ID: 1008955538

View in Genome Browser
Species Human (GRCh38)
Location 6:57212421-57212443
Sequence AAAGTGCAAGAGATTTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 8, 2: 28, 3: 92, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008955538_1008955542 5 Left 1008955538 6:57212421-57212443 CCCCAATAAATCTCTTGCACTTT 0: 1
1: 8
2: 28
3: 92
4: 452
Right 1008955542 6:57212449-57212471 CCATCTTGATACTTACTTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 169
1008955538_1008955543 18 Left 1008955538 6:57212421-57212443 CCCCAATAAATCTCTTGCACTTT 0: 1
1: 8
2: 28
3: 92
4: 452
Right 1008955543 6:57212462-57212484 TACTTCCTGGAGAACTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008955538 Original CRISPR AAAGTGCAAGAGATTTATTG GGG (reversed) Intronic
901802088 1:11714220-11714242 AAAGCACAACAGATTTATTTTGG + Intronic
902961232 1:19964144-19964166 GAAGTGCAGGAGATGTATGGAGG + Intergenic
903114127 1:21164396-21164418 TAAGTGCTTGAGATTTAGTGAGG - Intronic
903628667 1:24749397-24749419 AAAGGCCAAGAGATGTAATGGGG + Intronic
904815476 1:33193588-33193610 GGAGTGCAAGGGGTTTATTGAGG + Intergenic
905063632 1:35160955-35160977 AAAGAAAAAGAGATTTATTCAGG - Intergenic
905479960 1:38254858-38254880 AAAGAGCAAGTAATTTAATGTGG + Intergenic
905496192 1:38389881-38389903 AAAGTCAAAGAGGTTTATTTTGG - Intergenic
905529315 1:38664199-38664221 AAAGGGCAAGAGAGTGACTGAGG - Intergenic
905640820 1:39588623-39588645 GATGTGCAAGAAATTTATTTGGG - Intergenic
905841524 1:41183997-41184019 AAAGTTCTAGAGATTGATGGTGG + Intronic
907856828 1:58311776-58311798 GAAGTGCAAGAGACTTACTGGGG - Intronic
908075248 1:60510453-60510475 TTTGTGCAAGTGATTTATTGAGG - Intergenic
908083720 1:60608249-60608271 GATGTGCAAGAGATTTATTGCGG - Intergenic
908103178 1:60812148-60812170 GAAGTGTAAGAGATTTATTGAGG + Intergenic
908149835 1:61288641-61288663 ATAGGACAAGAGATTTATTGGGG + Intronic
908433609 1:64082895-64082917 AAAGTGCAAGAGATTTACTGGGG - Intronic
908765786 1:67553676-67553698 AAGGTGCAAAATATTTATTAGGG - Intergenic
908942886 1:69457337-69457359 AAAGCCCAAGACATTTTTTGAGG - Intergenic
908956888 1:69642866-69642888 TGATTGGAAGAGATTTATTGTGG + Intronic
909123284 1:71632701-71632723 AAATTACAAAACATTTATTGAGG + Intronic
909164540 1:72202542-72202564 AAAGTGCAATAGCTTTATTATGG + Intronic
909622754 1:77685545-77685567 AGTGTGCAGGAGATTTATTAGGG - Intergenic
909867115 1:80686936-80686958 AAAGTCCCAGAGATCTATAGGGG + Intergenic
910873452 1:91855878-91855900 TAAATACAAGAGATTTATTGGGG - Intronic
911344636 1:96681633-96681655 GGAGTGCAGGAGATTTATTGGGG - Intergenic
911645761 1:100335754-100335776 CAAGTGCAAGTAATTTATTTGGG - Intergenic
911911319 1:103639988-103640010 AAAGTGCAAGAGAGTGGTTGTGG + Intergenic
911917135 1:103711962-103711984 AAAGTGCAAGAGAGTGGTTGTGG - Intronic
911918734 1:103734126-103734148 AAAGTGCAAGAGAGTGGTTGTGG + Intronic
912039930 1:105377160-105377182 AAAGTTCTAGAGATTAATGGTGG + Intergenic
912186038 1:107276935-107276957 GATATGAAAGAGATTTATTGGGG + Intronic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
915131305 1:153697449-153697471 AAAGTGCCAGACATTTCTTCAGG + Intergenic
917356700 1:174133175-174133197 AACGTGCAAAAAATTTTTTGAGG - Intergenic
918585194 1:186178890-186178912 AAATTTCAAGACATTTATTTTGG + Intronic
918632196 1:186731032-186731054 AAAGTGCAAGAGAAATATATGGG - Intergenic
919019248 1:192082956-192082978 TGAGTGCAAGAGTTTTACTGGGG - Intergenic
919323025 1:196066915-196066937 AAAATTGAAGAGCTTTATTGAGG + Intergenic
919411611 1:197251561-197251583 AAAGTAGAAGAGATATTTTGAGG - Intergenic
919594837 1:199548301-199548323 GAAGTGCAAGAGATTTACTGGGG - Intergenic
919631801 1:199966640-199966662 AAAGTACAAAAAATTTATTGGGG + Intergenic
920782455 1:209007555-209007577 AAAGTAGAATATATTTATTGTGG - Intergenic
920877203 1:209847913-209847935 AAAAAGCAAGAGAGTTATTCTGG - Intronic
920884467 1:209913117-209913139 GAAGTGCAAGAGATTTACCGAGG - Intergenic
921562420 1:216674817-216674839 AAAGTTCAAGAGATTAATCTGGG - Intronic
921655925 1:217737422-217737444 TTGGTGCATGAGATTTATTGGGG + Intronic
921865293 1:220081928-220081950 AAAGTGGAAGAGGTTTATTAGGG - Intronic
922130237 1:222770653-222770675 GAAGCCCAAGAGATTTCTTGGGG + Intergenic
922204660 1:223436013-223436035 AGATGGCAAGAGATTTACTGGGG + Intergenic
922233192 1:223703724-223703746 GACATGCAAGAGACTTATTGGGG - Intronic
922271305 1:224037760-224037782 AAAGTTCTAGAGATGTATGGTGG + Intergenic
923069938 1:230553955-230553977 AATGAGCAATAGATGTATTGAGG + Intergenic
923175532 1:231460770-231460792 AAAATGCAAGTCATTTCTTGAGG + Intergenic
923748375 1:236724401-236724423 GAAGTGCAGGAGATTTTTTGGGG + Intronic
923967211 1:239155345-239155367 GATGTTCAAGAGATTTATTAGGG + Intergenic
924361565 1:243246984-243247006 AAAGTGCAAAATACTTATTTTGG - Intronic
1063289397 10:4728372-4728394 AAAATGCCAAAGATTAATTGAGG - Intergenic
1063394784 10:5676861-5676883 GACGTGCAATAGATTTATTAGGG + Intergenic
1063872382 10:10432222-10432244 AAAGTGCTAGAGATGATTTGCGG + Intergenic
1064661381 10:17611315-17611337 AAATTGCAAGACATCTGTTGAGG - Intronic
1064796359 10:19016210-19016232 AATGTGCAAGAGAGTGATTGTGG + Intergenic
1065237245 10:23665814-23665836 AAAGTGCAAGGGATTTATGGGGG + Intergenic
1065746863 10:28849914-28849936 GAAGTGCAAGAGATTTGGGGTGG - Intronic
1066680519 10:37933239-37933261 TAAGTTCAAGAGATTGACTGTGG - Intergenic
1067182481 10:43999446-43999468 AAAGTGGAAGATATTTATTCAGG - Intergenic
1068692633 10:59932611-59932633 GATGCACAAGAGATTTATTGGGG + Intergenic
1069316265 10:67107249-67107271 AAAGGCCAAGAGATTTAATTTGG - Intronic
1069873169 10:71545484-71545506 AAAGTGCAAAAGACTCTTTGGGG - Intronic
1072170785 10:92859555-92859577 TATATGCAAGTGATTTATTGAGG + Intronic
1072839297 10:98753111-98753133 AATTTCCAAGAGATCTATTGTGG + Intronic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1073933568 10:108603354-108603376 TAAGTGCACGAGTTTTTTTGAGG - Intergenic
1074192672 10:111151156-111151178 GATATGCAAGAGATTTATTTGGG - Intergenic
1074370421 10:112896324-112896346 ATAGAGGAAGCGATTTATTGTGG + Intergenic
1074478145 10:113791739-113791761 AAAGTGTAAGATATTAATTAAGG - Intergenic
1074657143 10:115603483-115603505 AAATTACAAGAGTTTTATGGGGG + Intronic
1074680668 10:115903951-115903973 AATGTGCAAGAGCTTTACTGGGG + Intronic
1075171609 10:120120910-120120932 GAAGTGCAGGAGATTTATTGAGG + Intergenic
1075226607 10:120634928-120634950 GATGTGGAAGAGATTTATTGCGG - Intergenic
1075233833 10:120709094-120709116 ATAGTTCAAGAGATTTATTTGGG - Intergenic
1075606079 10:123810633-123810655 GATGTGCAAGATATTTATGGAGG + Intronic
1077912911 11:6588471-6588493 AAAGTGCTATAGATCAATTGGGG + Intronic
1078310279 11:10233970-10233992 GGAGTGCAAGAGGTTGATTGAGG - Intronic
1078428953 11:11272557-11272579 AAAGTACAAGGGATTTGATGTGG - Intronic
1078558734 11:12352690-12352712 AAAGAACAAGAGGTCTATTGGGG + Intronic
1078799236 11:14625823-14625845 GACGTGCAAGTGACTTATTGTGG - Intronic
1079195752 11:18325169-18325191 AATGTGCAAGAGATAAATGGAGG - Intronic
1079287230 11:19146875-19146897 AAAGTTTAAGAAATTTATTAAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079540832 11:21572539-21572561 ATAGTGAAATAGTTTTATTGTGG + Intronic
1079666401 11:23111818-23111840 CACGTGCAAGAGATTTATTAGGG - Intergenic
1079975384 11:27084331-27084353 TGAATGCAAGAAATTTATTGAGG - Intronic
1079982899 11:27170295-27170317 AAAGTGCAAGAGAGTTATTGTGG - Intergenic
1080343510 11:31295740-31295762 TTAGTGCAAGAGACTTGTTGAGG - Intronic
1080531132 11:33177798-33177820 AATGTACAAGAAATTTATTGTGG + Intergenic
1081024561 11:37994048-37994070 GAAGACCAAGAGATTTGTTGGGG - Intergenic
1081068733 11:38582169-38582191 AAGGTTCTAGAGAGTTATTGAGG - Intergenic
1081229091 11:40563050-40563072 GATGTGCAAGATATTTACTGCGG - Intronic
1081409543 11:42740199-42740221 GATGTGCAAGAGATTTATTGGGG - Intergenic
1081503719 11:43693248-43693270 AAAGTGGAAGAGATTTGTCTGGG + Intronic
1082115044 11:48319136-48319158 AATATGCAAGAGATTTATTGGGG + Intergenic
1082258619 11:50060164-50060186 AATATGCAAGAGATTTATTGGGG - Intergenic
1083211101 11:61186959-61186981 AAAGTTTAACAGCTTTATTGAGG - Intergenic
1083575025 11:63784138-63784160 AAAGTGCAGGAGGTTCAGTGTGG + Intergenic
1084125667 11:67097382-67097404 CAAGTGCAAGAAGTTTATTTGGG - Intergenic
1085247039 11:75110236-75110258 CTTGTGCAAGTGATTTATTGAGG + Intronic
1087385671 11:97465117-97465139 AACATGCAAGAGATTTAAAGGGG + Intergenic
1087440783 11:98180695-98180717 AAAGTATAAGAGATTGATAGAGG + Intergenic
1087445890 11:98253026-98253048 AATATGAAAGAGATTTATTGGGG + Intergenic
1087509070 11:99067069-99067091 GATGTGCAAGTGATTTACTGGGG - Intronic
1087700539 11:101431760-101431782 TACATACAAGAGATTTATTGGGG - Intergenic
1088324563 11:108588351-108588373 AAATAGCAAGAGATTTAAAGTGG + Intronic
1088364239 11:109022138-109022160 AAAGGCCCAGAGATTTATAGTGG + Intergenic
1088395464 11:109363166-109363188 CAAGTGAAAGAGATTTGTTATGG - Intergenic
1091809135 12:3380260-3380282 AAAGTGCAAGTGATTTGTTTTGG - Intergenic
1091984214 12:4894746-4894768 AAAGTGCAAGACATTCAGAGTGG + Intergenic
1092249119 12:6882437-6882459 ACAGTACAATAGATATATTGTGG - Intronic
1092811894 12:12278825-12278847 AATGTGCAAGAGATTTATTGGGG + Intergenic
1092863701 12:12741973-12741995 AAAGTGAAAGAGAATAATTTAGG - Intronic
1094778389 12:33759331-33759353 AAAGTGCATAAGATTTATTGGGG - Intergenic
1095258878 12:40075268-40075290 AAATTGCTAGAGATTCACTGTGG - Intronic
1097338120 12:58407297-58407319 CCACTGCAAGAGATGTATTGAGG + Intergenic
1097530859 12:60798400-60798422 AAAGTACAAGAGATTTCCTAGGG + Intergenic
1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG + Intronic
1097789337 12:63797636-63797658 AAAGTCCAAGAGCCTTAATGTGG - Intronic
1097907954 12:64939947-64939969 AAACTGAAAGGGATTTAATGTGG + Intergenic
1097960958 12:65531623-65531645 CCAGTGCAAGAGAATTATGGTGG - Intergenic
1099490898 12:83286720-83286742 AAAGTGAAAAAAGTTTATTGGGG - Intergenic
1099898098 12:88673604-88673626 ACAGTGCAAATGATTTAGTGTGG + Intergenic
1100112170 12:91259150-91259172 GAAGTGCTAGAGATTTTTTGAGG + Intergenic
1101008168 12:100422669-100422691 AAAGAAAAACAGATTTATTGGGG - Intergenic
1101260661 12:103026475-103026497 AAAGTGCAAGAGATTTACTTGGG + Intergenic
1101260888 12:103028425-103028447 AAAGTGCAAGAGATTTACTGGGG - Intergenic
1101376418 12:104175215-104175237 AATGTGCTAGAAATTTATTAGGG + Intergenic
1101503386 12:105325212-105325234 GGAATGCAAGAGGTTTATTGGGG - Intronic
1102185227 12:110942365-110942387 AACTTGCAAGAGATTTATTGAGG - Intergenic
1102636518 12:114329292-114329314 AGAGTGCAAGAGATTTATTAGGG - Intergenic
1102800100 12:115724693-115724715 CACCTGCAAGAGATTTACTGGGG + Intergenic
1102863686 12:116357583-116357605 ATAGAGAAAGAGATTTATTATGG + Intergenic
1103220771 12:119242633-119242655 AAAATTTAAGAGCTTTATTGAGG + Intergenic
1103328297 12:120136401-120136423 GCAGGGCAACAGATTTATTGTGG - Intronic
1106404375 13:29461157-29461179 AAAGTGCAAGAGAGAGAGTGAGG + Intronic
1106778110 13:33027876-33027898 GATGTACAAGAAATTTATTGGGG + Intronic
1106820020 13:33454395-33454417 GATGTGCAAGAGATTTCTTAGGG - Intergenic
1107247394 13:38312024-38312046 CAAGTTCAAGAGATTTCTTGAGG - Intergenic
1107695518 13:42995553-42995575 AAAGTGAATGTGATTTATTATGG + Intergenic
1108529122 13:51312405-51312427 GACGTGCAAGAGATTCACTGGGG - Intergenic
1108891448 13:55265567-55265589 GAAGTGTAAAATATTTATTGGGG - Intergenic
1108996918 13:56746593-56746615 AAAGAGTTAGAAATTTATTGTGG + Intergenic
1109947211 13:69451812-69451834 AAAGTGGAAAAGAATTGTTGTGG + Intergenic
1110488631 13:76075869-76075891 CAAATGTAAGAGATTTATAGAGG - Intergenic
1110651650 13:77949533-77949555 GAAGTGGAAGAGATTTACTGGGG - Intergenic
1110777203 13:79421839-79421861 AAAGTCCAAGAAGTTTAATGGGG + Intergenic
1110782045 13:79478003-79478025 TCAGTGCAAGAGATTCACTGCGG + Intergenic
1110905228 13:80879186-80879208 AAAGTGCAAGAGAAGGATTGAGG - Intergenic
1110908816 13:80928925-80928947 AAAGGTCAAGAGATTGATTATGG + Intergenic
1111090272 13:83437378-83437400 AAAGCCCAAGAGATATAATGGGG - Intergenic
1111408686 13:87845398-87845420 AAAGTGCAAGGGATGGATAGAGG + Intergenic
1111882933 13:93980910-93980932 CTTGTGCAAGTGATTTATTGAGG - Intronic
1112021151 13:95372398-95372420 AAAGGGAAAGATATTTATTTAGG + Intergenic
1112943010 13:104889709-104889731 AGTGTGTAAGAGATTTATAGAGG + Intergenic
1112968647 13:105231428-105231450 AATGTGCTAAACATTTATTGAGG + Intergenic
1113357822 13:109600261-109600283 AAAGTGCAAGAGATGGATGCAGG + Intergenic
1113401857 13:110001544-110001566 GGAGTGCAAGAAATGTATTGTGG + Intergenic
1113980966 13:114275374-114275396 AAAGTGAAACAGCCTTATTGCGG - Intergenic
1114388703 14:22282843-22282865 ATAGTGAAGGAGATGTATTGGGG - Intergenic
1115213170 14:30988799-30988821 AAAGTGCAAGGTCTTTTTTGAGG - Intronic
1115338095 14:32262444-32262466 GAATTTCAAGAGATTTACTGGGG + Intergenic
1116622838 14:47227487-47227509 CATGTGCAAGTGATTTATTAAGG - Intronic
1116839062 14:49800907-49800929 AATGTCCAAGAAATTTATTGTGG - Intronic
1116955901 14:50922870-50922892 GAAGTGCAAGTGACATATTGGGG - Intronic
1116981773 14:51179002-51179024 GATGTGCAAGACATTTATTGAGG + Intergenic
1117229675 14:53703158-53703180 AAAGTGTAAGAGATTTATTTAGG + Intergenic
1118175047 14:63430837-63430859 AAACTACAGTAGATTTATTGTGG - Intronic
1119039421 14:71259409-71259431 GATGTGCATGAGATTTACTGAGG + Intergenic
1119060523 14:71469608-71469630 AAAGAGCAAGGGTTTTATTCTGG + Intronic
1119354979 14:73998857-73998879 AAAGTTGAAGAGATAGATTGAGG + Intronic
1119614726 14:76091564-76091586 GAAGTGCAGGAGATTTACTGAGG - Intergenic
1120381553 14:83786667-83786689 AAAGTGTAAGAAGTTTATTAGGG - Intergenic
1120381788 14:83789913-83789935 AAAGTGTAAGAAATTTATTAGGG + Intergenic
1120690869 14:87590811-87590833 AGAGTGCAAGAGGTTTAGGGAGG - Intergenic
1120737918 14:88076179-88076201 AATGTGCAAGAAAGTTATTAGGG + Intergenic
1121029304 14:90644597-90644619 AAAGTGTCAGAGATTTTTAGTGG + Intronic
1121398438 14:93648886-93648908 AAAGTCCAAAATATTTAATGTGG - Intronic
1122181177 14:99955885-99955907 AAATAGAAAGAGATTTATTATGG - Intergenic
1125081963 15:35685306-35685328 CAAGTGCAAGTGGTTTATTTGGG + Intergenic
1125154242 15:36568172-36568194 GACATGCAAGAGATTTATTGGGG + Intergenic
1125542441 15:40477741-40477763 GATGTGCAAGAGATTTATTGGGG + Intergenic
1126178733 15:45764479-45764501 AAGGTGTAAGATGTTTATTGGGG + Intergenic
1126179455 15:45770394-45770416 TAAGTGCATGAGATATTTTGTGG + Intergenic
1126696761 15:51332846-51332868 AAAGTACAAGTGACTTATAGGGG - Intronic
1127174197 15:56336623-56336645 AGAATGCAGGAGATTTAATGGGG + Intronic
1127699571 15:61484929-61484951 CTCGTGCAAGTGATTTATTGAGG - Intergenic
1128243962 15:66120288-66120310 AAAGTGGAAGAGATTTGAAGTGG + Intronic
1130211750 15:81930348-81930370 AATGTGTAAGAGTTTTATTCCGG + Intergenic
1130433733 15:83875079-83875101 GAAGTGAAAGAAATTTATTCAGG + Intronic
1131235322 15:90691888-90691910 AATGTGCAAATGATTTATTAAGG + Intergenic
1131583200 15:93665471-93665493 AATGCCCAAGAGATTTAGTGTGG - Intergenic
1132024462 15:98393023-98393045 GAAGTGCAGGAGATTTATAAAGG + Intergenic
1132435219 15:101795000-101795022 AAAGTGCAAGAGGATTTGTGGGG - Intergenic
1133856214 16:9551495-9551517 GACATGCAAGAGATTTATTGGGG - Intergenic
1136140901 16:28288001-28288023 GATGTGCAAATGATTTATTGAGG + Intergenic
1138165448 16:54797240-54797262 ATATAGAAAGAGATTTATTGTGG + Intergenic
1138639075 16:58368488-58368510 AAAGTTCTAGAGATTGATGGTGG - Intronic
1140204860 16:72925403-72925425 AAAGGGCAAGAGAATTCTAGAGG + Intronic
1141105034 16:81226522-81226544 CAAGAGCAAGAAATTTATTTGGG - Intergenic
1141557260 16:84844443-84844465 AAAGTGCCAGAGATGGATGGCGG - Intronic
1143002976 17:3806784-3806806 AAAGTTGTAGATATTTATTGTGG + Intergenic
1146316150 17:31808805-31808827 GAAGAGGAAAAGATTTATTGGGG + Intergenic
1146443107 17:32914303-32914325 AAAGTGCTAGAGATGGATTGTGG - Intergenic
1146553500 17:33802868-33802890 AAAGGGCTAGAGAGTCATTGTGG - Intronic
1146964330 17:37012032-37012054 AAATTGCAAGAGACTTCTTTTGG + Intronic
1148975760 17:51526981-51527003 AATGTGCAAAAGATTTATCAGGG - Intergenic
1148983637 17:51601034-51601056 AAAGTACATGATATTTATTTGGG + Intergenic
1149125664 17:53228179-53228201 AAAGTGCACAAGATTTACAGTGG - Intergenic
1151040345 17:70852395-70852417 AATTAGCAAGATATTTATTGTGG - Intergenic
1151534026 17:74727302-74727324 AATGTGCAAGGGTTTTACTGAGG + Intronic
1152220742 17:79063992-79064014 GAAGTCCATGAGATTTATTTGGG + Intergenic
1152980607 18:272750-272772 GATGTGCAAGAGATTTACTAAGG + Intergenic
1153629896 18:7059226-7059248 AAAGGGCAAAAGAAATATTGTGG - Intronic
1155765812 18:29630750-29630772 AAACTGCAAGAGGTATATTGGGG - Intergenic
1156026661 18:32662498-32662520 GATGTGCAATAGATGTATTGGGG - Intergenic
1156167673 18:34442877-34442899 CATGTTCAAGAAATTTATTGAGG + Intergenic
1158275419 18:55761617-55761639 AACTAGCAAGAGAGTTATTGGGG - Intergenic
1158444614 18:57508600-57508622 AAAGTGCATGGGAGTTCTTGGGG - Intergenic
1159354361 18:67318540-67318562 AATTTGAAAGAGATTTCTTGTGG + Intergenic
1159673288 18:71250065-71250087 CAAGTGCAAGTGATTTATTAAGG - Intergenic
1159745482 18:72229281-72229303 AACTTGCAAGAAATATATTGGGG - Intergenic
1162994277 19:14324001-14324023 AAAGTACAAGAGATTCACGGGGG - Intergenic
1165399004 19:35585856-35585878 TAAGAGTAAGAGATTTACTGAGG - Intergenic
1165700720 19:37935324-37935346 AATGTGCAAGAGATTTTTGTTGG + Intronic
1168126181 19:54284905-54284927 AAAGTGCAAGAAAATGACTGGGG + Intergenic
1168660257 19:58160102-58160124 GAACTGCAAAAGGTTTATTGGGG + Intergenic
925677276 2:6376784-6376806 AGAGTGCAAGATATTGATTGTGG - Intergenic
927318240 2:21710967-21710989 AAAGAGCAAGAAATAGATTGTGG - Intergenic
929621201 2:43355924-43355946 AATGTGAAAAAGATTTAGTGAGG + Intronic
930282110 2:49381774-49381796 AAAGAAGAAGAGATTTATTCTGG + Intergenic
930287018 2:49443438-49443460 AAAGAGCAAGAGAGTTATCTGGG - Intergenic
930291769 2:49502995-49503017 GAAGTACAATAGATTTACTGGGG - Intergenic
930818879 2:55625798-55625820 GACATGCAAGATATTTATTGGGG - Intergenic
930876443 2:56223496-56223518 AAAGTGAGATAGAATTATTGAGG - Intronic
931088721 2:58863260-58863282 AATGTGTGAGAGATTTAATGAGG - Intergenic
931291238 2:60875806-60875828 ACAGTGCAAGAGATTTATTGGGG - Intergenic
931377371 2:61719305-61719327 GAAGGGCAAGAGATTCGTTGTGG + Intergenic
931629440 2:64285656-64285678 AATGTGCAAGAGAATCATGGGGG + Intergenic
931851244 2:66252381-66252403 AAAGTGCAATAGATAAATTATGG - Intergenic
932289526 2:70564934-70564956 AAAGCGAAATAGATTTATTGTGG - Intergenic
932617279 2:73241587-73241609 AAACTGGAAGAAATTTATTTCGG - Intronic
933331415 2:80897013-80897035 AGAGAGCAAGAAATTCATTGGGG - Intergenic
933342688 2:81042788-81042810 AATGTGCAAGAGATTGATTGTGG + Intergenic
933656718 2:84894576-84894598 AATGTGCAGGATATTTATTAAGG - Intronic
934016410 2:87890116-87890138 AAAGGGCAGTAGATTAATTGTGG - Intergenic
934898705 2:98140367-98140389 AGAGTGCAGGAGATTTAGTCTGG + Intronic
935287264 2:101576189-101576211 AATGTGCAAGAATTTTATTAGGG + Intergenic
935616789 2:105094059-105094081 AAAGTGCAAGTAATTTCTTGTGG + Intronic
935657390 2:105435865-105435887 AAAGTGCAAGAATTTCATTCTGG - Intronic
935949907 2:108319187-108319209 TAAGAGTAAGAGATTTATTGAGG - Intergenic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
936527412 2:113251031-113251053 AAATTGAAAGACATTTAGTGTGG + Intronic
936960410 2:118067816-118067838 ACAGTGCAAAAGATTTAAAGTGG - Intergenic
937064414 2:119006396-119006418 GGAGTGCAAGAGAAATATTGGGG + Intergenic
937974026 2:127570257-127570279 GGACTGCAAGAGGTTTATTGAGG + Intronic
939217798 2:139262379-139262401 GAAGTTCAAGACATTAATTGGGG + Intergenic
939244052 2:139599896-139599918 GGTGTGCAAGATATTTATTGAGG - Intergenic
940071570 2:149694063-149694085 AAAATGCAAAAGATTTAGTTTGG - Intergenic
940606501 2:155930386-155930408 CTAGTGCAAATGATTTATTGAGG + Intergenic
940822611 2:158373684-158373706 AAAGGGCTATAGATTTATTCAGG + Intronic
941107814 2:161379670-161379692 GACATGCAAGAGATTTATTGGGG + Intronic
941148047 2:161877577-161877599 AAATTTCATGGGATTTATTGTGG - Intronic
941268679 2:163397571-163397593 GATATGCAAGAGATTTATTGGGG + Intergenic
941324648 2:164098525-164098547 GAAGTTCAAGAGATTTACTAGGG - Intergenic
941848075 2:170151204-170151226 TAAGTGCAAGTAATTTATTTGGG - Intergenic
943142141 2:183996314-183996336 AAAGATGAATAGATTTATTGAGG - Intergenic
943206226 2:184900626-184900648 AATATTCAAAAGATTTATTGGGG + Intronic
943465892 2:188228756-188228778 AAAGTTCAAAAAAATTATTGAGG + Intergenic
943500775 2:188686602-188686624 AAAGTGCAAGAGCTTTCATTCGG - Intergenic
944093580 2:195941712-195941734 GAAGTGCAAAAGGTTTAATGAGG - Intronic
944115075 2:196177148-196177170 AAAAAGGAAGAGATTTATTAGGG - Intergenic
944206898 2:197166113-197166135 AAAGTGGAATATCTTTATTGGGG + Intronic
944678675 2:202055957-202055979 GGTGTGCAAGAGATTTCTTGAGG + Intergenic
944706113 2:202290273-202290295 AAACTTAAAGGGATTTATTGTGG - Intronic
945011276 2:205466454-205466476 AAGGTGCAAGAGATTTCTCTGGG - Intronic
946460873 2:219867573-219867595 AAAGATCAAAAGATTTGTTGTGG - Intergenic
946550589 2:220797539-220797561 AAAGAGGAAGAGATTTATTTGGG + Intergenic
946702625 2:222427990-222428012 AAGGGTTAAGAGATTTATTGAGG + Intronic
947022084 2:225690395-225690417 CAATTTCAAAAGATTTATTGAGG + Intergenic
947946524 2:234108149-234108171 TAATTGCAAGACATTTATTAAGG - Intergenic
948258531 2:236585698-236585720 AAAGTGGTTGAGATTTATGGTGG + Intergenic
948297994 2:236877434-236877456 GGAGTGCAAGATATTTATTAAGG + Intergenic
1169476959 20:5940245-5940267 GAAGTGTAAGAGATTTATTGAGG - Intronic
1169584872 20:7070040-7070062 GGAGTGCAAAAGATTTATTGAGG + Intergenic
1169794202 20:9443728-9443750 CATGTGCAAGTGATTGATTGAGG - Intronic
1169817636 20:9674667-9674689 TAAATGCTCGAGATTTATTGAGG + Intronic
1170055850 20:12201664-12201686 ATTTTGCAAGTGATTTATTGAGG - Intergenic
1170083119 20:12498376-12498398 TTTGTGCAAGCGATTTATTGAGG - Intergenic
1170130567 20:13014604-13014626 TGAGTGCAAGAAATTTATTAGGG + Intronic
1170833029 20:19859865-19859887 CAAGTGCAAGTGGTTTATTTGGG + Intergenic
1170923595 20:20702314-20702336 GACATGCAAGAGATTTATTGGGG + Intronic
1173167853 20:40698644-40698666 TATGTGTAAGAGATTGATTGGGG + Intergenic
1173294953 20:41748141-41748163 AAAGAGCCAGAGAGCTATTGTGG - Intergenic
1173460722 20:43241195-43241217 CTTGTGCAAGTGATTTATTGAGG - Intergenic
1173473817 20:43344431-43344453 CAAGTGAAAGATATTTATTTGGG - Intergenic
1173777358 20:45721465-45721487 AAAGTTCAAGAGATTAAGTGTGG + Intergenic
1175024144 20:55883370-55883392 ACTGTGAAAGTGATTTATTGAGG - Intergenic
1177631581 21:23735605-23735627 AATGGGCAAGATATTTCTTGTGG + Intergenic
1177649308 21:23940016-23940038 AGAGTGCTAGAGATTTGTTGAGG - Intergenic
1178211501 21:30538801-30538823 AAAGGCCAAGAGATTTTTTAAGG + Intergenic
1178473296 21:32914331-32914353 ATAATGGAAGACATTTATTGAGG + Intergenic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1183602424 22:38847684-38847706 GAAGTGCAAGTGCTTTATTGGGG + Intergenic
1184088125 22:42278059-42278081 AAAGTTCAAGGGTTTTAGTGAGG + Intronic
1184102379 22:42347622-42347644 CCAGAGCGAGAGATTTATTGTGG - Intergenic
1184314929 22:43679121-43679143 AATGTGCACGAGATTTCTTCTGG - Intronic
949168488 3:969629-969651 ACAGTGCAAAATAATTATTGAGG - Intergenic
949189186 3:1231128-1231150 CAAGTGCATATGATTTATTGAGG - Intronic
949665956 3:6339956-6339978 ACAGTGCAAGAGATGTAGTCTGG - Intergenic
950750076 3:15121478-15121500 GACGTGCAAGAGATTTATTGGGG + Intergenic
950920228 3:16686553-16686575 AATGTGCAAGAAATGTATTAAGG + Intergenic
951103268 3:18714121-18714143 AAAGTTCAAGAGTTCTATTTGGG - Intergenic
951597493 3:24334055-24334077 AAAGTGGAAGGTAATTATTGCGG - Intronic
951609912 3:24480152-24480174 CAAGTGCAAGTGATTTTTAGGGG - Intronic
951860003 3:27241684-27241706 GAAGTGCAAGTGGTTTATTCTGG - Intronic
951872963 3:27386260-27386282 GTAGTGCAAGGGATTTATTCAGG - Intronic
952046384 3:29326472-29326494 AATAAGCAAGAGATTAATTGTGG - Intronic
952108264 3:30093396-30093418 AAAGTGAAAGAGATTTTTTGGGG + Intergenic
952220441 3:31318835-31318857 AGAGTGCAAAAAATTTATGGGGG - Intergenic
952313272 3:32209672-32209694 TTTGTGCAAGTGATTTATTGAGG - Intergenic
953148921 3:40306280-40306302 GATGTGCAAGAAATTTATTGGGG + Intergenic
953481384 3:43255228-43255250 CAGGTGCATGTGATTTATTGAGG - Intergenic
953583050 3:44174135-44174157 AACCTGCAACAGTTTTATTGGGG + Intergenic
953682287 3:45048663-45048685 GAAGTGTAAGAGATGTTTTGGGG - Intergenic
953736243 3:45496450-45496472 GACATGCAAGAGATTTCTTGGGG + Intronic
955110210 3:55941555-55941577 AACATGCAAGAAGTTTATTGAGG - Intronic
956526160 3:70164440-70164462 TAACTTCAAGGGATTTATTGAGG + Intergenic
957612829 3:82490461-82490483 AAAGTGCAAGAAGTTGATTGGGG + Intergenic
957630342 3:82709961-82709983 GAAGTGCAAGAAATTTATTGGGG - Intergenic
957892359 3:86376909-86376931 TGCGTGCAAGAAATTTATTGGGG + Intergenic
958078953 3:88720460-88720482 AGAGGGCAAGAGATTAATTTAGG + Intergenic
958747475 3:98154426-98154448 AAAGTGCCAGACATTTTCTGTGG - Intergenic
958856818 3:99395268-99395290 AAATTGGAAGAGATTTTTTGGGG - Intergenic
959444443 3:106421281-106421303 GAAGTGCAAGAGATTGATTGGGG + Intergenic
959559235 3:107760568-107760590 AGAGTGCAAGTGATTTAATAAGG + Intronic
959607163 3:108254057-108254079 GAAGTGCAGGAGATTTTTTTAGG - Intergenic
959953469 3:112208603-112208625 AAAGTGAATGAGATTTAAGGAGG - Intronic
960044679 3:113185431-113185453 TAAGTGCAAGAGATTTATTGGGG - Intergenic
960445130 3:117738872-117738894 ACTGTGCAAGGGATTTAGTGGGG + Intergenic
961111156 3:124284273-124284295 AAAGGGCAAAAGATGCATTGGGG - Intronic
961332704 3:126152348-126152370 CTTGTGCAAGTGATTTATTGAGG - Intronic
961479552 3:127171218-127171240 GGTGTGCAGGAGATTTATTGAGG + Intergenic
962169082 3:133081722-133081744 GAAATGCAAAAGATCTATTGGGG + Intronic
962239818 3:133742984-133743006 AAAGAGAAAGAGATTGATAGAGG - Intergenic
962330856 3:134476603-134476625 CTTGTGCAAGTGATTTATTGAGG - Intergenic
962842576 3:139249299-139249321 AAAGTGCAAAAGAATAATTAAGG - Intronic
963466747 3:145691383-145691405 AATGAGCAAGAGATTTATTGAGG - Intergenic
963837821 3:150074737-150074759 AAAGTGAAAGAGGATGATTGAGG - Intergenic
963959798 3:151296665-151296687 AATGGCCAAGAGATTTACTGGGG - Intronic
964056995 3:152472991-152473013 AAAATGCAAGAGACTTAGTGGGG + Intergenic
964302663 3:155306314-155306336 AATGTGCAAGAGTTTTATGAAGG - Intergenic
964438926 3:156684102-156684124 AAATTGCAAGATAATTATTTTGG + Intronic
964835204 3:160930401-160930423 CACTTGCAAGAGATTTATGGGGG + Intronic
964881385 3:161427031-161427053 ACAGTGCAAGACATTAATTGTGG + Intergenic
965154580 3:165032062-165032084 AAAGTACAAGATATATTTTGAGG + Intronic
965169942 3:165250057-165250079 AAAGAAAAAGATATTTATTGGGG + Intergenic
965806774 3:172550427-172550449 CCTGTGCAAGTGATTTATTGAGG + Intergenic
966343450 3:178951344-178951366 ATAGAGAAAGAGATTTATTATGG + Intergenic
966697983 3:182812809-182812831 AAAGTTCAAGAGATGGATGGTGG - Intronic
966922098 3:184619137-184619159 GATATGCAAGAGATTTACTGGGG - Intronic
967323863 3:188219780-188219802 AAAGTGCAAGATATATCTGGGGG - Intronic
967495349 3:190137825-190137847 AATGTTTAATAGATTTATTGAGG - Intergenic
968536642 4:1134980-1135002 CAAGTGCAAGTGATTTGTTAAGG - Intergenic
970261425 4:14228845-14228867 CAAGTGTAAGAGGATTATTGAGG + Intergenic
970599330 4:17628618-17628640 GAAGTGCAAGACATTCACTGGGG - Exonic
971037410 4:22709247-22709269 AACGTGCAAGAAATTTATTCAGG + Intergenic
971448324 4:26776826-26776848 AAACTGCAAGTGATTTATAAGGG - Intergenic
971708411 4:30078759-30078781 GAAGTGCAAGATATTTATTAGGG + Intergenic
971765064 4:30820050-30820072 AAAGTCCAAGAGTATTATTTTGG - Intronic
971834029 4:31738078-31738100 GAATTGCAATAGACTTATTGAGG - Intergenic
972570106 4:40303012-40303034 GAGGTGCAAGAGATTTATGAGGG + Intergenic
974116816 4:57589251-57589273 AAAGTGCTAGAGCTGAATTGTGG + Intergenic
974667906 4:64989185-64989207 AATGTGTAAGAGTTTTATTTTGG + Intergenic
975273549 4:72466996-72467018 AATGTGCCAGAGATATAGTGAGG - Intronic
975495555 4:75032094-75032116 AAAGGGAAAGAGAATTATTCTGG + Intronic
975716013 4:77206435-77206457 TAAGTGCAAGAGACTCAGTGGGG + Intronic
975988736 4:80234323-80234345 AAAGTGTATTAGATTTATTCTGG - Intergenic
976132386 4:81898220-81898242 GATGTGCAAGTCATTTATTGAGG - Intronic
977029696 4:91865896-91865918 AGACTGCAAGACATTTATTCGGG - Intergenic
977722345 4:100254370-100254392 GACATGCAAGAGATTTATTGTGG + Intergenic
977820501 4:101466339-101466361 AAAATTCAAGAGATACATTGGGG - Intronic
977883298 4:102231127-102231149 AAAATGTAAGAGAATTAGTGTGG + Intergenic
977960641 4:103081237-103081259 AAAGTGGAAGAGATTAAATTAGG + Intronic
978589051 4:110304263-110304285 AATGTGCAAGATATTCATTAGGG + Intergenic
978852071 4:113350738-113350760 AAAGTGCAAAAGAGTGATGGGGG - Intronic
979013471 4:115400740-115400762 AAAGTGCAGGAGATTTCTCCAGG + Intergenic
979152909 4:117342278-117342300 AAAGATCAAGAGAATGATTGGGG - Intergenic
979560450 4:122096043-122096065 AAGTTACAAGAGATTTATCGTGG + Intergenic
979685123 4:123503603-123503625 CAAGTGCATTACATTTATTGTGG + Intergenic
980547119 4:134279739-134279761 AAAGTGTAATCTATTTATTGTGG - Intergenic
981039401 4:140209598-140209620 GACATGCAAGAGATTTATTGGGG + Intergenic
981499869 4:145438674-145438696 GACGTACATGAGATTTATTGGGG - Intergenic
981557896 4:146015327-146015349 AAAGTGGTAGAGCTTTATTCTGG + Intergenic
982399108 4:154946340-154946362 TTTGTGAAAGAGATTTATTGAGG - Intergenic
982837756 4:160143941-160143963 AAAGTGAAAGAAATTTATACTGG - Intergenic
982973636 4:162023661-162023683 TAAGTAAAAGAGATTTATTAAGG + Intronic
983766633 4:171492028-171492050 AGAGTGGGAAAGATTTATTGTGG - Intergenic
984006266 4:174313701-174313723 AAAGAGCAGGTGATTTATTTGGG + Intronic
984731065 4:183068764-183068786 AATGAGAAAGAGATTTATTACGG + Intergenic
986372320 5:7092293-7092315 AAATTGCAAGAAATATGTTGTGG - Intergenic
986495354 5:8336088-8336110 AAAGTAAAAGATATTTATTGAGG + Intergenic
986653258 5:9986003-9986025 AAAGTGCATAACGTTTATTGTGG - Intergenic
987526231 5:19053443-19053465 AAGGTGCAAGTGACTTTTTGTGG + Intergenic
988396713 5:30705093-30705115 AAAGTGTAAGAGTATTATTAGGG + Intergenic
989085272 5:37669641-37669663 AATGTGTAAGAGATTTACTGGGG + Intronic
989210174 5:38851388-38851410 CATGTGCAAGAGATTTACTGGGG + Intronic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989540310 5:42610561-42610583 GATGTGCAAGAGATTTATCTGGG + Intronic
990561968 5:56992323-56992345 GACGCACAAGAGATTTATTGGGG + Intergenic
990631467 5:57674789-57674811 AAAATAAAAGAGATTTATTGGGG - Intergenic
991150208 5:63359180-63359202 AACATGCAAGTGATTTATTAAGG - Intergenic
991649402 5:68836766-68836788 GATGTGCAAGGGATTTATTGGGG - Intergenic
993135687 5:83958988-83959010 CAATTACAAGAGATTTAATGTGG + Intronic
993152749 5:84181626-84181648 AAAGTGTAAAAGATTTTTGGGGG - Intronic
993424142 5:87741451-87741473 AAAGGGCAAGAAATTATTTGTGG + Intergenic
993505075 5:88699328-88699350 AAAGTGTAAGAGATTTATATTGG + Intergenic
994111085 5:96005216-96005238 AAAGTCCAAGAGATAGATAGGGG + Intergenic
994276309 5:97842583-97842605 GAGGTGCAAGACATTAATTGGGG + Intergenic
994828083 5:104742500-104742522 TCTATGCAAGAGATTTATTGAGG - Intergenic
995135429 5:108674978-108675000 GATGTGTAAGAGATTTATAGAGG - Intergenic
995337735 5:111021038-111021060 AGATTCTAAGAGATTTATTGAGG + Intergenic
995712838 5:115052374-115052396 CATGTGCAAGAGGTTTATTAAGG - Intergenic
996344158 5:122471720-122471742 GATGTGCAAGAGATTTATTACGG - Intergenic
997256719 5:132434645-132434667 AAAGTGCAGAAGATTTATTGGGG + Intronic
998072597 5:139209978-139210000 AGGGTTCAAGATATTTATTGTGG - Intronic
999161249 5:149501188-149501210 AAAGTGCAAGAGTTGGTTTGTGG - Intronic
999480214 5:151941209-151941231 AAAGTGCTACAAATTCATTGTGG - Intergenic
999876905 5:155817642-155817664 AAAGGGCATGAGATTTATGTAGG + Intergenic
1000312814 5:160061804-160061826 AAAGTACAAGAGATTTACTGGGG + Intronic
1000388656 5:160700376-160700398 AAAGTGCTAGAGATGTATATGGG - Intronic
1000616585 5:163434517-163434539 AAAGTACCAGACATTTATTAGGG + Intergenic
1000918944 5:167116129-167116151 TACATGCAAGAGATTTATTGCGG + Intergenic
1001073982 5:168610490-168610512 AAAGTGCATGTGATATAGTGGGG - Intergenic
1003712994 6:8614347-8614369 CAAGTGCATTATATTTATTGTGG - Intergenic
1004473257 6:15947762-15947784 GATGTGCAAGAGATTTATTGGGG + Intergenic
1004588803 6:17029130-17029152 GCCATGCAAGAGATTTATTGGGG + Intergenic
1005307868 6:24530997-24531019 AAAATGCAAGACATTTCTGGAGG - Intronic
1005675644 6:28152092-28152114 AAAATGCATGAGATTTACTGGGG - Intronic
1006737171 6:36282455-36282477 AAAGTCCAAGGGATTGTTTGGGG - Intronic
1007109614 6:39305347-39305369 GATGCGCAAGAGATATATTGAGG - Intronic
1007201947 6:40116879-40116901 AAAGTACAAGAGACTTATTGGGG - Intergenic
1008286326 6:49655902-49655924 AAAGTTCAAGAAATTTAGTTAGG - Intergenic
1008395170 6:50997883-50997905 TAAGTACAAGAGATCTATTGGGG - Intergenic
1008577581 6:52875994-52876016 AAAGTCTGAGAGATTTATGGTGG - Intronic
1008955538 6:57212421-57212443 AAAGTGCAAGAGATTTATTGGGG - Intronic
1009339391 6:62534397-62534419 GACATGCAGGAGATTTATTGGGG - Intergenic
1010289123 6:74115300-74115322 ATTGTGAAAGAGATTTACTGGGG + Intergenic
1010294990 6:74185249-74185271 GACATGCAATAGATTTATTGAGG + Intergenic
1011124934 6:83996976-83996998 AAATTGTAATAGCTTTATTGAGG - Intergenic
1011720423 6:90150533-90150555 GATGTGCTAGAGATTTCTTGGGG + Intronic
1011870854 6:91890652-91890674 AGAGTGCAAATGTTTTATTGAGG + Intergenic
1012205715 6:96458160-96458182 CAATAGCAAGGGATTTATTGGGG - Intergenic
1013362607 6:109408284-109408306 AAAGAGCAAGTGATTTATAAGGG - Intronic
1013504146 6:110782368-110782390 AAAGTTCAAGGGATTTATTTAGG - Intronic
1013996677 6:116316971-116316993 AATGTGCAAGAAATTTAGTAGGG + Intronic
1014220565 6:118794962-118794984 AAAGTGCTAGAGATGTGTGGAGG - Intergenic
1014297857 6:119642412-119642434 CAAGGGCAAGAGATTGATTGGGG - Intergenic
1014326271 6:119999226-119999248 AAACTGCAAGAGATTTGATAGGG - Intergenic
1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG + Intergenic
1015053396 6:128869698-128869720 AAAGTCAAAGAGATTTGTGGGGG - Intergenic
1015660601 6:135570009-135570031 GATGTGCAAGAAATTTACTGGGG - Intergenic
1016064401 6:139664406-139664428 AAAAAACAAGAGATTTATTTTGG + Intergenic
1016268977 6:142266284-142266306 GAAGTGCAAGAGAGATATTGGGG + Intergenic
1016556541 6:145344799-145344821 AAACTACAAGGGATTTAGTGTGG - Intergenic
1016888880 6:148985887-148985909 GATGTGCAAGAGATTTATTGGGG + Intronic
1017101192 6:150851221-150851243 AAAGTTCAAGAGATCTACAGTGG - Intergenic
1018725521 6:166610042-166610064 AAATAGCAAGAGATATAATGAGG - Intronic
1019025587 6:168960293-168960315 AAAATGCAAGACATTTATTAGGG + Intergenic
1020697634 7:11434649-11434671 TAAGTAGAAGAGATTTTTTGAGG - Intronic
1021092159 7:16496513-16496535 GCTGTGCAAGAGATTTATTAAGG + Intronic
1022074715 7:26956033-26956055 AAAGGACAAGAGACTTTTTGGGG - Intronic
1022215246 7:28253268-28253290 AACATGCAAGAGACTTATTAGGG - Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1024603011 7:51001746-51001768 CCAGTGCAAGTGATTTATTTGGG - Intergenic
1024828317 7:53418535-53418557 AAAGTGCCATAGATTTCTTGAGG - Intergenic
1025116192 7:56260499-56260521 AGAGTGCAAGTGATTTATTAGGG - Intergenic
1025146165 7:56506207-56506229 TAAGTGCAAGAGGTTGATTTGGG - Intergenic
1028405212 7:90466877-90466899 GAAGTCCAAGAGTTTTACTGGGG + Intronic
1028749088 7:94362203-94362225 AATGTGCAATCAATTTATTGGGG + Intergenic
1028953484 7:96663396-96663418 AAGGTGCAAGAGATTTGCTGGGG + Intronic
1029931200 7:104373107-104373129 AAAGTTCACCAGAATTATTGTGG - Intronic
1030131634 7:106206790-106206812 AATGTGCCAGAGATTTATTAGGG + Intergenic
1030312360 7:108081513-108081535 CAACTGCAAGTGATTTATTAAGG - Intronic
1030322907 7:108187965-108187987 GAAGTGCAAGAGGTCTATTTGGG + Intronic
1030382168 7:108824750-108824772 GATATGCAAGAGACTTATTGAGG + Intergenic
1030640795 7:112003958-112003980 AAAGTTCCAGAGATTAATAGCGG + Intronic
1030677971 7:112404806-112404828 GAACTGCAAGAGATTTCTTTGGG + Intergenic
1031480439 7:122271789-122271811 AAAGGGCAAGAGAAGTTTTGGGG + Intergenic
1031536981 7:122946829-122946851 GACATGCAAAAGATTTATTGGGG + Intergenic
1031895741 7:127346724-127346746 AATGTGCAAGAGTTTTATTAAGG + Intergenic
1032561692 7:132899180-132899202 AAAGTACAAGAGACTGATTATGG + Intronic
1033219522 7:139519073-139519095 TAAGTGCAAGTAATTTATTTCGG + Intergenic
1034599945 7:152241177-152241199 AAAATGCCAGACATTTATTGAGG - Intronic
1035975443 8:4305376-4305398 ATAGAGCAAGAGATTTGCTGAGG + Intronic
1037219768 8:16504511-16504533 GACATGCAAGAGATTTATTGGGG + Intronic
1038137308 8:24801724-24801746 GATGAGCAAGAGATTTATTGGGG + Intergenic
1038390058 8:27189256-27189278 AATATACAAGGGATTTATTGAGG + Intergenic
1038516241 8:28189930-28189952 AAAACGCAAGTGATTTTTTGGGG - Exonic
1041259553 8:56008880-56008902 TAAGAGCAAGATATTAATTGAGG - Intronic
1041834586 8:62197501-62197523 GATGTGCAAGAGATTTATTGAGG + Intergenic
1042437772 8:68787587-68787609 AAAGTGAAATAGCTTTATTGTGG - Intronic
1042843337 8:73146846-73146868 GAAGTGCAACAGACTTATTAGGG + Intergenic
1043328501 8:79083445-79083467 ACAGTGCAATAGATTAATAGAGG + Intergenic
1043928166 8:86061238-86061260 CATGTGCAAGTGATTTATTATGG - Intronic
1044452936 8:92359484-92359506 AGAGAGAAAGAGATTGATTGGGG + Intergenic
1045321989 8:101089181-101089203 GAAATGCAAAAGATTTATTGGGG + Intergenic
1045336784 8:101211881-101211903 AAACTGAAAGAGTTTTCTTGGGG + Intergenic
1045696102 8:104810495-104810517 CAAGTGCAAGTGATTTGTTAAGG + Intronic
1046570323 8:115956054-115956076 TAAGTACAAGAGTTTTCTTGTGG - Intergenic
1047023236 8:120799219-120799241 TAAGTGCAAGAAGTTTATTTGGG - Intronic
1047268790 8:123334678-123334700 ATTTTGCAAGAGATTTATAGAGG + Intronic
1047336238 8:123939447-123939469 GAAGTGCTGGAGATTTATTCGGG + Intronic
1047510923 8:125514749-125514771 AAAATTCAAGAGATTTTCTGTGG + Intergenic
1047822452 8:128536118-128536140 ATAGTGCAAGAGATCTCTTGAGG - Intergenic
1048099946 8:131340376-131340398 GATGTGCAAGAGGTGTATTGGGG + Intergenic
1048224034 8:132567664-132567686 GAACTGCAAGAGATTTACTGGGG - Intergenic
1048848030 8:138617945-138617967 AAAGGGCTAGGGATTTCTTGGGG + Intronic
1050014736 9:1221827-1221849 CCTGTGCAAGTGATTTATTGAGG + Intergenic
1050274509 9:3982949-3982971 AAAGTGAAGGACATTGATTGAGG + Intronic
1050547746 9:6723033-6723055 AAACAGCAAGAGATTTACAGTGG + Intronic
1050620109 9:7443127-7443149 TAAGTGTAAGAGTTTTATTTGGG - Intergenic
1050936256 9:11399355-11399377 CATGTACAAGAGATCTATTGAGG - Intergenic
1051126877 9:13814676-13814698 AGAGTGCAAGAAAATAATTGTGG - Intergenic
1051899057 9:22018832-22018854 ATAGTGTATGATATTTATTGGGG - Intronic
1051903043 9:22063473-22063495 AAAATTGAAGAGATTAATTGAGG + Intergenic
1053832881 9:42102796-42102818 AAATTGGGAGTGATTTATTGAGG - Intronic
1055341672 9:75290917-75290939 CAAGTGCAAGTGATTTATTTGGG - Intergenic
1055353796 9:75416971-75416993 AAAGTTCTATACATTTATTGGGG + Intergenic
1055505359 9:76942587-76942609 TACATGCAGGAGATTTATTGGGG - Intergenic
1055717829 9:79137764-79137786 AGTGGGCAAGAGATTTGTTGAGG - Intergenic
1055958077 9:81792957-81792979 AATGTGCAGGATATTTATTAAGG - Intergenic
1057134589 9:92678651-92678673 AAAGTTCTAGAGATTAATGGTGG + Intergenic
1057341677 9:94207634-94207656 GGAGTGCAAGAGGTTTATTGAGG - Intergenic
1058347280 9:103979298-103979320 GTAGTGAAGGAGATTTATTGAGG + Intergenic
1058634767 9:107025949-107025971 AGAAAGCAAGAGATTTATTATGG - Intergenic
1058752328 9:108051645-108051667 CAAGTGCAAGTGATTTATTAGGG - Intergenic
1059977335 9:119731487-119731509 ACAGTGCAAGTGGTTTATTGGGG - Intergenic
1060060454 9:120454931-120454953 AGAGTGTAAGGGATTTATTTGGG - Intronic
1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG + Intergenic
1185559084 X:1044857-1044879 AAACTTCAAGAGACTTAGTGCGG - Intergenic
1185916313 X:4039367-4039389 AGAGAGCAAGAGATTGAATGGGG - Intergenic
1186456549 X:9714392-9714414 GATGGGCGAGAGATTTATTGGGG + Intronic
1187177604 X:16910745-16910767 TATGTGCAGGAGATTTATTAGGG + Intergenic
1188104243 X:26129804-26129826 AATGGGAAAGAAATTTATTGAGG + Intergenic
1188182839 X:27076585-27076607 AATGTACAAGTGATTTATTAAGG + Intergenic
1188465838 X:30480070-30480092 TATGTGCAAGTGATTTATTAAGG - Intergenic
1188578326 X:31680282-31680304 TAAGAGCAAGTGATTTATTTGGG - Intronic
1188652129 X:32644538-32644560 TCAGTGCAAGTGATTTATTAAGG + Intronic
1188774575 X:34198401-34198423 GAAGTACAAGAAATGTATTGAGG - Intergenic
1188805110 X:34578624-34578646 GGAGTATAAGAGATTTATTGGGG + Intergenic
1189121529 X:38400441-38400463 GACTTGCAAGAGATTTATTGAGG + Intronic
1189125254 X:38438630-38438652 ACTGTGCAAGAGAGTCATTGAGG - Intronic
1189200777 X:39194003-39194025 TGAGTGCAAGAGGTTTATTGAGG + Intergenic
1189280708 X:39818674-39818696 TAAGTGTGAGAGATGTATTGGGG + Intergenic
1189684728 X:43552007-43552029 AAAATGCAAGCAGTTTATTGAGG - Intergenic
1189752241 X:44234101-44234123 AATATGCAAGAGATTTAATAGGG - Intronic
1193815482 X:86100503-86100525 AAAGTCCAAGATATATTTTGTGG - Intergenic
1194811162 X:98388956-98388978 TGTGTGCAAGAGGTTTATTGAGG + Intergenic
1194940153 X:99999402-99999424 GATTTGCAATAGATTTATTGAGG + Intergenic
1195032043 X:100935778-100935800 GATATGCAAGAGATTGATTGAGG - Intergenic
1195598340 X:106718648-106718670 AAAGTACAAGAACTTTAATGGGG - Intronic
1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG + Intergenic
1195811286 X:108833413-108833435 AAAGTGGAAGAGATTTAATCTGG - Intergenic
1196315585 X:114219114-114219136 AAAATGCAAGAGGTTTACTGGGG + Intergenic
1197423262 X:126264382-126264404 AAAGTGAAACAGCCTTATTGTGG - Intergenic
1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG + Intergenic
1197645714 X:129014437-129014459 AAAGGGAAAGAGATTTATTTAGG + Intergenic
1197979226 X:132198215-132198237 AAAGAGCAAGAGCTTTAATAGGG - Intergenic
1198155459 X:133955459-133955481 GATGTGCAAGGGATTTATTGGGG - Intronic
1198370932 X:135988248-135988270 AAAGTGCAAGAGTGTTAGTCTGG + Intronic
1198832873 X:140769671-140769693 AAACTGTAAAAGATTTGTTGAGG - Intergenic
1199128075 X:144148424-144148446 AAAGGGCAGTAGATTAATTGTGG + Intergenic
1200427780 Y:3040401-3040423 GGAGTACAAGAAATTTATTGGGG + Intergenic