ID: 1008956596

View in Genome Browser
Species Human (GRCh38)
Location 6:57222311-57222333
Sequence GAGCATGCGCAGACGAAGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008956596_1008956605 18 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956605 6:57222352-57222374 TGCCCCGCCCCTGTTCTGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 190
1008956596_1008956611 25 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956611 6:57222359-57222381 CCCCTGTTCTGGCGGGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 133
1008956596_1008956608 21 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956608 6:57222355-57222377 CCCGCCCCTGTTCTGGCGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 129
1008956596_1008956601 14 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956601 6:57222348-57222370 GCCCTGCCCCGCCCCTGTTCTGG 0: 1
1: 1
2: 4
3: 54
4: 498
1008956596_1008956598 -8 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956598 6:57222326-57222348 GCATGCTCTGTGCGGACCCGCGG 0: 1
1: 0
2: 1
3: 2
4: 74
1008956596_1008956604 17 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956604 6:57222351-57222373 CTGCCCCGCCCCTGTTCTGGCGG 0: 1
1: 1
2: 3
3: 24
4: 220
1008956596_1008956614 28 Left 1008956596 6:57222311-57222333 CCGTGCTTCGTCTGCGCATGCTC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1008956614 6:57222362-57222384 CTGTTCTGGCGGGTGGCTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008956596 Original CRISPR GAGCATGCGCAGACGAAGCA CGG (reversed) Exonic