ID: 1008952496

View in Genome Browser
Species Human (GRCh38)
Location 6:57175910-57175932
Sequence CTCCAGAACTTCTGACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 15, 1: 34, 2: 74, 3: 119, 4: 331}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952496_1008952508 14 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952508 6:57175947-57175969 CGGTGGAGGGTGGGGTCTTGGGG No data
1008952496_1008952506 12 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952506 6:57175945-57175967 AACGGTGGAGGGTGGGGTCTTGG No data
1008952496_1008952500 0 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952500 6:57175933-57175955 GCCTAGACTTGCAACGGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1008952496_1008952499 -3 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952499 6:57175930-57175952 GAGGCCTAGACTTGCAACGGTGG 0: 1
1: 1
2: 2
3: 6
4: 44
1008952496_1008952504 5 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952504 6:57175938-57175960 GACTTGCAACGGTGGAGGGTGGG No data
1008952496_1008952502 1 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952502 6:57175934-57175956 CCTAGACTTGCAACGGTGGAGGG No data
1008952496_1008952507 13 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952507 6:57175946-57175968 ACGGTGGAGGGTGGGGTCTTGGG No data
1008952496_1008952503 4 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952503 6:57175937-57175959 AGACTTGCAACGGTGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 192
1008952496_1008952498 -6 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952496_1008952505 6 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952505 6:57175939-57175961 ACTTGCAACGGTGGAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952496 Original CRISPR CTCCAGAACTTCTGACCAAC TGG (reversed) Intronic
900708703 1:4097142-4097164 CTCTGGAAGTTCTGACCACCTGG + Intergenic
901846326 1:11985005-11985027 CTCCAGAATTTCTCACCGACTGG - Intronic
902285137 1:15403392-15403414 CTCTGGAACTTCTGACGGACAGG + Intergenic
903519073 1:23933824-23933846 CTCCAGAACTTCTGACCGACTGG + Intergenic
903696371 1:25210444-25210466 CACCTACACTTCTGACCAACTGG + Intergenic
903844111 1:26267141-26267163 CACCCGTATTTCTGACCAACTGG + Intronic
904059386 1:27696121-27696143 CTCCAGAACTTCTAATGGACTGG + Intergenic
904934970 1:34123554-34123576 CTCCAGAACTTCTGACCAATTGG - Intronic
905509998 1:38511547-38511569 CTCCTGAACTTCTGAAAACCTGG - Intergenic
905691023 1:39942876-39942898 CTCTGGAACTTCTGACCTACTGG + Intergenic
905692091 1:39950958-39950980 CTCTGGAACTTCTGACAAGCTGG + Intergenic
905712317 1:40116661-40116683 CTCCGGAACTTCTGATGTACTGG + Intergenic
905764245 1:40586986-40587008 TACCTGTACTTCTGACCAACTGG + Intergenic
906433212 1:45772941-45772963 CTCTGGAACTTCTGACTGACTGG - Intergenic
907103230 1:51856422-51856444 CTCTGGAACTTCTGACTTACCGG + Intronic
907983129 1:59504360-59504382 TTCCACAACTTCTGAACTACTGG - Intronic
908211591 1:61906034-61906056 CACCTATACTTCTGACCAACTGG + Intronic
909023030 1:70452966-70452988 CTCTGGAACTTCTGACTGACTGG + Intergenic
909446879 1:75757915-75757937 CTCCAGAACTTCTGGCTGACTGG + Intronic
909701188 1:78525287-78525309 CACCTGAACTTCTGACAAACTGG + Intronic
910076003 1:83279860-83279882 CTCTGGAACTTCTGACAGACCGG + Intergenic
910881325 1:91924662-91924684 CTCCAGAACTTCTAACCAACTGG + Intergenic
911020928 1:93386981-93387003 TACCAATACTTCTGACCAACTGG + Intergenic
911066105 1:93789994-93790016 CTCCTCTACTTCTGACCAAATGG - Intronic
911890964 1:103371309-103371331 TTCCAGAACTTCTGATCAACTGG - Intergenic
912261594 1:108116160-108116182 CTCTAGAACATCTGACTGACTGG - Intergenic
912913681 1:113789559-113789581 CTCTGGAACTTCTGACCAACTGG - Intronic
913107935 1:115632038-115632060 CTCTGGAACTTATGGCCAACTGG + Intergenic
913675948 1:121140262-121140284 CTCTGGAACTTCTGACCAACTGG - Intergenic
914027843 1:143928202-143928224 CTCTGGAACTTCTGACCAACTGG - Intergenic
915183457 1:154083469-154083491 CTCCAGAACTTCTGACCAACTGG - Intronic
915909806 1:159907564-159907586 ATCCGGAACTTCTGACTGACCGG - Intergenic
916293101 1:163187844-163187866 CTCCGGAACTTCTGACAAACTGG - Intronic
916658336 1:166897920-166897942 CACCTGCACTTTTGACCAACTGG - Intergenic
917090916 1:171352363-171352385 TTCCAAAACTTCTAACCTACTGG + Intergenic
917211300 1:172634359-172634381 CTCTTGTACTTCTGGCCAACTGG - Intergenic
917269453 1:173257485-173257507 CACCCTCACTTCTGACCAACGGG + Intergenic
917995797 1:180437269-180437291 CTCCAGAATTTCTTACCAACTGG - Intronic
918490232 1:185073975-185073997 CTCATGTACTTCTGACCAATTGG + Intronic
918508368 1:185282624-185282646 CACCTCTACTTCTGACCAACTGG - Intronic
920118124 1:203635804-203635826 CTGCAAAACTCCTGACCAATAGG + Intronic
920463318 1:206159099-206159121 CTCTGGAACTTCTGACCAACTGG - Intergenic
921830493 1:219723153-219723175 CTCCAGAAGTTCTGGCCAATTGG - Intronic
922761413 1:228134204-228134226 CTTGGGAACGTCTGACCAACTGG + Intergenic
922805271 1:228383427-228383449 CTCTGGAACATCTGACCAACTGG + Intergenic
923301295 1:232643022-232643044 CTCCAGAACTTCTGACCAACTGG - Intergenic
923804460 1:237243306-237243328 TCCCAGAACTTCTAACCAACTGG + Intronic
923856195 1:237848063-237848085 CTACAGAACTTCTGATCAGCCGG + Intergenic
1063150390 10:3331588-3331610 TTCCACAACTTCTGACCCAGTGG - Intergenic
1064221678 10:13446250-13446272 CTTCAGAGCTTCAGAGCAACAGG - Intronic
1064303293 10:14141756-14141778 CTCCAGCACTTCTCACCATGCGG + Intronic
1064655521 10:17551783-17551805 CTCCAGAACTTCTGACCGACCGG - Intergenic
1064666148 10:17653998-17654020 CCCAGGCACTTCTGACCAACTGG - Intronic
1064912013 10:20412750-20412772 TTCAAGAACTTCTTACCAAAAGG + Intergenic
1065053640 10:21820699-21820721 CTCCAGAACTTCTGACCAACTGG + Intronic
1065747974 10:28859179-28859201 GTCCAGAATTTCTGACAAATCGG - Intronic
1067080062 10:43207747-43207769 CCCCAGAGTTTCTGACCAGCAGG - Intronic
1067092256 10:43273822-43273844 CACCTGCACTTTTGACCAACTGG + Intergenic
1067187674 10:44044204-44044226 CTCCTGAAATGCTGACCAGCTGG + Intergenic
1068518418 10:58051957-58051979 CACCTGTATTTCTGACCAACAGG - Intergenic
1068530420 10:58179936-58179958 CTCCCATACTTCTGACCAACTGG + Intergenic
1068758666 10:60682936-60682958 CTCTGGAACTTCTGAGCAACTGG - Intronic
1069176786 10:65300155-65300177 CTCTGGAACTTCTGACCAACTGG - Intergenic
1069663255 10:70137876-70137898 CTCCAGAACTTCTGACCAACTGG + Intergenic
1070351680 10:75598766-75598788 CTCCATAACTTCTTAGCAAAAGG - Intronic
1071371727 10:84958100-84958122 CTCCAGAACTTCTAATCAACTGG - Intergenic
1071755778 10:88537268-88537290 CTCAATAACTTCTGATCAGCAGG - Intronic
1071928372 10:90437209-90437231 CTCTGGAACTTCTGACCAACTGG - Intergenic
1072742843 10:97920529-97920551 CCCCTGAGTTTCTGACCAACAGG + Intronic
1073498381 10:103914929-103914951 CAACTGCACTTCTGACCAACTGG + Intronic
1074265106 10:111893869-111893891 CTTTGGAACTTCTGACCAGCTGG - Intergenic
1077036977 11:499976-499998 CTCCAGAACTGCTGCCTGACGGG - Exonic
1077086227 11:752839-752861 CTCCAGAACTTCTGATCCACTGG - Intronic
1078931396 11:15914423-15914445 GTCCTGAACTTCTGAACAGCAGG - Intergenic
1079187872 11:18253721-18253743 CTCTGGAACTTCTGACTGACTGG - Intergenic
1079573321 11:21971608-21971630 CTCCTCAAATTCTGACCAAAGGG + Intergenic
1080244386 11:30163274-30163296 CTCTAGAACTTCTGCCTGACTGG - Intergenic
1080302939 11:30804572-30804594 CTCTAGAACTTCTGACTGATGGG - Intergenic
1081150018 11:39616467-39616489 CTCCCACATTTCTGACCAACTGG - Intergenic
1081847521 11:46251639-46251661 CTCCAGACCCTCTTGCCAACTGG + Intergenic
1083239643 11:61377970-61377992 CTCTGGTACTTCTGACCCACTGG - Intergenic
1083286462 11:61662324-61662346 CTCCAGAACTTCTGACCGACTGG - Intergenic
1083810825 11:65105750-65105772 CTCCAGAATTTCTGACCAACTGG + Intronic
1083898685 11:65633271-65633293 CTCCTGTACTTTTGCCCAACAGG + Intronic
1084553240 11:69861505-69861527 ATCCAGAACTCCTGCCCATCTGG + Intergenic
1085354394 11:75822545-75822567 CTCTGGAACTTCTTACCGACTGG + Intronic
1086575155 11:88331305-88331327 CTCCAGAACTTCTGATGGACTGG + Intronic
1086601569 11:88640614-88640636 CTCCAGAAATTGTGACCAACCGG + Intronic
1088069983 11:105770594-105770616 CTCCAGAACTACTTGGCAACTGG - Intronic
1088129706 11:106472626-106472648 CTCCAGACGCTCTGACCACCAGG - Intergenic
1089569102 11:119390799-119390821 CACCAGGACTTCTGACCTACAGG - Intergenic
1089663884 11:120004587-120004609 CACCTGCACTTCTCACCAACTGG + Intergenic
1089734338 11:120539266-120539288 CTCAAGAGCTTCTGAAGAACAGG + Intronic
1090493831 11:127190721-127190743 GCTCTGAACTTCTGACCAACTGG + Intergenic
1091582752 12:1799023-1799045 TTCCAGAACTTCCCACCACCTGG - Intronic
1092177103 12:6417561-6417583 CTCTGGAACTTCTGATCAACTGG + Intergenic
1092470146 12:8770841-8770863 CTACAGAACTTCTGACCAACTGG + Intronic
1093700100 12:22210605-22210627 CTCCAGAACTTCTGACCAGCTGG + Intronic
1093703203 12:22246120-22246142 CTCCGGAGCTTCTGACTGACTGG - Intronic
1093927195 12:24920774-24920796 CTCTGGAACTGCTGACCAACAGG + Intronic
1094374448 12:29775377-29775399 CACCAGTACTTCTGACCAACTGG + Intronic
1094712010 12:32973761-32973783 CTCCCGAAATTCTGACCAAAGGG + Intergenic
1095043688 12:37474398-37474420 CCTCTGAACTTCTGACCTACTGG + Intergenic
1095861574 12:46923728-46923750 TTCCAGAATTTCTAACCAACTGG + Intergenic
1096132219 12:49168633-49168655 CCCCGGGACTTCTGACCGACTGG - Intergenic
1096812391 12:54179702-54179724 CACCTGCACTTCTGACCAACTGG + Intronic
1097729852 12:63116253-63116275 CTCTGGAACTTCTGACTGACTGG + Intergenic
1098132258 12:67362982-67363004 CTCCCATGCTTCTGACCAACTGG - Intergenic
1099371043 12:81830003-81830025 CTCTGCAACTTCTGACCAAGTGG - Intergenic
1099580777 12:84444410-84444432 CTCCAGAACTTCAGACCAACTGG - Intergenic
1100445643 12:94657188-94657210 CTTCAGAACTTCGGGCCAACCGG - Intergenic
1100705455 12:97195708-97195730 CACCTGTACTTCTGACCAACTGG - Intergenic
1100836624 12:98572700-98572722 CTCTGGAACTTCTGACCAACTGG + Intergenic
1100976056 12:100123627-100123649 CTCCAGAACTTCTGACGGACAGG + Intronic
1101462672 12:104912722-104912744 CTCCAGAATTTCTGACCAACTGG - Intronic
1101550011 12:105752920-105752942 CTCCAGACCTTCAGACCACCTGG + Intergenic
1101582127 12:106050845-106050867 TTCTAGAAGTTCTGACCAAGTGG + Intergenic
1101772819 12:107767254-107767276 CTGTGGAACTTCTGACCAATTGG + Intergenic
1102150059 12:110682886-110682908 CACCAGAACTTCTGCCCCCCAGG - Intronic
1102840625 12:116116616-116116638 CTCCAAAGCTTCTGACCAATTGG - Intronic
1103344653 12:120241284-120241306 TTCCAGAAATTCTGATCACCTGG - Intronic
1103752365 12:123173917-123173939 CTCCAAAACGTCTAACCAACTGG - Intronic
1104484935 12:129143164-129143186 CTCTAGAACTTCTGATTGACTGG + Intronic
1105923214 13:24984070-24984092 CTCCAGAGCTTCTGACCCATTGG - Intergenic
1105974571 13:25462320-25462342 CACCTGCACATCTGACCAACTGG + Intronic
1106528867 13:30568763-30568785 CTCCAGAACTTCTGGCCTCCAGG + Intronic
1107018786 13:35730844-35730866 CTCCGGAACTTCCTACCAACTGG + Intergenic
1107038853 13:35928154-35928176 CACCCACACTTCTGACCAACTGG - Intronic
1107312377 13:39093085-39093107 GTTGAGAACTTCTGACCAAAAGG - Intergenic
1107332551 13:39317326-39317348 CTCCTGCACTTCTGACCAACTGG - Intergenic
1107360032 13:39607781-39607803 CTTCAGAACTTCTGACAAACTGG - Intergenic
1107404518 13:40099862-40099884 CTTCCATACTTCTGACCAACTGG - Intergenic
1108239128 13:48444138-48444160 CTCCAGAACTTCTGACCTACTGG + Intronic
1108867004 13:54936566-54936588 CTTCAGAACTTCTAACCAATTGG + Intergenic
1109263250 13:60167756-60167778 CTCTAGCACTTCTGATCCACTGG - Intergenic
1109459570 13:62638445-62638467 CTCTGGAACTTCTGACCCACTGG + Intergenic
1111509395 13:89241662-89241684 CTCTGCAACTTCTGACCAACTGG + Intergenic
1111706883 13:91761512-91761534 CTCCAGAACTTCTGACCAACTGG + Intronic
1112592449 13:100776143-100776165 CTCTGGAACTTCTGACTGACAGG + Intergenic
1114063421 14:19039238-19039260 CAGCAGAACTTCTGGCCACCCGG + Intergenic
1114098835 14:19360758-19360780 CAGCAGAACTTCTGGCCACCCGG - Intergenic
1115307079 14:31944447-31944469 CTCAGGAACTACTGACCCACAGG + Intergenic
1116164862 14:41322658-41322680 CTCCAGAACTTCTGAGCCATTGG - Intergenic
1117454913 14:55887117-55887139 CTCCAGAACTTGCCACCTACTGG - Intergenic
1118020959 14:61713778-61713800 CTCAGGAACTTCTGACTGACAGG - Intronic
1118281950 14:64437643-64437665 CACCTGTGCTTCTGACCAACTGG + Intronic
1118830414 14:69426264-69426286 CTCTGGAACTTCTGACCAACTGG + Intronic
1118995938 14:70836079-70836101 CACCTGCACTTTTGACCAACTGG - Intergenic
1119308510 14:73627430-73627452 TTTCAGAACTTCTGACTAACTGG + Intergenic
1120513029 14:85438449-85438471 CTCCAGAAATCCTGACCAACTGG - Intergenic
1121090017 14:91174740-91174762 CTCCAGAACTTCTGACCAACTGG - Intronic
1121208744 14:92190670-92190692 CTCCAGGACCTCTCACCAGCAGG - Intergenic
1121283619 14:92717431-92717453 CTCCAGGAATTGTGATCAACAGG - Exonic
1121679883 14:95784675-95784697 CTCCAGTATTTCTGGCCAACCGG - Intergenic
1122272874 14:100576212-100576234 CACCAGAACTTCCCACCCACCGG + Intronic
1122440897 14:101731169-101731191 CTCCAGAGCTTCTGTTCAGCAGG - Intronic
1123156181 14:106228760-106228782 CTCCAGATCCTCTGCCCTACAGG + Intergenic
1202916778 14_GL000194v1_random:182184-182206 CTCCCATACTCCTGACCAACTGG + Intergenic
1202876013 14_KI270722v1_random:1012-1034 CTCCCATACTCCTGACCAACTGG - Intergenic
1123493128 15:20798939-20798961 CAGCAGAACTTCTGGCCACCGGG - Intergenic
1123549634 15:21368041-21368063 CAGCAGAACTTCTGGCCACCGGG - Intergenic
1124183741 15:27502647-27502669 CTCCAGAGCTTCTGACCAACGGG + Intronic
1124434316 15:29634707-29634729 CTCCAGAACTCCTGCCTGACTGG + Intergenic
1124898505 15:33799698-33799720 GACCTGTACTTCTGACCAACTGG - Intronic
1125258701 15:37797629-37797651 TACCAAAACTTCTGACCAACTGG + Intergenic
1125770847 15:42164871-42164893 CTTCAGAACTTCTGCGCACCTGG + Intronic
1126202795 15:46006709-46006731 CACCTACACTTCTGACCAACTGG + Intergenic
1126277117 15:46896439-46896461 CTCCAGAGATTCTAACCAAAAGG + Intergenic
1126291194 15:47081462-47081484 CCTCTGAACTTCTGACCTACTGG - Intergenic
1126312560 15:47334368-47334390 CCCCAGAAATTCTGACTGACAGG - Intronic
1127390318 15:58499980-58500002 ATCCAGAACTTGTGTCCAGCTGG + Intronic
1127533248 15:59865435-59865457 CTCCGGAACTTCTGACCAACTGG - Intergenic
1127787766 15:62371423-62371445 CTCTAGAACTTCTGACCAACTGG + Intergenic
1127890486 15:63246351-63246373 CACCTCTACTTCTGACCAACTGG + Intronic
1128073464 15:64811563-64811585 CTCTGGAACTTCTGACCGACTGG - Intergenic
1128176609 15:65561832-65561854 CTCCAGAACTTGTGACCAATAGG + Intronic
1128571842 15:68739318-68739340 CACCTGTACTTCTGACCAACTGG - Intergenic
1128624492 15:69185878-69185900 CTCTGGAACTTCTGACCAACTGG + Intronic
1129536957 15:76321407-76321429 CTCCAGAACTTCTGAATAGGCGG + Intergenic
1130443791 15:83979987-83980009 CCCCAGAAATTCTGACTTACGGG - Intronic
1130740228 15:86591445-86591467 TTCCGGAACTTCTGACCCACTGG + Intronic
1130884107 15:88078951-88078973 CTCCAGTCCTTCAGACCCACTGG - Intronic
1132384563 15:101390808-101390830 CTCCTGGACTTCTGGCCTACAGG + Intronic
1202957965 15_KI270727v1_random:95259-95281 CAGCAGAACTTCTGGCCACCGGG - Intergenic
1132919645 16:2380005-2380027 TACCTGTACTTCTGACCAACTGG + Intergenic
1132988525 16:2780644-2780666 CTCCGGAACGTCTGACTGACTGG - Intergenic
1133155622 16:3873484-3873506 TTCCAGAACTGCTGAGAAACAGG + Intronic
1133263581 16:4569193-4569215 CTCCTGAACTTCAGATCCACTGG + Intronic
1134178298 16:12026502-12026524 CTCCTGAGCCTCTGCCCAACTGG - Intronic
1134804693 16:17114307-17114329 CTTTGGAACTTCTGACCAAATGG - Intronic
1135079772 16:19424172-19424194 CTTGGGAACTTCTGACCAGCTGG + Intronic
1135091173 16:19519107-19519129 CTATGGAACTTCTGACCAATTGG + Intronic
1135483507 16:22843421-22843443 CTCCAGAACTTCTGACTGATTGG + Intronic
1135955991 16:26956615-26956637 CTCCAGAGCTTCTGACCAACTGG + Intergenic
1136423253 16:30150836-30150858 CACCAGAACTTCTGACCGACTGG + Intergenic
1137697637 16:50472632-50472654 CTCTGGAACTTCTAACTAACTGG - Intergenic
1137997362 16:53233182-53233204 CTTCAGAACTTCTGACTGACTGG + Intronic
1138780203 16:59775660-59775682 CTCTGGAACTTCTGACAGACTGG - Intergenic
1139003323 16:62540771-62540793 TTCCAGAACTTCTGACTGTCTGG + Intergenic
1139310495 16:66024361-66024383 CACCTGCCCTTCTGACCAACTGG + Intergenic
1139535995 16:67574209-67574231 CTTCAGAGCTTCTGACCAACTGG + Intronic
1140523492 16:75602507-75602529 CACCCATACTTCTGACCAACTGG - Intronic
1141425813 16:83943731-83943753 ACCCAGAACTTCTGATCTACTGG + Intronic
1141610057 16:85176253-85176275 CTCCACAACTGCAGACCCACAGG - Intronic
1141827387 16:86490368-86490390 CTCTCGAATTTCTGACCTACAGG - Intergenic
1142063874 16:88049191-88049213 CCTCAGAACTTCTGGCCAACCGG + Intronic
1142203121 16:88770517-88770539 CTCCAGAACTGCAGTCCATCGGG + Intronic
1142494143 17:297393-297415 CTCTGGAACTTCTGAGCAGCTGG - Intronic
1142642544 17:1292835-1292857 CCACAGAACTTCTGGCCCACTGG - Intronic
1144112036 17:12044791-12044813 CTTCAGAACTTCTGACTGTCCGG + Intronic
1144217434 17:13068734-13068756 TACCTGTACTTCTGACCAACAGG + Intergenic
1144263697 17:13547754-13547776 CTCCTGTACTTCTGACTGACTGG - Intronic
1144405521 17:14949275-14949297 CACCTGTACTTCTGACCAACTGG - Intergenic
1144770371 17:17756106-17756128 CTCCAGAACTCCTGTCCCAGGGG - Intronic
1145053565 17:19682902-19682924 TTCCAGATCTTCTGAACTACAGG + Intronic
1145099814 17:20065347-20065369 CTCTGGAACTTCTGACCAACTGG + Intronic
1146809783 17:35893997-35894019 TTCCAGAATGTCTGACCAGCTGG + Intergenic
1146986071 17:37219448-37219470 CACTTGCACTTCTGACCAACTGG - Intronic
1147230847 17:39016681-39016703 CTCCAGAACTTCTGGCCAACAGG - Intergenic
1147722041 17:42545346-42545368 CCCTGGAACTTCTGACTAACTGG + Intergenic
1147738378 17:42655406-42655428 CTCCAGAACTTCTGACCAGCAGG - Intergenic
1149067020 17:52492771-52492793 CACCAGAGGTTCTGATCAACTGG - Intergenic
1149390924 17:56189546-56189568 CACCTGCACTTCTGACCAACTGG - Intronic
1149722710 17:58862405-58862427 CTCTAGAACTTCATAGCAACAGG - Intronic
1149730941 17:58945639-58945661 CTCCCAAACTTCTGACCAACTGG + Intronic
1151080597 17:71324612-71324634 CTCTGGAACTTCTGACTGACTGG + Intergenic
1151607083 17:75144648-75144670 CTCTGGAACTTCTGACCGACTGG - Intronic
1152014388 17:77740655-77740677 CACCTGCACTTCTGACCAGCTGG - Intergenic
1152993509 18:384644-384666 CTACAGAATCTCTGACCAACGGG - Intronic
1153282192 18:3425034-3425056 CACCAATACTTCTGACCAACTGG - Intronic
1153503389 18:5770956-5770978 CTCCAAAACTTCTAACCAACTGG + Intergenic
1153837407 18:8976399-8976421 TACCTGCACTTCTGACCAACTGG + Intergenic
1153920679 18:9786466-9786488 CTCTAGAACTTCTGATCGACAGG - Intronic
1154334855 18:13457152-13457174 CTCAGGAATTTCTGACCGACTGG + Intronic
1155154870 18:23149740-23149762 CCCCAGAGCTTCTGACCCAGTGG - Intronic
1155233170 18:23793864-23793886 CTCTGGAACTTCTGACGAAGCGG + Intronic
1156646359 18:39166491-39166513 TTCCAGTACTTTTGACCAACTGG - Intergenic
1156962622 18:43051026-43051048 CTCTGGAACTTGTGACCAACTGG - Intronic
1157125470 18:44951965-44951987 CAACAGCACTTCTGACCAAGCGG + Exonic
1157783397 18:50460085-50460107 TCACTGAACTTCTGACCAACTGG + Intergenic
1157807340 18:50667965-50667987 CTCCGGAACTTCTGATGGACTGG + Intronic
1157926530 18:51772794-51772816 CTCCAGAACCCTTAACCAACAGG - Intergenic
1157959011 18:52131730-52131752 CTCCAGAACTTCTGACTGACTGG + Intergenic
1158340888 18:56465064-56465086 TACCTGCACTTCTGACCAACTGG + Intergenic
1159549176 18:69877170-69877192 CTCTAGAACTTCGGACCAATGGG + Intronic
1160322386 18:77908173-77908195 CGATAGAACATCTGACCAACAGG + Intergenic
1160537559 18:79603194-79603216 CTTCGGAACTTCTGGCCCACAGG - Intergenic
1161113691 19:2484826-2484848 ACCCAGAACTCCTGACCAACTGG + Intergenic
1162022344 19:7873606-7873628 CTCCTGGACTTCTGACCCCCAGG - Exonic
1162072628 19:8163500-8163522 CTCCAGAACTTTTTCCAAACGGG - Intronic
1162661610 19:12173726-12173748 CTCTGGAACTTCTGACCAACAGG - Intronic
1163849628 19:19655786-19655808 CCCCAGAACATCTGCCCCACGGG - Intronic
1164717594 19:30404879-30404901 CTCACGAACTTCTGACCAACAGG + Intronic
1164718003 19:30407549-30407571 CTCACGAACTTCTGACCAACAGG + Intronic
1164768526 19:30790096-30790118 CACCCACACTTCTGACCAACTGG - Intergenic
1164847129 19:31441918-31441940 CTCTAGAACTTCTGACTGAAGGG - Intergenic
1165551371 19:36589236-36589258 CTCTAGAACTTCTGACCAGCTGG - Intronic
1165570255 19:36769940-36769962 CTCTACAACTTCTGACTGACGGG + Intronic
1165985902 19:39768673-39768695 CACCTGCACTTCTGACCAACTGG + Intergenic
1166772143 19:45290285-45290307 CTCCAGAGGTCCTGACCATCAGG + Intronic
1167029450 19:46947767-46947789 CTCTGGAACTTCTGACTGACCGG + Intronic
1167869618 19:52357082-52357104 CTCTGGAACTTTCGACCAACTGG + Intronic
1168125971 19:54283103-54283125 CTCCAGAACTTCTGACTGACTGG - Intergenic
1168171304 19:54591685-54591707 CTCCAGAACTTCTGACTGACTGG + Intronic
1168176002 19:54628450-54628472 CTCCAGAACTTCTGACTGACTGG + Intronic
1202674648 1_KI270710v1_random:31798-31820 CTCCCATACTCCTGACCAACTGG + Intergenic
925489515 2:4376161-4376183 ATGAAGAACTTCTTACCAACTGG - Intergenic
926007560 2:9384518-9384540 CTCCAGAACTTCTGACCAACCGG + Intronic
926022980 2:9513424-9513446 CTCCAGAACTTCTGACCAACTGG - Intronic
926530076 2:14033226-14033248 CTCCCTAATTTCTGACCCACAGG + Intergenic
927164039 2:20299133-20299155 CTCCAGAACTTCTGACCGACTGG - Intronic
927451944 2:23216246-23216268 CTCTTGAATTTCTGACCCACAGG + Intergenic
927563263 2:24088766-24088788 CTCCTACACTTCTGACCAACTGG - Intronic
927593184 2:24374379-24374401 CTCTGGAACTTCTGAACAACTGG - Intergenic
927666855 2:25038881-25038903 CTCCAGAACTTCTGACCAACTGG + Intergenic
928444694 2:31322575-31322597 CTCCTGTACTTCTGGCCAACTGG - Intergenic
930014052 2:46958525-46958547 CTGCAGGACCTCTGACCACCGGG - Intronic
930194656 2:48497078-48497100 CTTGAGAACTTGTGACTAACCGG - Intronic
930722334 2:54649450-54649472 CTCGAGAACCTCTTAGCAACTGG - Intronic
931630180 2:64291397-64291419 CTCCAGAGCTTCTGACTCATGGG + Intergenic
931817902 2:65922621-65922643 CTCTCTACCTTCTGACCAACAGG - Intergenic
933364017 2:81325171-81325193 CTCTGGAACTTCTGACCAACTGG + Intergenic
933725849 2:85426811-85426833 CTCCAGAACTTCTGACCAACTGG - Intronic
934636496 2:95994009-95994031 CTCCTGACCTTGTGACCCACTGG + Intergenic
935242390 2:101190009-101190031 ATCTGGAACTTCTGACCAACTGG - Intronic
935493256 2:103746600-103746622 CTCTGGTACTTATGACCAACTGG - Intergenic
935654934 2:105414022-105414044 CACCTATACTTCTGACCAACAGG + Intronic
935695604 2:105768458-105768480 CACCTGTACTTCTGATCAACTGG + Intronic
936002802 2:108851018-108851040 CTCTGGAACTTCTGACCAACTGG + Intronic
936229445 2:110687264-110687286 CACCTGCACTTCTGACCAACTGG + Intergenic
937156253 2:119721547-119721569 CACCAGCATTTCTGACCAGCTGG - Intergenic
937261994 2:120592431-120592453 CTCCAGAAATGCAGAGCAACAGG + Intergenic
937920663 2:127127306-127127328 CACCTGCACTTCTGACCAACTGG - Intergenic
939061011 2:137421366-137421388 CTCTGAAAATTCTGACCAACTGG + Intronic
941299859 2:163787782-163787804 CTCCAGAACTTCTTACCAAATGG + Intergenic
941694714 2:168538587-168538609 CTCTAGCACTTCTCACCATCTGG + Intronic
941790448 2:169547051-169547073 CTCCAGAACTTCTGAGCAACCGG + Intronic
942660283 2:178256647-178256669 CTCCAGAACTTCTTAAGAATTGG - Intronic
942830039 2:180228822-180228844 AACCAGAACTTCTGAGCCACTGG + Intergenic
943771508 2:191722504-191722526 CTCTGGAACTTCTGACCAGCTGG + Intergenic
944481291 2:200160257-200160279 CACCCACACTTCTGACCAACCGG + Intergenic
945549162 2:211197706-211197728 CTCCAAAATTTCTGAACAGCTGG - Intergenic
945921681 2:215761530-215761552 CACTAGCACTTCTGACCAACTGG + Intergenic
946811638 2:223531411-223531433 CTTCAGAATTTCTGACCCACTGG - Intergenic
947294743 2:228617962-228617984 TTTCCGTACTTCTGACCAACTGG - Intergenic
947335905 2:229082842-229082864 CACCAGAACTTCTGACCTATAGG + Intronic
947964404 2:234267379-234267401 CACCTGTACTTCTGACCAACTGG - Intergenic
948555963 2:238811191-238811213 CTCCTGCCCTTCTGAACAACCGG - Intergenic
1169232077 20:3896930-3896952 CTCCAGAACTTCTGATCAACTGG - Intronic
1169423400 20:5477452-5477474 CTCCATCACTGCTGACCACCTGG + Intergenic
1170016523 20:11787888-11787910 TTCCAGAACTTCTGACTAACTGG - Intergenic
1170123673 20:12938248-12938270 CTCCAGAACTTCTCACTGACTGG + Intergenic
1170125296 20:12956537-12956559 CTCCAGAACTTCTCACTGACTGG + Intergenic
1170199988 20:13732099-13732121 ATCCAGAACTTCTGATTGACTGG - Intronic
1170724545 20:18914691-18914713 CACCAGAACTTCTGACCAGCTGG - Intergenic
1171538144 20:25917131-25917153 CCTCTGAACTTCTGACCTACTGG + Intergenic
1171802995 20:29644310-29644332 CCTCTGAACTTCTGACCTACTGG - Intergenic
1171841086 20:30212432-30212454 CCTCTGAACTTCTGACCTACTGG + Intergenic
1173042374 20:39476461-39476483 CACCTGTACTTCTTACCAACTGG + Intergenic
1173498280 20:43534431-43534453 CTACAGAATTCCTGCCCAACTGG - Intronic
1174260445 20:49290917-49290939 TTCCACAGCTCCTGACCAACTGG - Intergenic
1175310439 20:58008073-58008095 CTCCAGGACTCCTGATAAACTGG - Intergenic
1176913477 21:14596872-14596894 CTCCCCAACTCCTGACCCACAGG + Intronic
1177127117 21:17209028-17209050 CACCTGCACTTCTGACCAATTGG + Intergenic
1178000612 21:28158528-28158550 CTCCAGAAATTCCAACCAACTGG + Intergenic
1178676272 21:34634243-34634265 CTCAGGAACTTCTGACCAACTGG + Intergenic
1178880159 21:36443231-36443253 CTCCTGAACTTGTGATCCACCGG + Intergenic
1179258381 21:39737476-39737498 CTCCAGAACTTCTGACCGACCGG + Intergenic
1179618422 21:42596621-42596643 CTCTGGAACTTCTGACCAACTGG + Intergenic
1180481915 22:15761872-15761894 CAGCAGAACTTCTGGCCACCCGG + Intergenic
1181588511 22:23867988-23868010 CTCCTGCACTTCTGACCAACTGG - Intronic
1181821385 22:25478423-25478445 CTCCTGAATTTCTGACCCGCAGG + Intergenic
1182336648 22:29587983-29588005 CTCCAGAATTCCTGACCCTCAGG - Intergenic
1184725415 22:46342178-46342200 CTCTAGAACTTATGACCAACTGG + Intronic
949397311 3:3628804-3628826 CACCAGTACTTCTGCCCAACTGG + Intergenic
949451773 3:4193428-4193450 CACCTGCACTTCTGATCAACTGG - Intronic
949966204 3:9358677-9358699 CTCCAGAACTTCTGACCAACAGG + Intronic
950006120 3:9691970-9691992 TTTCAAAACCTCTGACCAACAGG - Intronic
951477066 3:23118213-23118235 CTCAAAAAATACTGACCAACTGG + Intergenic
951478235 3:23131149-23131171 TTCAGGAACTTCTGACCCACTGG - Intergenic
952747196 3:36792533-36792555 CTCAAGACCTGCTGACCAAGAGG + Intergenic
953207187 3:40841492-40841514 CACCCTCACTTCTGACCAACTGG - Intergenic
953882441 3:46697657-46697679 CTCTGGAACTTCTGACCAACTGG - Intergenic
956844112 3:73166605-73166627 CTCCCAAATTCCTGACCAACAGG - Intergenic
957103599 3:75858563-75858585 CTCCCACACTCCTGACCAACTGG + Intergenic
957837536 3:85617220-85617242 CTTGGGAATTTCTGACCAACTGG + Intronic
959598949 3:108157433-108157455 CTCCTACACTTCTGAACAACTGG - Intergenic
960009995 3:112823364-112823386 CACCTGAACTTCTAATCAACTGG - Intronic
961227418 3:125264247-125264269 CTCTTGTACTTCTGACCAACTGG - Intronic
961431044 3:126883296-126883318 CTCCGGAACTTCTGACCAATCGG - Intronic
961992237 3:131204397-131204419 ATCCAGGCCTTCTGATCAACTGG - Intronic
962182295 3:133220818-133220840 CACCTATACTTCTGACCAACTGG + Intronic
962326698 3:134440467-134440489 CTCCAGAACTTCTGACTGACTGG + Intergenic
962712605 3:138100519-138100541 CTCCTGTACTTCTGACTAACTGG - Intronic
962963918 3:140336362-140336384 CTCCAGAAATTCTGAGTAATTGG - Intronic
963192164 3:142484657-142484679 CTCTGGAACTTCTGACCAACTGG - Intronic
963994023 3:151685554-151685576 TTCTGGAATTTCTGACCAACTGG - Intergenic
964109307 3:153072703-153072725 CTCCAGAACTTCTGACTGACTGG + Intergenic
964138559 3:153371521-153371543 CTCCAGAACTTCTGACCCACTGG - Intergenic
964257782 3:154796932-154796954 CTCCAGAACATCTGACCAACTGG + Intergenic
964271743 3:154964055-154964077 CTCCAGATCTTTTTACCACCTGG + Intergenic
964745229 3:160006078-160006100 TGCCAGAACTTCTGATCCACTGG - Intergenic
967163484 3:186759777-186759799 CTCGGGAATTTCTGACCAACAGG + Intergenic
967910991 3:194542337-194542359 CTCTGGAATTTCTGAGCAACTGG - Intergenic
968484866 4:854560-854582 CTCCAGACCATCTGATGAACGGG + Intronic
968515561 4:1014164-1014186 TTCCAGAACTTATGACCCAGCGG - Intronic
970529947 4:16971214-16971236 CTCAGGAACTTCTGACCCACTGG + Intergenic
971640520 4:29126326-29126348 GTTGGGAACTTCTGACCAACAGG - Intergenic
972766943 4:42159920-42159942 CTCCGGAACTTCAGACCTACTGG + Intergenic
973744054 4:53946210-53946232 CTCCAGAACTTCTGACTGACTGG - Intronic
973816823 4:54626857-54626879 CTCCAGCACTTCTGACTCAGTGG + Intergenic
974096454 4:57369656-57369678 CACCCACACTTCTGACCAACTGG - Intergenic
974456407 4:62134139-62134161 CTCTAGAAATTCTGACTGACTGG - Intergenic
975849775 4:78560304-78560326 CACCTGCACTTCTGGCCAACTGG + Intronic
976609933 4:87019830-87019852 CTCCAGAACTTCTGATAGACTGG - Intronic
976657798 4:87507794-87507816 CTCCAGAACTTCTGGCTGACTGG + Intronic
976737845 4:88328649-88328671 CTCGGGAACTTCTGACCAACTGG + Intergenic
976855228 4:89596808-89596830 CCCTAGAACTCTTGACCAACAGG - Intergenic
977718388 4:100209640-100209662 CTCCTGAACTTCTGACCAACTGG - Intergenic
978752369 4:112264691-112264713 CCCAAGAACTTCCAACCAACTGG - Intronic
978846983 4:113285398-113285420 CCTCTGAACTTCTGACCTACTGG + Intronic
979077077 4:116285275-116285297 CACCTGAACTTCTAATCAACTGG - Intergenic
980121794 4:128735249-128735271 CTCTGGAACTTCTGACCCATTGG + Intergenic
980692550 4:136313918-136313940 CTCTAGAATTTCTGATCAGCTGG - Intergenic
980864216 4:138535728-138535750 CTCCAGAACTTCTGATGAATGGG + Intergenic
980864328 4:138536655-138536677 CTCCAGAACTTCTCTTGAACTGG + Intergenic
981114013 4:140968772-140968794 CCCCAGAACTCCTCACCAAGAGG - Intronic
981483780 4:145263668-145263690 CTCTAGAACTTCTGATCAACTGG + Intergenic
981643528 4:146972722-146972744 CTCTGGAGCTTCTGATCAACTGG + Intergenic
982772983 4:159415070-159415092 CTCCAGAACTTCTGACCAAAAGG - Intergenic
982819354 4:159927093-159927115 CACCAGATATTCTGACAAACTGG + Intergenic
983490676 4:168385531-168385553 CTCTGGAACTTATGACCAACTGG - Intronic
984210318 4:176839513-176839535 CTCCGGTACTTCTGACCAACTGG + Intergenic
984517459 4:180758106-180758128 CTTGGGAACTTCTGACCCACTGG - Intergenic
984600997 4:181726830-181726852 TACCTGCACTTCTGACCAACCGG + Intergenic
985430194 4:189871764-189871786 TTCCAGAACATCTGACTGACTGG + Intergenic
986512743 5:8525435-8525457 CTCCAAATCTTGTGACCAACTGG - Intergenic
986844131 5:11733200-11733222 CCTCAGAACTTCTGACCAACAGG - Intronic
988099021 5:26655120-26655142 CTCTGAAACTACTGACCAACTGG + Intergenic
988400271 5:30752781-30752803 CTCCAGAACTTCTGACTGACTGG + Intergenic
989187349 5:38638103-38638125 CTCCACAACTTCTGACTGACTGG - Intergenic
989482843 5:41951937-41951959 CTCCAGGAATACTGACCACCAGG - Intergenic
989624435 5:43415770-43415792 CTCCAGAACTTCTGAACAGCTGG - Intergenic
990355483 5:54962280-54962302 CTCTGAAACTTCTGACAAACTGG + Intergenic
990604521 5:57395486-57395508 CTTCTGAACTTCTGACTGACTGG + Intergenic
990997854 5:61751196-61751218 CTCCAGGAATTAAGACCAACCGG + Intronic
992345450 5:75871580-75871602 CTCCTGACCTTGTGACCCACCGG - Intergenic
992477833 5:77121117-77121139 CTCCTGAATTCCTGACCCACAGG - Intergenic
992669023 5:79040097-79040119 CACCCATACTTCTGACCAACTGG - Intronic
992712718 5:79476502-79476524 CTCCAGAAATTCTGACCAACTGG + Intronic
992766289 5:80003847-80003869 CTCCAGAACCTCTCAACAAGCGG - Intronic
994201226 5:96978660-96978682 TCCCAGAATTTCTGTCCAACAGG - Intronic
994637860 5:102364690-102364712 CTCTGGAACTTCTCACCGACAGG + Intergenic
995339887 5:111046596-111046618 CTCCAGAACTTCTGATCTAGGGG + Intergenic
995379638 5:111517841-111517863 CTCAGGAACTTCTGACCTACTGG - Intergenic
995450241 5:112291933-112291955 CTGTGGAACTTCTGACCAACTGG - Intronic
995594523 5:113733761-113733783 CTGCAGAACTTCTGGCCAATTGG + Intergenic
995795464 5:115936688-115936710 CTCTAGAACATCTGACCAACTGG - Intergenic
996571320 5:124935306-124935328 CACCTGCACTTCTAACCAACTGG + Intergenic
996866103 5:128124406-128124428 CTCCTGTACCTCTGACCAACTGG + Intronic
997005761 5:129814624-129814646 CTCTGGAACTTCTGACTGACTGG + Intergenic
997016525 5:129941839-129941861 CTCTGGAACTTCTGACCAACTGG + Intronic
997985561 5:138498856-138498878 CACCTGTACTTCTGACTAACTGG + Intergenic
999392750 5:151206071-151206093 CTCCAGAACTTTTGACAGATGGG + Intronic
1000053149 5:157579312-157579334 TTCCAGAACTTCTGACCAACTGG + Intergenic
1000842058 5:166232204-166232226 CTGTAGAATTTCTGACTAACTGG - Intergenic
1000963246 5:167625696-167625718 CTCCCAAATTTCTGACCCACAGG - Intronic
1001322806 5:170696946-170696968 CTCCAGAACTTCTGCACAGGAGG + Intronic
1001703493 5:173724326-173724348 CTCCTATAATTCTGACCAACTGG + Intergenic
1001835842 5:174831688-174831710 CACCAGAACTTCTGACCAACTGG + Intergenic
1001974199 5:175983576-175983598 CACCTGTACTTCTGACCAGCTGG + Intronic
1002243234 5:177860203-177860225 CACCTGTACTTCTGACCAGCTGG - Intergenic
1002257169 5:177966488-177966510 CACCTGCACTTCTGACAAACTGG + Intergenic
1002288214 5:178179824-178179846 CTTTGGAACTTCTGACCAATTGG + Intergenic
1002295143 5:178226370-178226392 CTTTGGAACTTCTGACCGACTGG + Intronic
1002659764 5:180783757-180783779 CTCCAGAACTTCTGACCAACTGG - Intergenic
1003188906 6:3855844-3855866 CTCCTGTACTTCTGATCAACTGG - Intergenic
1003400141 6:5784150-5784172 CTCCAGAGCTTCTGACCCATTGG - Intergenic
1003516186 6:6820956-6820978 CTCCAGCCCTCCTGACCAAGGGG - Intergenic
1003735159 6:8869811-8869833 CTCCACATCTTCTGAGCAAGAGG - Intergenic
1004461570 6:15841688-15841710 TTCCAGAACTTCTGGCCAACAGG + Intergenic
1004557997 6:16718463-16718485 TTCCAGAACTTCTAACCTATAGG + Intronic
1005023698 6:21442283-21442305 CTCCAGAACTTTTGACCAACTGG - Intergenic
1005194823 6:23270766-23270788 CTCTGGGACTTCTGAACAACTGG + Intergenic
1005222468 6:23602326-23602348 CACCAGTATTTCTGACTAACGGG - Intergenic
1005257079 6:24014667-24014689 TTTTAGAACTTCTGTCCAACGGG - Intergenic
1005818696 6:29578956-29578978 TTCTGGAACTTCTGACCTACTGG - Intronic
1006002461 6:30976111-30976133 CTCTGGAACTTCTGACCAACTGG + Intergenic
1006421003 6:33934099-33934121 CACCTGTACTTCTGACCAACCGG + Intergenic
1006519494 6:34563119-34563141 CCCCCGAACTTCCCACCAACCGG - Intergenic
1007767627 6:44170285-44170307 CTTCTGAATTTCTGACCCACAGG - Intronic
1008634119 6:53392479-53392501 CTCCAGAACTTCTGACTGACTGG + Intergenic
1008737697 6:54565963-54565985 ATCCATAAATTCTTACCAACTGG + Intergenic
1008738309 6:54574159-54574181 CTCCAGAACTTCTGACCAACTGG - Intergenic
1008742237 6:54623440-54623462 CTCTGGAACTTCTGACCAATTGG - Intergenic
1008952496 6:57175910-57175932 CTCCAGAACTTCTGACCAACTGG - Intronic
1010382308 6:75239184-75239206 CTTCGGAACTTCTGACTGACTGG - Intronic
1011249302 6:85353922-85353944 CTGCAGTACTTCTGACCATAGGG + Intergenic
1011512940 6:88121369-88121391 TTCCAGAACTTGTGCCCAAATGG + Intergenic
1011819049 6:91229377-91229399 CACCTACACTTCTGACCAACTGG + Intergenic
1013074989 6:106763411-106763433 CTCCAAAACTTCTGAATAACTGG - Intergenic
1013939441 6:115644380-115644402 ATCCTGAACTTCTGATCAACTGG - Intergenic
1014107578 6:117584379-117584401 TTCCAGAACTTCTGACTGAATGG + Intronic
1015394351 6:132718124-132718146 TTCCAGATCTTCCGACCAAATGG + Intergenic
1015640663 6:135328045-135328067 TTCCAGAACTTTTGACCAACCGG - Intronic
1015708190 6:136110895-136110917 CTCCAGGACTTCTGAGCACCTGG + Intronic
1016431227 6:143988432-143988454 CTCCAGAACCTCTGATGAAGTGG - Intronic
1016456369 6:144235030-144235052 CACCTGCACTTCTGACCAACTGG - Intergenic
1017038171 6:150285789-150285811 CACCAGTACTTCTAACCAACTGG - Intergenic
1017124180 6:151050580-151050602 CTCTGGAACTTCTGACCAACTGG - Intronic
1017782173 6:157724051-157724073 CACCAGTGCTTCTCACCAACTGG + Intronic
1017846068 6:158259726-158259748 TACCTGGACTTCTGACCAACTGG + Intronic
1018003577 6:159600690-159600712 CTCAAGAACTTCTGAACTCCTGG + Intergenic
1018047106 6:159975157-159975179 CTCTGGAACTTCTGACCAACTGG + Intronic
1019001037 6:168752382-168752404 CTCCAGAAGTTTTGACCCACTGG + Intergenic
1019300432 7:300376-300398 CACCAGAACTTCCCATCAACAGG - Intergenic
1019705356 7:2494804-2494826 CTCCAGCACTGCTGGCCACCAGG + Intergenic
1020334621 7:7053082-7053104 CTCTAGAACTTCTGACTGACCGG - Intergenic
1020454804 7:8359743-8359765 CACCTGCACTTCTGACCAAATGG - Intergenic
1021826057 7:24552520-24552542 CTCCAGAATTTCTGTCTAAAAGG + Intergenic
1023040936 7:36172842-36172864 CTCCAGAACTTCTGACCAACTGG - Intronic
1023392200 7:39721226-39721248 CTCCAGAACTTCTGACCACTGGG + Intergenic
1024027986 7:45430480-45430502 TTCCATAACTTCTGACCCACCGG - Intergenic
1024295619 7:47839646-47839668 CTCCAGCGCTCCTGCCCAACTGG - Exonic
1025289600 7:57703957-57703979 CCTCTGAACTTCTGACCTACTGG + Intergenic
1025947994 7:66119456-66119478 CTCCAGAACTTCTCAACGGCGGG - Intronic
1026574611 7:71561756-71561778 CACCAGGACTTGTGCCCAACAGG + Intronic
1027293719 7:76744723-76744745 CTCTGGAACTTCTGACAGACCGG + Intergenic
1028235946 7:88361597-88361619 CTCTAGCACTTCTGACCAACTGG - Intergenic
1029036648 7:97529361-97529383 CTCTGGAACTTCTGACAGACTGG + Intergenic
1029146891 7:98452765-98452787 CACATGCACTTCTGACCAACTGG - Intergenic
1030077281 7:105747615-105747637 CTCCAGAATTTCTGGCCTACTGG - Intronic
1030586890 7:111432051-111432073 CTCTGGAACTTCTGATGAACTGG - Intronic
1031479171 7:122257559-122257581 CTCTGGAACTTCTGACCAACAGG - Intergenic
1033035767 7:137874525-137874547 CTCCAGAAATTCTGATGAAATGG - Intergenic
1033147786 7:138885844-138885866 CTCCAGAACTTCTGACCGACTGG - Intronic
1034265749 7:149779877-149779899 CTCCATAACTTATAACCAAATGG - Intergenic
1034561138 7:151879924-151879946 ATCCGGAGCTTCTGACCGACAGG - Intergenic
1035174250 7:157039205-157039227 CTCCAGGTCTTCTGCTCAACTGG + Intergenic
1037452098 8:19025633-19025655 CACCAGTACTTCTGACCAAGTGG - Intronic
1038625671 8:29190652-29190674 CTCTAGAACTTCTGACCTACTGG - Intronic
1040055289 8:43052304-43052326 CACCTGAACTTCTAACAAACTGG - Intronic
1041650546 8:60297997-60298019 TTCCAGAACATCTTACCAACAGG + Intergenic
1041862994 8:62535487-62535509 CTCCAGAACTTCTGACCACCGGG + Intronic
1041950511 8:63495677-63495699 CTCCAGAACTTCTGACCACCTGG - Intergenic
1042111815 8:65389110-65389132 CTCCAGAAGTTCTGATCGACTGG - Intergenic
1042184189 8:66120882-66120904 GTCCTGCACTTCTGACCAACTGG - Intergenic
1042304533 8:67317304-67317326 CACAAGCACTTCTGACCAACTGG - Intronic
1042344668 8:67715271-67715293 CTCCTATATTTCTGACCAACTGG + Intronic
1042379332 8:68094886-68094908 CACCTGTATTTCTGACCAACTGG + Intronic
1042898054 8:73692652-73692674 CTTCTAAACTTGTGACCAACTGG - Intronic
1043028808 8:75105739-75105761 CTTCAAACCTTCTAACCAACTGG + Intergenic
1043559011 8:81468936-81468958 CGCTGGAACTTCTGACCAACAGG + Intergenic
1043913318 8:85890340-85890362 CACATGTACTTCTGACCAACTGG - Intergenic
1044098696 8:88102251-88102273 CCACAGAACTTCTGACCAACTGG + Intronic
1044553342 8:93536021-93536043 CTCCAAAACTTCCAACTAACTGG + Intergenic
1044581509 8:93830425-93830447 CTCCAGAAGTTCTGACAGACTGG - Intergenic
1045060996 8:98411008-98411030 CCCCAGAAAGTCTGACCAATTGG + Intronic
1045221191 8:100201988-100202010 CTCCAGAACTTCTCACCAACAGG - Intronic
1045414653 8:101953836-101953858 CACCTGCACTTTTGACCAACTGG - Intronic
1045517391 8:102872171-102872193 CTCCTGAACTTCTGACCTACAGG + Intronic
1045911538 8:107416230-107416252 CTCTGGAACTTCTCACCAACTGG + Intronic
1045991585 8:108314697-108314719 TTCTGGAACTTCTGACCCACTGG - Intronic
1046190448 8:110788590-110788612 CTTCAGAACTTATGACCACCTGG - Intergenic
1046198059 8:110888962-110888984 CTCTGGAACTTCTGACCGACTGG - Intergenic
1047605291 8:126468417-126468439 CACCAGGACTATTGACCAACTGG + Intergenic
1047969522 8:130072751-130072773 CTTCAGAACTTCTGACTGACTGG - Intronic
1048340785 8:133537080-133537102 CTCTGCAACTTCTGACCAACTGG + Intronic
1048715152 8:137260193-137260215 CTCCTGAATTTCTGACCCACAGG + Intergenic
1049508619 8:143016902-143016924 CTCTGGAACTTCTTACCGACTGG - Intergenic
1049862689 8:144910850-144910872 CTGCAAAACTTGTGACCAATGGG + Intergenic
1050487187 9:6146776-6146798 CTCTGGAACTTCTGATCAACTGG + Intergenic
1053090282 9:35269162-35269184 TGCCTGAACTTCTGACCAACTGG + Intronic
1054946520 9:70802008-70802030 CTCCAGAGCTTCTGATCAGCAGG + Intronic
1055185089 9:73441883-73441905 CTCCTATGCTTCTGACCAACTGG + Intergenic
1055484877 9:76747004-76747026 TTCTGGAACTTCTGACCCACTGG - Intronic
1055953620 9:81753761-81753783 CTCCTGAACTTGTGATCCACTGG - Intergenic
1056173836 9:84014622-84014644 CACCTGTACTTATGACCAACTGG - Intergenic
1056373203 9:85979974-85979996 TTCCAGAACTTCTGACCCACTGG + Intronic
1056592187 9:87972742-87972764 CTTCAGAATTGCTGACCAACTGG + Intronic
1056625084 9:88246204-88246226 CACTGGTACTTCTGACCAACTGG - Intergenic
1057080097 9:92167692-92167714 CTCCAGAACTTCTGATTGACAGG - Intergenic
1057711743 9:97451692-97451714 CTCTGGAACTTCTGACCACCTGG - Intronic
1057831192 9:98408549-98408571 CTCAAGAAGTTCTGCCCAATAGG + Intronic
1058418724 9:104815303-104815325 CTCCAGAAATTCTGATTCACAGG + Intronic
1058732855 9:107867329-107867351 CTCTATACCTTCTGACCTACAGG - Intergenic
1058825236 9:108769746-108769768 CTACAGAAATTCTGACTAAAAGG + Intergenic
1059142898 9:111870845-111870867 CTCCAGAACATCTGACCAACTGG - Intergenic
1059206778 9:112474663-112474685 GTCTGGAAATTCTGACCAACTGG - Intronic
1059263207 9:112999552-112999574 CTCCCATACTTCTGACCAACTGG + Intergenic
1059284316 9:113159774-113159796 CTCCCGTACTTCTGGCCAACTGG + Intronic
1060010448 9:120038994-120039016 CTCCAGTACTTCTGTCTAACTGG - Intergenic
1060699593 9:125739217-125739239 CACCTGTACTTCTAACCAACTGG + Intergenic
1061672485 9:132196852-132196874 CTCCCGTACTTCTGTCCAATTGG + Intronic
1062072747 9:134566607-134566629 CTCCATAACTTCTTAACGACAGG + Intergenic
1062180973 9:135191075-135191097 CTCCCTAATTCCTGACCAACAGG - Intergenic
1203610961 Un_KI270749v1:2984-3006 CCTCTGAACTTCTGACCTACTGG - Intergenic
1188597804 X:31922456-31922478 CTCTGGAACTTCTGACCCATGGG - Intronic
1190441532 X:50479856-50479878 TACCTGCACTTCTGACCAACTGG + Intergenic
1191197171 X:57736903-57736925 GTCCAGAAATTCTGTCCAAGAGG - Intergenic
1191930699 X:66368260-66368282 TTCCAGAAATTCTGACCAACTGG + Intergenic
1191943416 X:66503735-66503757 CCCCAGAGCTTCTGACCAAATGG - Intergenic
1195268734 X:103210597-103210619 CTCTGGAACTTCTGACCAACCGG + Intergenic
1195344189 X:103932197-103932219 CTCCAGAACTTCTGACAGATGGG - Intronic
1195362760 X:104101016-104101038 CTCCAGAACTTCTGACAGATGGG + Exonic
1195383020 X:104288823-104288845 CTGCAGAACTTCTAACCGATCGG - Intergenic
1196300630 X:114046842-114046864 CTCCAGTACCTCTGACTGACTGG - Intergenic
1197210632 X:123825450-123825472 TTCCAGAACTTCTGACTAACCGG - Intergenic
1197337960 X:125231294-125231316 CTCCAGAACTTCTGGTCAATGGG - Intergenic
1198256924 X:134932134-134932156 CTCCAGAACTTCTGACTGACTGG + Intergenic
1199237491 X:145507699-145507721 CTCTGGAACTTCTGACTGACCGG - Intergenic
1200897209 Y:8388420-8388442 CTCCAAAAATTCTGAACACCAGG + Intergenic
1201172403 Y:11281575-11281597 CTCCCATACTCCTGACCAACTGG + Intergenic