ID: 1008952498

View in Genome Browser
Species Human (GRCh38)
Location 6:57175927-57175949
Sequence CTGGAGGCCTAGACTTGCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008952492_1008952498 7 Left 1008952492 6:57175897-57175919 CCCCAATTTGAAGCCAGTTGGTC 0: 2
1: 31
2: 85
3: 216
4: 453
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952493_1008952498 6 Left 1008952493 6:57175898-57175920 CCCAATTTGAAGCCAGTTGGTCA 0: 3
1: 36
2: 134
3: 235
4: 490
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952494_1008952498 5 Left 1008952494 6:57175899-57175921 CCAATTTGAAGCCAGTTGGTCAG 0: 3
1: 33
2: 95
3: 192
4: 396
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952496_1008952498 -6 Left 1008952496 6:57175910-57175932 CCAGTTGGTCAGAAGTTCTGGAG 0: 15
1: 34
2: 74
3: 119
4: 331
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952489_1008952498 29 Left 1008952489 6:57175875-57175897 CCCAAAGAGGGGGACATGGGAAC 0: 1
1: 32
2: 86
3: 216
4: 573
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data
1008952490_1008952498 28 Left 1008952490 6:57175876-57175898 CCAAAGAGGGGGACATGGGAACC 0: 1
1: 26
2: 88
3: 241
4: 572
Right 1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008952498 Original CRISPR CTGGAGGCCTAGACTTGCAA CGG Intronic
No off target data available for this crispr