ID: 1008953180

View in Genome Browser
Species Human (GRCh38)
Location 6:57183026-57183048
Sequence GGCACCAAAGGAGCCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008953180_1008953185 -2 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953185 6:57183047-57183069 CCACACAGGCCACATGGTACTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1008953180_1008953189 11 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953189 6:57183060-57183082 ATGGTACTGGGCCAAGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 374
1008953180_1008953188 7 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953188 6:57183056-57183078 CCACATGGTACTGGGCCAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 230
1008953180_1008953190 16 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953190 6:57183065-57183087 ACTGGGCCAAGTGGCTGGTGAGG 0: 1
1: 0
2: 1
3: 27
4: 330
1008953180_1008953183 -8 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953183 6:57183041-57183063 TTGGTGCCACACAGGCCACATGG 0: 1
1: 0
2: 0
3: 19
4: 256
1008953180_1008953186 -1 Left 1008953180 6:57183026-57183048 CCTACTTGGGCTCCTTTGGTGCC 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1008953186 6:57183048-57183070 CACACAGGCCACATGGTACTGGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008953180 Original CRISPR GGCACCAAAGGAGCCCAAGT AGG (reversed) Intronic
900800219 1:4732524-4732546 GCCCCCGAAGGAGCCCAAGTTGG - Intronic
908291383 1:62670175-62670197 GGCCGCAAAGGAGCCCACGGAGG - Intronic
910218175 1:84863500-84863522 GCCAGCAAAGGAGCCCTAGAAGG - Intronic
917030053 1:170680443-170680465 GTCACCAAAGGATCCCAGATGGG - Intronic
919794733 1:201314586-201314608 GGAAACAAAGGAGACCAAATGGG + Intronic
922777304 1:228221171-228221193 GGCAACTCAGGAGGCCAAGTCGG - Intronic
923002965 1:230022845-230022867 GGCAGGAAAGGAGACCAAGTGGG + Intergenic
923157194 1:231289550-231289572 GGCAGCACAGGAGCCCATGGAGG + Intergenic
1063116005 10:3072332-3072354 GACACCAAAGGTGCCCATGTGGG - Intronic
1063205832 10:3829934-3829956 GGCACAAAAGGGGCTCAAGTTGG + Intergenic
1064580610 10:16789390-16789412 GGCAACAAAGGACTCCAGGTCGG + Intronic
1065514429 10:26510958-26510980 GACACCAAATAAGACCAAGTTGG - Intronic
1069012262 10:63386942-63386964 AACACCAAAGGAGCCCAAAGTGG + Intronic
1070241955 10:74690812-74690834 TGCACCAAAGGAGTCAAAGATGG - Intronic
1070564056 10:77590356-77590378 GGCAGCACAGGAGCCCACGGAGG + Intronic
1071041049 10:81309150-81309172 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1075018509 10:118929056-118929078 GGTACCACAGGAGGCCAACTAGG + Intergenic
1075323549 10:121511622-121511644 GGCACCAAAGGAGTGGGAGTGGG + Intronic
1080622231 11:33996449-33996471 GGCAACAAACAAGTCCAAGTGGG + Intergenic
1082058855 11:47843461-47843483 ACCAACAAAGGAGCCCAAGAAGG - Intronic
1082698720 11:56401995-56402017 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1085621097 11:78038487-78038509 GGAACCCAAGGAGGACAAGTTGG - Intronic
1087613216 11:100458548-100458570 GCCAGCAAAGGAGACCAAGAAGG + Intergenic
1087814529 11:102644038-102644060 AGCAGCAAAAGAGACCAAGTAGG + Intergenic
1088138886 11:106591814-106591836 GGCACTACAGGAGGCCAAGGTGG - Intergenic
1090562483 11:127947499-127947521 GGCACCAAAAGATACTAAGTTGG - Intergenic
1092272965 12:7037706-7037728 GGCAGCACAGGAGCCCATGGAGG - Intronic
1093095760 12:14970511-14970533 GGTATCAAAGAAGCCCAAGTGGG - Intergenic
1095799306 12:46255831-46255853 TGCTCCAAAGTAGCCAAAGTAGG + Intronic
1096123073 12:49101273-49101295 GGCACCAAAGGAGCCCAGCTTGG + Exonic
1099078855 12:78149454-78149476 GGCACCAGAGCAGCCCAGGATGG + Intronic
1104799302 12:131542723-131542745 GTCACCAAAGCAGCCCTGGTAGG - Intergenic
1108741050 13:53338764-53338786 GAAACCAAAGGGACCCAAGTTGG - Intergenic
1111388498 13:87561340-87561362 GGCACCTCAGGAGACCAAGGCGG - Intergenic
1112533129 13:100224124-100224146 GGCCCCACAGGAGCCCAGGGAGG + Intronic
1113543840 13:111131240-111131262 GGCACCAAGGGAGCCCAGGAGGG + Intronic
1116827725 14:49688392-49688414 GGCAGCAAAGGAGCGCGAGGTGG - Intronic
1119599848 14:75968228-75968250 GGCAACAAAGGACTCCAAATTGG - Intronic
1122875105 14:104660302-104660324 GGCACCCAGGGAGCCCAAATCGG - Intergenic
1124706453 15:31970431-31970453 GGGGCCAATGGAGCCCAAGCGGG + Intergenic
1128529051 15:68431715-68431737 GGCACCTAAGGCGCCCAGGAGGG + Intronic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1135280894 16:21152883-21152905 GGCAGCACAGGAGCCCACGGAGG - Intronic
1138682762 16:58698098-58698120 GCAACCAAAGGAGCCCTAATTGG + Intergenic
1141441240 16:84030969-84030991 GGCAGCAACAGAGACCAAGTGGG - Intronic
1141557486 16:84845687-84845709 GGCTCCACAGGAGCCCAGGCTGG + Intronic
1143452484 17:7043876-7043898 GGCAGCGATGGAGCCCAACTTGG + Exonic
1148217242 17:45839953-45839975 GGTGCCTAAGGAGCCCAGGTTGG + Intergenic
1150529272 17:65959616-65959638 GGAACCACAGGAACCCAAGGAGG - Intronic
1153987604 18:10367380-10367402 TGCTCAAAAGGAGCCCCAGTGGG - Intergenic
1156038712 18:32794860-32794882 GGCAGCAAAGGAGCCCACGGAGG - Intergenic
1156457130 18:37301170-37301192 GGCACCAAAGCAGCCAAGCTTGG + Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1160002546 18:75040241-75040263 GGCTCCGAAGAAGCCCAAATTGG - Intronic
1160590294 18:79940877-79940899 GGCCCCAAATGACCTCAAGTGGG - Intronic
1163950327 19:20578319-20578341 GGCACTATGGGAGGCCAAGTTGG - Intronic
1165901839 19:39172930-39172952 GGCAGCAAAGGTGCCAAAGATGG + Exonic
1166900161 19:46054996-46055018 GACACCAAAGATGTCCAAGTTGG - Intronic
1167726360 19:51215786-51215808 GGCACCAAATGAGCCCTGGTTGG - Intergenic
925404530 2:3597309-3597331 GACACCAGAGCAGCCCAGGTGGG - Intronic
926444501 2:12926625-12926647 GGCCGCACAGGAGCCCAAGGCGG + Intergenic
930468192 2:51780410-51780432 GGCAGCACAGGAGCCCATGGCGG + Intergenic
932235676 2:70119359-70119381 GGCAGCAAAGCAGCCCAGGTTGG + Intergenic
934220396 2:90076899-90076921 GGCACCAAAGGAGAAGAAGATGG - Intergenic
936286008 2:111181978-111182000 GGCACCTGAGGAGCCCAGGAGGG - Intergenic
938310674 2:130286494-130286516 GGCTCAAAAGGAGCCAAAGGAGG + Intergenic
940302761 2:152192903-152192925 AGCACCAAAGAAGCAAAAGTAGG + Intergenic
941240123 2:163026561-163026583 GGCAGCACAGGAGCCCATGGAGG - Intergenic
942460068 2:176162537-176162559 GGCAAACAAGGAGCCAAAGTTGG + Intronic
943106124 2:183546753-183546775 GGCAGCACAGGAGCCCAGGGGGG + Intergenic
943671939 2:190672137-190672159 GGCACCTTAGGAGTCCAAGGTGG - Intronic
945787249 2:214256684-214256706 GGCACCAAAGGAACCCAGTGTGG - Intronic
945790225 2:214295201-214295223 GGCAACCAAGGAGCAAAAGTGGG + Intronic
946660297 2:221992318-221992340 GGCAGCTAAGGAGCCAGAGTTGG - Intergenic
947836757 2:233181350-233181372 GCCAGCAAAGGAGACCAAGAAGG - Intronic
1172505415 20:35457908-35457930 GGCAGCAAAGGAGACTGAGTGGG + Intronic
1172841394 20:37904451-37904473 AGCCCCGAAGGAGCCCAAGTTGG + Intronic
1173400754 20:42723784-42723806 GCCACCCAAGGAGCCCACATGGG + Intronic
1175210106 20:57348682-57348704 GGCAGCACAGGAGCCCATGGAGG - Intergenic
1175480534 20:59307514-59307536 GTCACCTAAGAAGCCCATGTTGG - Intronic
1180181530 21:46120560-46120582 GGCAACAAAGGAGCCAAGGTAGG + Exonic
1182582239 22:31321178-31321200 GGCACCTGAGAACCCCAAGTAGG - Intergenic
1185106273 22:48871671-48871693 GGCCTCACAGGAGCCCAAGAGGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
957070980 3:75567660-75567682 GCCACTAAAGCAGCCCAAGAGGG + Intergenic
957995146 3:87679384-87679406 GGCAGCACAGGAGCCCACGGAGG - Intergenic
960199372 3:114812771-114812793 GGCCGCACAGGAGCCCACGTAGG + Intronic
961486622 3:127221632-127221654 GGCACCAAAGCAGCTGGAGTGGG + Intergenic
965078033 3:164003254-164003276 GGCGCCACAGGAGCCCATGGAGG - Intergenic
965446509 3:168780396-168780418 GGCAGCACAGGAGCCCAGGGAGG - Intergenic
966849518 3:184155926-184155948 GGAACCAAAGGGGCCCAAATGGG - Intronic
966947650 3:184788526-184788548 GGCAGCAAAGGAGAACAATTAGG + Intergenic
967133867 3:186496798-186496820 GGCTCCAAAGAATCCCAGGTAGG - Intergenic
969362396 4:6673010-6673032 GGCAGCACAGGAGCCCATGGAGG - Intergenic
974827801 4:67152166-67152188 GGCGGCACAGGAGCCCAAGGAGG - Intergenic
977343397 4:95788850-95788872 GGGAGAAAAGGAACCCAAGTTGG + Intergenic
978080292 4:104582267-104582289 GGCTGCACAGGAGCCCAAGGAGG - Intergenic
979149227 4:117287226-117287248 GGCACCAAAAGACCACAAATGGG + Intergenic
979561839 4:122109719-122109741 GGCACAAAAAATGCCCAAGTAGG + Intergenic
981078672 4:140616805-140616827 GTTACCACAGGAACCCAAGTAGG - Intergenic
982668318 4:158292305-158292327 GGCACCACAGGGGACCAAGAAGG - Intergenic
982803663 4:159735795-159735817 GTCATCCAAGGACCCCAAGTGGG + Intergenic
985088033 4:186334338-186334360 GGCATCAGAGAAGGCCAAGTAGG - Intergenic
985412070 4:189695766-189695788 GGCTGCACAGGAGCCCATGTGGG + Intergenic
990134711 5:52631333-52631355 GGCTGCAAAGGAGCACAAGCAGG - Intergenic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
991330196 5:65485547-65485569 GGCAGCACAGGAGCCCACGGAGG + Intergenic
993991244 5:94660850-94660872 GGGACAAAAGGAGCCAAAGCAGG - Intronic
994679101 5:102863278-102863300 AGGAGCAAAGGAGCCCAGGTGGG - Intronic
998561732 5:143178655-143178677 GGCACCAAGGGAGCCCCCATGGG - Intronic
1001547342 5:172578885-172578907 GGGACCAACGGAGCCAAAGCAGG - Intergenic
1002567055 5:180118204-180118226 GGGACCAAAGGGCCCCAAGTGGG + Intronic
1004004927 6:11629635-11629657 CGCAACAAATGATCCCAAGTTGG - Intergenic
1004499635 6:16198174-16198196 GGCCGCACAGGAGCCCAAGGCGG + Intergenic
1005459624 6:26056008-26056030 GGCAGCCAAGAAGCCCAAGAAGG - Exonic
1005478736 6:26234510-26234532 GGCAGCCAAGAAGCCCAAGAAGG - Exonic
1006749879 6:36370285-36370307 AGCACCAAAGGAGGCCGAGGTGG + Intronic
1007753850 6:44086148-44086170 GGCATAAAAGGGGCCCAAGGTGG - Intergenic
1008360614 6:50613281-50613303 GGCATCAGAGAAGGCCAAGTAGG + Intergenic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1010564004 6:77385814-77385836 GGCACCTTAGGAGGCCAAGATGG - Intergenic
1013734234 6:113206915-113206937 GTCAAAAAAGGAACCCAAGTAGG + Intergenic
1013963413 6:115928155-115928177 GGCAGCACAGGAGCCCACGGCGG + Intergenic
1022787868 7:33656970-33656992 AGCACCAAGGGAGCGCAAGATGG - Intergenic
1024465942 7:49711540-49711562 GGCAGCACAGGAGCCCACGGAGG - Intergenic
1024475633 7:49805928-49805950 TGCATCAAAGGAGCAGAAGTTGG + Intronic
1026061027 7:67026318-67026340 AGCACCACAGGAGGCCAAGGCGG - Intronic
1026717335 7:72801079-72801101 AGCACCACAGGAGGCCAAGGCGG + Intronic
1028816790 7:95156320-95156342 GGCACCACAGGACCCCAAAGAGG + Intronic
1029096409 7:98088588-98088610 GGCAAATAAGGAGACCAAGTAGG - Intergenic
1031693018 7:124814151-124814173 GGCACCAGCCCAGCCCAAGTTGG - Intergenic
1032767544 7:135012666-135012688 GGCACCAAAGAAACCCAATGAGG + Intronic
1037137957 8:15486039-15486061 GGCACCATGGGAGGCCAAGGTGG - Intronic
1038625128 8:29185076-29185098 GGAACAAAAGGAGGCCAAGATGG - Intronic
1041914559 8:63126360-63126382 GGCAGCACAGGAGCCCATGGAGG - Intergenic
1043102197 8:76060526-76060548 GGCCACAAAGGAGCCCACGGAGG + Intergenic
1046454435 8:114440292-114440314 GGCACCACAGGAGTACATGTGGG - Intergenic
1051972780 9:22911084-22911106 GGCACAAATGAAGCCCAATTAGG + Intergenic
1053370345 9:37556093-37556115 GGCACCAAAGCAACCCAATAAGG - Intronic
1054850555 9:69842864-69842886 AGCAGCAAGGGAGCCCAAGGTGG - Intronic
1056743790 9:89282711-89282733 GGCCCCACAGGAGCCCATGGAGG - Intergenic
1060777820 9:126389259-126389281 GGGAACAGAGGAGCCCAAGCTGG + Intronic
1061571102 9:131477867-131477889 GGCAGAGAAGGAGGCCAAGTTGG + Exonic
1062001571 9:134218519-134218541 GGCTGCAAAGCACCCCAAGTGGG - Intergenic
1062570414 9:137182566-137182588 AGCACCAAAGGAGTCCAGGTAGG + Intronic
1203670524 Un_KI270755v1:7215-7237 GGCTGCACAGGAGCCCATGTGGG - Intergenic
1190571453 X:51786677-51786699 GGTACCAAGGGAGGCTAAGTGGG - Intergenic
1192224430 X:69218467-69218489 GGCCCCAGAGGCGCCCAGGTGGG + Intergenic
1195259335 X:103117184-103117206 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1195321689 X:103726440-103726462 GGCTGCCAAGGAGCCAAAGTAGG + Intronic