergenic
967469902 3:189849303-189849325 CTGACCAACCAGCTTCAAATTGG - Intronic
967776404 3:193390873-193390895 CTGACCAACTGGGTATAAACTGG + Intergenic
967910990 3:194542326-194542348 CTGAGCAACTGGCTTCAAGTTGG - Intergenic
968250298 3:197204384-197204406 CAGACAAACTGTTTTCAAATGGG + Intronic
968744194 4:2351051-2351073 CTGTCCAGCTGGCTATAAATCGG - Intronic
969128357 4:4971549-4971571 CTGACCCACTGGCTATAAATTGG + Intergenic
969862740 4:10050644-10050666 TTAACCAACTGGCTATAAATTGG + Intronic
970114148 4:12674470-12674492 CTCACCACCTGGCTGCCAATGGG + Intergenic
970529948 4:16971225-16971247 CTGACCCACTGGCTTCAAGTTGG + Intergenic
971394129 4:26213159-26213181 CTGACCTACTGACTTCAAGTTGG - Intronic
971640519 4:29126315-29126337 CTGACCAACAGGTTTCAAGTTGG - Intergenic
972353565 4:38259900-38259922 CTTACCAACTGGCTTCCAGATGG + Intergenic
972702383 4:41506982-41507004 CTGTCCACTTGGCTACAAATTGG + Intronic
972766945 4:42159931-42159953 CAGACCTACTGGCTTCACGTTGG + Intergenic
972807203 4:42541442-42541464 CTGACAAACTGTCTTCCAAGTGG - Intronic
974456405 4:62134128-62134150 CTGACTGACTGGCTTCAAGGCGG - Intergenic
975381843 4:73709718-73709740 CTGAGCAATTGGCTTCATCTAGG + Intergenic
976282741 4:83341314-83341336 CTTACCAACATGCTTCAAGTTGG + Intergenic
977718386 4:100209629-100209651 CTGACCAACTGGCTTCAAGTTGG - Intergenic
978132466 4:105214934-105214956 CTGACCAACCAGCTTCGAGTTGG - Intronic
978846984 4:113285409-113285431 CTGACCTACTGGCTTCAAGTTGG + Intronic
979643926 4:123044543-123044565 CTGACAAACTGTTTTCAAACTGG + Intronic
980121795 4:128735260-128735282 CTGACCCATTGGCTTCAAATTGG + Intergenic
980312685 4:131154178-131154200 CTGACCAACCAGCTTCGAGTTGG + Intergenic
980323501 4:131309522-131309544 CTTCCTAACTGGCTTTAAATTGG - Intergenic
980692549 4:136313907-136313929 CTGATCAGCTGGCTTCAAGTTGG - Intergenic
981138819 4:141243224-141243246 CTGACAATCTGTCTTCTAATTGG + Intergenic
981396194 4:144252664-144252686 CTGACTAACTGGCTCTAAATTGG - Intergenic
981483781 4:145263679-145263701 CTGATCAACTGGCTTCAAGCTGG + Intergenic
981643529 4:146972733-146972755 CTGATCAACTGGCTATAAGTTGG + Intergenic
981731967 4:147909072-147909094 CTGGCTAACTGGCTATAAATTGG + Intronic
981889401 4:149717175-149717197 CTCAACAACTGGCTATAAATTGG - Intergenic
982084486 4:151819714-151819736 CTGACCCACTGGCTTCAACTTGG - Intergenic
982772981 4:159415059-159415081 CTGACCAAAAGGCTTCCAGTTGG - Intergenic
982996708 4:162358001-162358023 CTCACCAACTGGAGTCAAACTGG - Intergenic
983490675 4:168385520-168385542 ATGACCAACTGGCTTCAAGTTGG - Intronic
983626138 4:169803742-169803764 CTCACCCAATGGCTTCAAGTTGG - Intergenic
983768607 4:171519338-171519360 CTGACTGACTGGCTTCAAGTTGG + Intergenic
984232495 4:177115630-177115652 CTGACCAACCAGCTATAAATTGG - Intergenic
984270989 4:177548552-177548574 CTAATGCACTGGCTTCAAATTGG - Intergenic
984517458 4:180758095-180758117 CTGACCCACTGGCTTCCAGTTGG - Intergenic
985406111 4:189639795-189639817 CTGATCAATGGGCTTCAATTTGG - Intergenic
986542871 5:8865530-8865552 TTTACAAACTGGCTTCGAATTGG - Intergenic
986844129 5:11733189-11733211 CTGACCAACAGGCTTCAGCTGGG - Intronic
986884257 5:12214578-12214600 CTGAGCAGCAGGCTTCAAACAGG + Intergenic
988099022 5:26655131-26655153 CTGACCAACTGGCTTCATGATGG + Intergenic
988276850 5:29091532-29091554 TTGACCAACTGTCTTCCAAGTGG + Intergenic
988400273 5:30752792-30752814 CTGACTGACTGGCTTCAAGTTGG + Intergenic
989186630 5:38632379-38632401 CTGATCAACCAGCTTCAAGTTGG - Intergenic
989624433 5:43415759-43415781 CTGAACAGCTGGCTCCAAGTTGG - Intergenic
990604522 5:57395497-57395519 CTGACTGACTGGCTTCAAGTTGG + Intergenic
992712720 5:79476513-79476535 CTGACCAACTGGCTTTGAGTTGG + Intronic
993336845 5:86670440-86670462 CTGACCAACTTGCTTCAAGTTGG - Intergenic
993857789 5:93097427-93097449 CTGACCGACTGTCTTTAAGTTGG + Intergenic
994637861 5:102364701-102364723 CTCACCGACAGGCTCCAAATTGG + Intergenic
995379637 5:111517830-111517852 CTGACCTACTGGCTTCAAGTTGG - Intergenic
995450240 5:112291922-112291944 CTGACCAACTGGCTTCAAGTTGG - Intronic
995795463 5:115936677-115936699 CTGACCAACTGGCTTCAAGTTGG - Intergenic
996092406 5:119363853-119363875 TTGACCAACTGGGTATAAATTGG + Intronic
996707694 5:126513683-126513705 CTGACCAATTGCCTTTAAATTGG - Intergenic
996866106 5:128124417-128124439 CTGACCAACTGGCTATATATTGG + Intronic
996953609 5:129157349-129157371 CTGACCAACTAGCTTCAAGATGG - Intergenic
997005762 5:129814635-129814657 CTGACTGACTGGTTTCAACTTGG + Intergenic
997016526 5:129941850-129941872 CTGACCAACTGGCTTCAAGCTGG + Intronic
997316305 5:132939479-132939501 CTAACAACCAGGCTTCAAATAGG + Intronic
998605700 5:143632537-143632559 CTGACCAACCAGCTTCAAGTTGG + Intergenic
998741143 5:145203407-145203429 CTTACCATCTGGATTCAAGTTGG - Intergenic
999432406 5:151535677-151535699 CTGACCAACCAGCTTCAAGTTGG - Intronic
999712204 5:154328716-154328738 CTGACCAGCCGGCTGTAAATTGG + Intronic
1000053151 5:157579323-157579345 CTGACCAACTGGCTTCCAGTTGG + Intergenic
1000772152 5:165368132-165368154 CTGATTAACTGGTTTCAAGTTGG + Intergenic
1000813557 5:165891684-165891706 CTGACCTACTGGCTATAAATTGG - Intergenic
1001217205 5:169867004-169867026 CTGACTGACTAGCTTCAAGTTGG + Intronic
1001431217 5:171663881-171663903 CTGACAAACTGTCTTCCAAAGGG + Intergenic
1001467746 5:171983436-171983458 CTGACCAACTTGCTTCAAGTTGG - Intronic
1001612686 5:173016120-173016142 CTGACCAACTGGCTATAAATCGG - Intronic
1001755244 5:174163605-174163627 CCGACAGACTGGCTTCAAGTTGG + Intronic
1001985371 5:176070064-176070086 CTGGCCAACTGTCTTCAAATTGG - Intronic
1002231499 5:177768055-177768077 CTGGCCAACTGTCTTCAAATTGG + Intronic
1002288215 5:178179835-178179857 CTGACCAATTGGCTATACATTGG + Intergenic
1002659761 5:180783746-180783768 CTGACCAACTGGGTTCAAGTTGG - Intergenic
1002745167 5:181464410-181464432 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1002808498 6:602517-602539 CTTACCAGCTGCCTTAAAATTGG - Intronic
1002837772 6:879777-879799 CTGACAAACTGGCTTCAAGTTGG - Intergenic
1003188904 6:3855833-3855855 CTGATCAACTGGCTATAAATTGG - Intergenic
1003192845 6:3889421-3889443 CTGACCTATTAGCTTCAAGTTGG - Intergenic
1003262433 6:4531696-4531718 CTGACTGACTAGCTTCAAGTTGG + Intergenic
1003400139 6:5784139-5784161 CTGACCCATTGGCTTCAAGTTGG - Intergenic
1003610884 6:7614170-7614192 CTGATGAACTGGCTATAAATTGG + Intergenic
1004278208 6:14256757-14256779 CTGATCTACTGTCTTCAAGTTGG + Intergenic
1004687171 6:17957544-17957566 CTGACCTACCAGCTTCAAGTTGG - Intronic
1004801846 6:19157219-19157241 CTGACCAACTGGCTATAAATTGG + Intergenic
1005023695 6:21442272-21442294 TTGACCAACTGGCTTAAGTTGGG - Intergenic
1005976601 6:30804880-30804902 CTGACCCACCAGCTTCAAGTTGG + Intergenic
1006473267 6:34239971-34239993 CTGCCCAACTGGAGTCAGATGGG - Intronic
1006483596 6:34319341-34319363 CTGACCAACTAGCTTCAAGTTGG + Intronic
1006720508 6:36147176-36147198 TTGACAAACTGTCTTCAAAGAGG + Intergenic
1007625033 6:43241355-43241377 CTGACCCCCTTGCTTCAACTGGG - Intergenic
1007674814 6:43584725-43584747 CTGAACAGCTGGCTTTAAGTTGG + Intronic
1007922336 6:45621622-45621644 CTGATCGACTGACTTCAAGTTGG - Intronic
1008119333 6:47592948-47592970 CTGATCAATTGGCTATAAATTGG - Intronic
1008534035 6:52493095-52493117 CTGCCTGACTGGCTTCAAATTGG + Exonic
1008586819 6:52958229-52958251 CTGACCAATCAGCTTCAAGTTGG + Intergenic
1008634121 6:53392490-53392512 CTGACTGACTGGCTTCAAGTTGG + Intergenic
1008738307 6:54574148-54574170 CTGACCAACTGGCTTCAAGTTGG - Intergenic
1008742236 6:54623429-54623451 CTGACCAATTGGCTTCAAGTTGG - Intergenic
1008881155 6:56381809-56381831 GTGACAAACTGACTCCAAATTGG + Intronic
1008952494 6:57175899-57175921 CTGACCAACTGGCTTCAAATTGG - Intronic
1009594451 6:65716563-65716585 CTGACCAATAAGCTTCAAGTTGG + Intergenic
1009927249 6:70134988-70135010 TTGACCAACTGGCTATAAATCGG + Intronic
1010023889 6:71193534-71193556 CTGACTGACTGGCTATAAATTGG - Intergenic
1010382307 6:75239173-75239195 CTGACTGACTGGCTTTAAGTTGG - Intronic
1010908541 6:81523242-81523264 CTGATCAATTGGCTACATATTGG - Intronic
1010970089 6:82253801-82253823 CTGACTGATTGGCTTCAAGTTGG - Intergenic
1011060307 6:83258387-83258409 GTGACAAAGTGGGTTCAAATTGG - Intronic
1011353201 6:86445732-86445754 CTGACTAACTGGCTGTAAATTGG - Intergenic
1011381126 6:86743299-86743321 CTGACCAACCAGCTTTAAGTTGG + Intergenic
1011391129 6:86854806-86854828 CTGACCAACTAGCTTTAAGCTGG + Intergenic
1011580868 6:88862606-88862628 CTGACCAGCTAGCTTCAATTTGG - Intronic
1012444650 6:99295533-99295555 CTGCCTAACTGCCTTCAAACTGG + Intronic
1012467367 6:99530550-99530572 CTGACCAACTAGCTGTAAATCGG + Intergenic
1012860804 6:104556782-104556804 CTGACCAACCGGCTATGAATTGG - Intergenic
1013510507 6:110840392-110840414 CTGATCGACTGGCTTCAAGGTGG + Intronic
1013939439 6:115644369-115644391 CTGATCAACTGGCTTCAAGTTGG - Intergenic
1013971987 6:116030832-116030854 CTGACCAACTAGCTATAAATTGG - Intronic
1014107580 6:117584390-117584412 CTGACTGAATGGCTTCAAGTTGG + Intronic
1014679864 6:124415247-124415269 CTGACCAACTGACTACAAATTGG + Intronic
1015593399 6:134843599-134843621 CTAACCTACTGGCTTCGAGTTGG - Intergenic
1015640661 6:135328034-135328056 TTGACCAACCGGCTTCAAGTTGG - Intronic
1016705544 6:147102496-147102518 TTGACCCACTGGCTTCCAACTGG - Intergenic
1016933671 6:149432576-149432598 CTGACCAACTCGCTTTGAAATGG - Intergenic
1017124179 6:151050569-151050591 CTGACCAACTGGTTTCAAATTGG - Intronic
1017234489 6:152105240-152105262 CTGACCAACTGGTTATAAATTGG - Intronic
1017782175 6:157724062-157724084 CTCACCAACTGGCTATAAAGTGG + Intronic
1018047107 6:159975168-159975190 CTGACCAACTGGCTTCAATTTGG + Intronic
1018340969 6:162850829-162850851 CTGACCAACCAGCTTCAAGCTGG - Intronic
1018743348 6:166746664-166746686 TTAACCAACTGGCTATAAATAGG + Intronic
1018780476 6:167059538-167059560 CTGACCAACTGGCTCCAAATCGG + Intergenic
1019001039 6:168752393-168752415 TTGACCCACTGGCTTCAAGTTGG + Intergenic
1019250075 6:170737956-170737978 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1020266272 7:6562366-6562388 CTGACAAACTGTCTCCAAAGGGG + Intergenic
1020334620 7:7053071-7053093 CTGACTGACCGGCTTCAAGTTGG - Intergenic
1020941299 7:14541784-14541806 CTGACTTACTGACGTCAAATTGG - Intronic
1021097692 7:16551858-16551880 CTGACCAACTGGCTGTTAATTGG - Intronic
1022194344 7:28049632-28049654 CTGAACAACTGGCTATAAACAGG + Intronic
1022987699 7:35675021-35675043 TTGACCAACTGGTTATAAATTGG - Intronic
1023294340 7:38699357-38699379 GTGACCAGGTGGCTTCAAATAGG + Intergenic
1024918332 7:54528564-54528586 CTGTCAAACTGTCTTCCAATGGG + Intergenic
1024925148 7:54604731-54604753 ATGACCGACTGGCTTCAACTTGG - Intergenic
1025289601 7:57703968-57703990 CTGACCTACTGGCTTCAAGTTGG + Intergenic
1026485219 7:70812372-70812394 CTGAACACCTGGCTTCAATTGGG + Intergenic
1027355175 7:77347281-77347303 CTGACCAACTGTCTTTAAGTTGG - Intronic
1027803226 7:82782059-82782081 CTGACCGACTGGCTTCAAGTTGG - Intronic
1029036649 7:97529372-97529394 CTGACAGACTGGCTTCAAGTTGG + Intergenic
1029050309 7:97679962-97679984 CTGACTGACTAGCTTCAAGTGGG - Intergenic
1030077279 7:105747604-105747626 CTGGCCTACTGGCTTCAAGTTGG - Intronic
1031099993 7:117467912-117467934 CTGAAAAACTAGCTTCAAGTTGG - Intronic
1031116195 7:117671484-117671506 CTGCCAAACTGTCTTCAAAGTGG + Intronic
1031308250 7:120161400-120161422 CTGACCAACTAGCTATAAAGTGG + Intergenic
1031479170 7:122257548-122257570 CTGACCAACAGGCTTCAAACTGG - Intergenic
1032180902 7:129676743-129676765 CTGATCAACTTGCTTGACATAGG + Intronic
1032913679 7:136462755-136462777 CTGACTGATTGGCTTCAAGTTGG - Intergenic
1032926742 7:136614700-136614722 GTGACCTACTGGCATCAGATTGG - Intergenic
1033067886 7:138173324-138173346 CTGACCAATCAGCTTCAAGTTGG - Intergenic
1035237078 7:157504898-157504920 CTGACAATCTGTCTTCTAATTGG + Intergenic
1035280253 7:157773837-157773859 TTCACCAACTGACTTCAACTTGG - Intronic
1035410965 7:158641324-158641346 CTGACAATCTGTCTTAAAATTGG - Exonic
1035497960 8:69348-69370 CTGAGAAACTTGCTTCAAATAGG - Intergenic
1036427008 8:8654228-8654250 CTGATCAATGGGCTTCAAGTTGG + Intergenic
1036475484 8:9089323-9089345 TTGAACTACTGGCTTCAAGTGGG + Intronic
1037012610 8:13862740-13862762 CTGATCATCTGGCTATAAATTGG + Intergenic
1037189236 8:16101348-16101370 CTGAACAAATGGCTTCAAGTTGG + Intergenic
1038427329 8:27472269-27472291 CTAACCCACTGGCTATAAATTGG - Intronic
1038985281 8:32802474-32802496 CTGACCAGCTGGCTATAAACTGG + Intergenic
1039803895 8:40982667-40982689 CTGACCAACCAGCTTCAAGCTGG - Intergenic
1041350861 8:56946641-56946663 TTGACTAACCAGCTTCAAATTGG - Intergenic
1041791142 8:61697559-61697581 CAGACCAACTGGCTATAAATCGG + Intronic
1041862996 8:62535498-62535520 CTGACCACCGGGCTTCAAGTTGG + Intronic
1041950509 8:63495666-63495688 CTGACCACCTGGCTTCAAGTTGG - Intergenic
1042111813 8:65389099-65389121 CTGATCGACTGGCTTCAAGTTGG - Intergenic
1042344670 8:67715282-67715304 CTGACCAACTGGCTATAAACTGG + Intronic
1042533809 8:69839552-69839574 CTGACCAACTAGCTTCAATTTGG + Intergenic
1042898053 8:73692641-73692663 GTGACCAACTGGCTATAAACCGG - Intronic
1043305378 8:78787196-78787218 CTGACCAACTGGCTGTACAATGG - Intronic
1043559012 8:81468947-81468969 CTGACCAACAGGCTTCAAGCTGG + Intergenic
1043561158 8:81494934-81494956 CAGAGGAACTGGCTTAAAATGGG + Intergenic
1044394024 8:91688224-91688246 GTGATCAACTGGCTATAAATTGG + Intergenic
1044444981 8:92265232-92265254 CTGACCCACCAGCTTCAAGTTGG + Intergenic
1044581507 8:93830414-93830436 CTGACAGACTGGCTTCAATTTGG - Intergenic
1045422925 8:102034579-102034601 CTCACCAATTGGCTTCTTATTGG + Intronic
1045436279 8:102168151-102168173 AGGACCAACTAGCTTCACATTGG + Intergenic
1045517393 8:102872182-102872204 CTGACCTACAGGCTTCAAGTTGG + Intronic
1045911539 8:107416241-107416263 CTCACCAACTGGCTTCAAGTTGG + Intronic
1045991584 8:108314686-108314708 CTGACCCACTGGCTTCAAGTTGG - Intronic
1046198058 8:110888951-110888973 CTGACCGACTGGCTTCATGTTGG - Intergenic
1047968468 8:130064778-130064800 CTGACCAGTTGGCTTCAACTGGG + Intronic
1048340786 8:133537091-133537113 CTGACCAACTGGCTTCAAATTGG + Intronic
1049494750 8:142924443-142924465 CAGAGCAACTGTCTTCGAATAGG + Intergenic
1049821345 8:144635581-144635603 CTGACCAACCAGGTACAAATCGG - Intergenic
1049966440 9:784536-784558 CTGACCAACTAGCTGTAAATTGG + Intergenic
1050487188 9:6146787-6146809 CTGATCAACTGGCTTCAAGTTGG + Intergenic
1051427728 9:16950623-16950645 CTAACTGACTGGCTTCAAGTTGG - Intergenic
1051466598 9:17385001-17385023 CTGACCAACTGAGTTTAAATTGG + Intronic
1051724191 9:20071813-20071835 CTGACCAATAGTCTTCAAGTTGG + Intergenic
1051875727 9:21791204-21791226 CGGACTGACTGGCTTCAAATTGG - Intergenic
1051887247 9:21906003-21906025 CTGAATAACTGGTTACAAATTGG + Intronic
1051898200 9:22010066-22010088 CTGACAAAGTGGGTTTAAATAGG - Intronic
1052816998 9:33109482-33109504 CTGACCAACCAGCTATAAATTGG - Intronic
1053090284 9:35269173-35269195 CTGACCAACTGGCTATAAACTGG + Intronic
1053608718 9:39687584-39687606 CTGGCCAACTGGCTATAAATTGG - Intergenic
1053866564 9:42443936-42443958 CTGGCCAACTGGCTATAAATTGG - Intergenic
1054244806 9:62654814-62654836 CTGGCCAACTGGCTATAAATTGG + Intergenic
1054558933 9:66689357-66689379 CTGGCCAACTGGCTATAAATTGG + Intergenic
1054794561 9:69288358-69288380 CTGACCAACCAGCTATAAATTGG + Intergenic
1055042776 9:71893361-71893383 CTGACTAACTGGCTATAAATTGG + Intronic
1055185091 9:73441894-73441916 CTGACCAACTGGCTACAAATTGG + Intergenic
1055300821 9:74879895-74879917 CTAACTGACTGGCTTCAAGTTGG - Intronic
1055305778 9:74927720-74927742 CTGACTGACTAGCTTCAAGTTGG + Intergenic
1055762059 9:79619690-79619712 CTGACAAAATGGCTCCAACTGGG - Intronic
1056373205 9:85979985-85980007 CTGACCCACTGGCTTTAAGTTGG + Intronic
1057035298 9:91807532-91807554 CTGACCTACTGGCTTCAGGTTGG - Intronic
1057327333 9:94077436-94077458 CTGACTGACTGGCTATAAATTGG + Intronic
1057526816 9:95810412-95810434 CTGCCCAACTGACTTCAAATTGG + Intergenic
1057614064 9:96572297-96572319 CTGACTGACTGGCTTCAAGTTGG - Intronic
1057711451 9:97449403-97449425 CTGACTGACCAGCTTCAAATTGG + Intronic
1057816695 9:98301166-98301188 CTGACCAGCCAGCTTCAAGTTGG - Intronic
1059206777 9:112474652-112474674 CTGACCAACTGGCTTCAAGTTGG - Intronic
1059244030 9:112834342-112834364 CTGACCAGCCAGCTTCAAGTTGG + Intronic
1059891650 9:118811158-118811180 CTGATGCACTGGCTTCAAGTAGG + Intergenic
1061672488 9:132196863-132196885 CTGTCCAATTGGCTGTAAATTGG + Intronic
1062585903 9:137249908-137249930 CTGACCAACTAGCTTCAATTTGG - Intergenic
1203579637 Un_KI270745v1:30541-30563 CTGAGAAACTTGCTTCAAATAGG + Intergenic
1203610960 Un_KI270749v1:2973-2995 CTGACCTACTGGCTTCAAGTTGG - Intergenic
1185572922 X:1148054-1148076 CTGAGCAACTGGCTTCATGGGGG + Intergenic
1186143712 X:6603680-6603702 CTGACCAATCAGCTTCAACTTGG - Intergenic
1186487178 X:9942481-9942503 CTGACCAACCACCTTCAAGTTGG + Intronic
1186697045 X:12046536-12046558 CTGACCAACCTGCATCAAGTTGG + Intergenic
1187862019 X:23691933-23691955 CTGACTGACTGACTTCAAGTTGG + Intergenic
1188597803 X:31922445-31922467 CTGACCCATGGGCTTCAAGTTGG - Intronic
1188611720 X:32107586-32107608 CTGCCCGACTGCCTTCAAACTGG - Intronic
1189091179 X:38084415-38084437 CTGACCAACTGTCTTCAATTTGG - Intronic
1189890814 X:45600427-45600449 CAGACCAACTGGCTATAAATTGG + Intergenic
1189999936 X:46676154-46676176 CTGACTGCCTGGCTTCAAGTTGG - Intronic
1190004380 X:46721004-46721026 CTGAACAAAGGACTTCAAATCGG + Intronic
1190111902 X:47595336-47595358 CTGACCAACTAGCTATAAATCGG - Intronic
1190704860 X:53019075-53019097 CTCATCAACTGGCTATAAATCGG - Intergenic
1191635697 X:63373668-63373690 ATGACCAACTGGCCTGAAATGGG + Intergenic
1191702354 X:64056352-64056374 CTGCCAAACTGTCTTCAAAGCGG + Intergenic
1192542117 X:71982903-71982925 CTGGACAACCAGCTTCAAATTGG - Intergenic
1194819800 X:98491410-98491432 CTCACCAACAGGCTTTAAATTGG - Intergenic
1195118403 X:101723437-101723459 CTGACCAACTGAATATAAATTGG - Intergenic
1195325618 X:103755949-103755971 CTGACTGACTGGCTATAAATCGG + Intergenic
1195567048 X:106352402-106352424 TTGGCCTAATGGCTTCAAATGGG + Intergenic
1196783701 X:119404316-119404338 CTGACCAACCAGCTTCAAGTTGG + Intronic
1196792320 X:119475410-119475432 CTGACCACCTGGATTCAAAATGG + Intergenic
1196802022 X:119552353-119552375 CTGACCAACCAGCTTCAAGTTGG + Intronic
1197070555 X:122291585-122291607 CAGACCAACTGTCTGCAAATTGG - Intergenic
1197210630 X:123825439-123825461 CTGACTAACCGGCTTTAAGTTGG - Intergenic
1197557841 X:127978140-127978162 CTGACCAACCACCTTCAAGTTGG + Intergenic
1197853396 X:130889099-130889121 GTGACCAGCTGGCTTCAGCTGGG + Intronic
1198015260 X:132603805-132603827 TGGACCAAATGGCTTCAAAAAGG + Intergenic
1198409756 X:136354682-136354704 CTGACTAACTGACTTCAACTTGG + Intronic
1198833366 X:140775490-140775512 CTGTCCAACTGAGTTCAAAATGG - Intergenic
1198955115 X:142120767-142120789 CTGACCCACAGGCTTCAAGTTGG + Intergenic
1199860053 X:151793321-151793343 CTGAACAAGTTGCTTCACATAGG - Intergenic
1201360172 Y:13138288-13138310 CTGCCAATCTGTCTTCAAATTGG - Intergenic
1201409810 Y:13688130-13688152 CTAACCAACTGGCTAAAAATTGG + Intergenic
1201564027 Y:15347358-15347380 CTGATTGACTGGCTACAAATTGG - Intergenic
1201891564 Y:18948489-18948511 CTGCCCAACCACCTTCAAATTGG + Intergenic