ID: 1008956615

View in Genome Browser
Species Human (GRCh38)
Location 6:57222365-57222387
Sequence TTCTGGCGGGTGGCTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008956600_1008956615 -1 Left 1008956600 6:57222343-57222365 CCGCGGCCCTGCCCCGCCCCTGT 0: 1
1: 2
2: 17
3: 173
4: 1330
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956603_1008956615 -8 Left 1008956603 6:57222350-57222372 CCTGCCCCGCCCCTGTTCTGGCG 0: 1
1: 0
2: 3
3: 40
4: 348
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956602_1008956615 -7 Left 1008956602 6:57222349-57222371 CCCTGCCCCGCCCCTGTTCTGGC 0: 1
1: 0
2: 4
3: 77
4: 627
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956599_1008956615 0 Left 1008956599 6:57222342-57222364 CCCGCGGCCCTGCCCCGCCCCTG 0: 1
1: 0
2: 14
3: 171
4: 1081
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008956615 Original CRISPR TTCTGGCGGGTGGCTGGCGG CGG Intergenic
901442369 1:9286206-9286228 TTCTGCAGGGTAGCTGGAGGGGG - Intergenic
902259522 1:15214288-15214310 TTCTGGAGGGTGGTTGGGGGTGG + Intronic
902507308 1:16946679-16946701 TGCTGGTGGGTGGGTGGAGGAGG + Intronic
902771581 1:18648234-18648256 TTCTGGGAGATGGCTGGGGGTGG - Intronic
903275152 1:22216880-22216902 TTCTTGCTGGAGGTTGGCGGGGG + Intergenic
903935314 1:26891084-26891106 TGCTGGTGGGTGGCTGGCGGCGG + Exonic
904146657 1:28398228-28398250 ATCTGTTGGGTGGCTGGCCGGGG + Intronic
904620764 1:31773691-31773713 CTGTGGCGGGGGGTTGGCGGGGG - Intergenic
905924000 1:41737007-41737029 TTGTGGCTGGTGCCTGGAGGTGG - Intronic
906522266 1:46474649-46474671 GGCTGGCGGGTGGGGGGCGGCGG - Intergenic
907425281 1:54375628-54375650 TTCTGGAGGGGGACTGGCTGGGG - Intronic
908979256 1:69934488-69934510 TTTTGGCGGGGGGGGGGCGGGGG + Intronic
909358191 1:74732580-74732602 ATCAAGCGGGTGACTGGCGGGGG + Intronic
913523646 1:119669714-119669736 TGCAGGCAGGTGGCTGGCGTAGG - Intronic
914928572 1:151909589-151909611 TACTGGCGGCTGGCTGGCCGGGG + Exonic
916107214 1:161441013-161441035 GTGTGGCGGGTGGCGGGCGGCGG - Intergenic
916108801 1:161448431-161448453 GTGTGGCGGGTGGCGGGCGGCGG - Intergenic
916110389 1:161455812-161455834 GTGTGGCGGGTGGCGGGCGGCGG - Intergenic
916111974 1:161463222-161463244 GTGTGGCGGGTGGCGGGCGGCGG - Intergenic
916113561 1:161470603-161470625 GTGTGGCGGGTGGCGGGCGGCGG - Intergenic
917383932 1:174447893-174447915 TTCGGGCGGGGGGGTGGGGGGGG - Intronic
917515680 1:175706069-175706091 TTTTGGTGGGGGGTTGGCGGGGG - Intronic
917854116 1:179087778-179087800 TTCTGGCGGGGGGCGGGGGGTGG + Intronic
918123327 1:181558625-181558647 GACTGGAGGGTGGCAGGCGGAGG + Intronic
918452424 1:184672393-184672415 TTCTGGAGGGTGGGAGACGGAGG + Intergenic
921060661 1:211581377-211581399 TCCTGGTGGGTGGTTGGGGGCGG + Intergenic
921326297 1:213988756-213988778 TTCCTGCTGGTGGCTGGGGGTGG + Intronic
923551836 1:234970385-234970407 TTCTGGGGGGTGGGTTGGGGCGG - Intergenic
924501974 1:244646199-244646221 TTCTGGCGGGTTGCAGGGGGAGG + Intergenic
924559521 1:245146223-245146245 TTCTTGCTGGGGGGTGGCGGGGG - Intergenic
924625261 1:245692209-245692231 TTCTGGTGTGTGGGTGGAGGTGG + Intronic
1063115331 10:3068189-3068211 TTCTAGGGGGTGGCGTGCGGCGG - Intronic
1063464141 10:6232244-6232266 TTGCGGGGGGTGGGTGGCGGGGG + Intronic
1063473702 10:6309631-6309653 TTTTGGCTGGTGGCCGGCGGGGG - Intergenic
1068083229 10:52346318-52346340 TTTTGGGGGGTGGGGGGCGGGGG - Intergenic
1069544896 10:69320754-69320776 TGCTGGCTGTTGGCTGCCGGTGG + Intronic
1069912184 10:71766354-71766376 AGGTGGCGGGTGGCGGGCGGGGG - Intronic
1073479888 10:103779770-103779792 TTCTGGCAGGTTCCTGGCTGTGG + Intronic
1075206396 10:120453154-120453176 ATGTGGCGGGTGGCAGGTGGCGG + Intergenic
1076071369 10:127492590-127492612 TTTTGGCGGGGGGCGGGGGGCGG + Intergenic
1077329723 11:1978876-1978898 TTCCGGCGGGCGGCAGGTGGAGG + Intronic
1080616970 11:33953006-33953028 TTCTGGTGGGTGGTTGGAAGAGG - Intergenic
1083938839 11:65884333-65884355 TCCTGGCAGGTGGCAGGCTGGGG + Intronic
1084308894 11:68304536-68304558 TTCTGGGGTGTGGATGGTGGCGG - Intergenic
1084570641 11:69957677-69957699 TTCTGTGGGGTGGGTGGCGGGGG - Intergenic
1084606423 11:70175009-70175031 ATGTGGCAGGTGGCGGGCGGGGG - Intronic
1087727708 11:101741267-101741289 TTCTGGCATATGGCTGGGGGTGG + Intronic
1202812701 11_KI270721v1_random:34055-34077 TTCCGGCGGGCGGCAGGTGGAGG + Intergenic
1091809607 12:3384946-3384968 GTGTGGCGGGTGGGGGGCGGGGG + Intronic
1097106456 12:56629190-56629212 TTCCTGCGGGAGGCTGGGGGAGG + Intronic
1097153019 12:56993666-56993688 GTGTGGTGGGTGGCTGGCAGGGG - Intergenic
1100686563 12:96992731-96992753 TTGTGGTGGGTGGCGGGGGGTGG - Intergenic
1103774609 12:123357603-123357625 TGGTGGCGGGTGCCTGGTGGCGG + Intronic
1103857812 12:123986107-123986129 GTCTGGCGGGGGGCTGGAGGGGG + Intronic
1104414787 12:128589248-128589270 TGCTGTGGGGTGGCTGGTGGAGG - Intronic
1104992536 12:132634209-132634231 TTCTGGCAGGAGGCTGCCTGTGG + Exonic
1105316188 13:19266197-19266219 TCCTGGCTGGTGGCAGGCTGGGG + Intergenic
1106555454 13:30804633-30804655 TGCAGGCAGGTGGCCGGCGGTGG + Intergenic
1109510770 13:63369031-63369053 TTCTGGGGAGTGGGTGGCAGGGG + Intergenic
1112883031 13:104133046-104133068 TTCTGGGGAGTGGCTGGGAGGGG + Intergenic
1114610375 14:24036332-24036354 GACTGGCGGGCGGCGGGCGGCGG + Intergenic
1114683411 14:24506179-24506201 ATGTGCCGGGTGGCTGGCTGGGG - Exonic
1114755264 14:25252626-25252648 AGCTGGCGGGTGGCGGGTGGGGG + Intergenic
1116944273 14:50821807-50821829 TTCTGCCGGGGTGCTGGGGGTGG - Intronic
1117097703 14:52314682-52314704 TGCTGGCGCGCCGCTGGCGGGGG + Exonic
1117548499 14:56811806-56811828 TGGTGGTGGGTGGGTGGCGGGGG - Intergenic
1119046254 14:71320919-71320941 GGCTGGCGGGGGGCCGGCGGGGG - Intronic
1124655021 15:31500571-31500593 CTCTGGCGGAGGGCTGGGGGAGG + Intronic
1125508577 15:40281282-40281304 TTCTGGTGGAGGGCTGGTGGAGG + Intronic
1128309735 15:66622471-66622493 TTAGGGCGGGGGGCTGCCGGGGG - Intronic
1129033193 15:72632976-72632998 TGCTGGCATGTGGCAGGCGGAGG - Intergenic
1129170377 15:73803923-73803945 TGCTGGCGGGTGCCAGGCTGTGG + Intergenic
1129216691 15:74104254-74104276 TGCTGGCATGTGGCAGGCGGAGG + Intronic
1129225497 15:74168187-74168209 CTCTGTCTGGTGGCTGGGGGTGG + Intergenic
1129407983 15:75331831-75331853 TGCTGGCATGTGGCAGGCGGAGG - Intergenic
1129471147 15:75754610-75754632 TGCTGGCATGTGGCAGGCGGAGG - Intergenic
1129733857 15:77948567-77948589 TGCTGGCATGTGGCAGGCGGAGG + Intergenic
1129841727 15:78747436-78747458 TGCTGGCATGTGGCAGGCGGAGG - Intergenic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1132570485 16:641952-641974 ATCTGGCCGGGGGCCGGCGGCGG + Exonic
1132741608 16:1416159-1416181 TTTTGGCGGGGGGCGGGGGGAGG + Intergenic
1132888046 16:2191049-2191071 CTCTGGCAGCTGGCTGGGGGAGG - Intronic
1133138260 16:3727488-3727510 TTTTGGCGGGGGGGTGGGGGGGG - Exonic
1133868555 16:9667028-9667050 GTCTGCTGGGCGGCTGGCGGAGG - Exonic
1136457816 16:30391835-30391857 TTTTGGCGGGGGGGTGGGGGTGG + Intronic
1136958007 16:34806223-34806245 TTCTGCCGCGTGGCTGCTGGAGG + Intergenic
1138301055 16:55930181-55930203 TTCTGACAGGTTGCTGGGGGAGG - Intronic
1138467492 16:57202226-57202248 TTACGGGGGGTGGGTGGCGGGGG + Intronic
1139400219 16:66675367-66675389 TTCTGGCTGTTGGCTGGGCGTGG - Intronic
1141579444 16:84987130-84987152 TTCTGGCTGCTGGCAGGCTGTGG - Intronic
1142704696 17:1687389-1687411 TTCTGGGGGGTGGCCGGGCGCGG + Intergenic
1142713075 17:1733790-1733812 ATCTCGGGGGTGGGTGGCGGGGG + Exonic
1143547116 17:7604029-7604051 TTGTGGCTGGTGGCTGGCCCGGG - Exonic
1143872344 17:9965972-9965994 TTTTGGGGGGTGGGTGTCGGGGG - Intronic
1144461339 17:15460888-15460910 GGCTGGAGGGTGGTTGGCGGTGG - Intronic
1145269868 17:21399093-21399115 TGCTGGCAGGAGGCTGGAGGTGG + Intronic
1146190297 17:30759710-30759732 TTTTGGTGGGTGGGTGGTGGGGG + Intergenic
1146332267 17:31937206-31937228 GCCCGGCGGGTAGCTGGCGGGGG + Exonic
1147446124 17:40476216-40476238 TTCTGGAGGCTGGGTGGGGGTGG + Exonic
1148785494 17:50144245-50144267 GTCTGGCAGGTGGCAGGTGGTGG - Intronic
1148895022 17:50834523-50834545 TTCTGGCAGATGGATGGGGGAGG + Intergenic
1149552242 17:57548900-57548922 TTTTGGCGGGGGGGTGGGGGGGG - Intronic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1150407925 17:64919006-64919028 TGCTGGGGTGGGGCTGGCGGCGG + Intronic
1150531690 17:65990428-65990450 ATCTGGCTGGTGGATGGGGGAGG - Intronic
1151956792 17:77384136-77384158 GGCTGGCGGGAGGCTGGCTGGGG + Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152811381 17:82384313-82384335 TGGTGGCAGGTGCCTGGCGGCGG + Intergenic
1152851931 17:82642042-82642064 TTCTGGAGGGTGGCAGCCGAGGG + Intronic
1153201887 18:2655687-2655709 CGGTGGCGGGTGGCGGGCGGCGG - Intergenic
1153739238 18:8105782-8105804 TTCTGGGGGGTGACTGGCAGTGG - Intronic
1155229063 18:23756446-23756468 TTTTGGCGGGGGGGTGGGGGCGG - Intronic
1155591186 18:27428993-27429015 TTCTGGAGGGTGGGTGGCACAGG - Intergenic
1158960558 18:62584473-62584495 TTCTGGTGAGAGGCTGGTGGAGG - Intronic
1160425629 18:78777264-78777286 TTATGGTGGGTGGCTGGCATGGG - Intergenic
1160778389 19:867040-867062 CCCTGGCGGGTGGTTGGGGGCGG - Intergenic
1160981856 19:1819906-1819928 TCCTGGCGGGTGGGCGGGGGAGG - Intronic
1160994212 19:1874832-1874854 TTCTGTTGGGTGGATGGTGGTGG - Intergenic
1161007585 19:1944233-1944255 TTCTCTCGTGTGGCTGCCGGCGG - Intronic
1161044989 19:2129941-2129963 CTCTGGCGTGTGGCAGGCGTGGG - Intronic
1161853361 19:6750371-6750393 GTCTGGCGGGGCGCTAGCGGGGG - Exonic
1161857192 19:6772746-6772768 TGCGGGCGGGTGGGTGGTGGAGG + Exonic
1162327766 19:10008963-10008985 ATTTGGCGGGTGGCTGAAGGGGG + Intronic
1162561289 19:11419332-11419354 GGGTGGCGGGTGGCGGGCGGCGG + Intronic
1162883528 19:13678493-13678515 TTCTGCGGTGTGGCGGGCGGGGG - Intergenic
1163621880 19:18365828-18365850 TGCTGGCGGGTGACTTGCAGTGG + Exonic
1164702182 19:30293518-30293540 TACTGGGGGCTGGCAGGCGGGGG - Intronic
1165845091 19:38812942-38812964 TGGTGGCGGATGGCAGGCGGTGG + Exonic
1165903504 19:39179569-39179591 TTCTGGGGAGTGGCAGGCTGGGG - Intronic
1167250098 19:48394899-48394921 TTCTGTTGGGGGGATGGCGGGGG - Exonic
1168057893 19:53873680-53873702 TTCTCGCTGGTGGCTAGCGTGGG + Exonic
927936457 2:27079213-27079235 CTGTGGCGGCTGGCTGGCCGGGG - Exonic
929683120 2:44011320-44011342 TTTTGGGGGGTGGGTGGTGGGGG + Intergenic
931601084 2:64003838-64003860 TTCTGGCTGGTGGTTGGGGTTGG - Intronic
932495190 2:72142723-72142745 TTCTGGGGAGTGGCTGGAAGGGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935262450 2:101367016-101367038 TTTTGGTGGGGGGCTGGAGGAGG + Intronic
936089161 2:109489734-109489756 TTTTGGCGGGGGGTGGGCGGGGG + Intronic
937099655 2:119259122-119259144 TTCAGGCAGGTGGCTGGAGTGGG - Intronic
937221797 2:120346235-120346257 TGCTGGCGGCCGGCTGGCTGGGG + Exonic
937231465 2:120400502-120400524 TTTTGGCGTGTGGGTGGCGCGGG + Intergenic
938287643 2:130130484-130130506 TTCTGGGGGGTGGATGGAGGGGG + Intergenic
938322464 2:130374245-130374267 GTCTGGCGGGGGTCTGGCTGGGG - Exonic
938427950 2:131208375-131208397 TTCTGGGGGGTGGATGGAGGGGG - Intronic
938673885 2:133611258-133611280 TGGTGGCGGGTGGCGGGTGGAGG - Intergenic
941111026 2:161418724-161418746 GGCTGGCGGCTGGCTGGCTGGGG - Intronic
941541027 2:166784652-166784674 CTCTGGGGGGTGGGGGGCGGGGG - Intergenic
942046643 2:172102796-172102818 CTCTGGCGGGGGGCGGGCAGTGG + Exonic
942085993 2:172444586-172444608 TTTTGGCGGGGGGCGGGGGGCGG - Intronic
942135216 2:172918834-172918856 ATCTGAAGGGTGGCTGGCTGTGG - Intronic
942155309 2:173121740-173121762 TGGTGGCGGGTGGGCGGCGGGGG - Intronic
943809606 2:192168324-192168346 TTGTGGGGGGTGGGTGGCAGGGG - Intronic
944650830 2:201828728-201828750 TTCTGGAGGGTGGCTTGCCTGGG - Intronic
947946816 2:234110823-234110845 TTGTGGTTGGGGGCTGGCGGAGG + Intergenic
948140515 2:235669629-235669651 GGGTGGCGGGTGGCGGGCGGCGG - Intronic
948178229 2:235960469-235960491 TTCTCTGGGGTGGCTGGAGGTGG + Intronic
948487350 2:238289197-238289219 CTCTGGCCGGTGGCCGGAGGTGG - Intronic
949014499 2:241701898-241701920 TTCCGGCGGGCGGCGGGCTGCGG - Intergenic
1169455194 20:5746456-5746478 TTCATGCAGCTGGCTGGCGGTGG + Intergenic
1171251536 20:23652907-23652929 TGCTGGCTGGTGGCTGGAAGTGG + Intergenic
1172866012 20:38097930-38097952 TTTTGCAGGGGGGCTGGCGGCGG + Intronic
1174349761 20:49958540-49958562 TTCTGGCTGCTTGGTGGCGGAGG - Intergenic
1178478206 21:32956185-32956207 TTCTGGCTGGAGACTGGCAGGGG + Intergenic
1178663343 21:34524829-34524851 TCCTGGAGTGTGGCTGTCGGTGG + Intronic
1179207147 21:39292112-39292134 TTGTGGGGGGTGGGTGGGGGTGG + Intronic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1179788217 21:43741366-43741388 GGCTGGCGGGGGGCTGGCGGGGG + Intronic
1179788222 21:43741377-43741399 GGCTGGCGGGGGGCTCGCGGGGG + Intronic
1179992270 21:44954269-44954291 TTCTGGCCGGTGGGTTGCTGAGG + Intronic
1181592909 22:23895730-23895752 TTCAGGCGGGTGGGTGGGGGAGG + Intronic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1182444678 22:30383192-30383214 GTCTGAAGGGTGGCTGGAGGAGG - Intronic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1185107641 22:48883368-48883390 TGCTGGCGCTCGGCTGGCGGTGG + Intergenic
949349605 3:3112029-3112051 TTCTGGCGGGGGGTTGCGGGGGG + Intronic
950089054 3:10281985-10282007 TTCTGGGGGGAGGCGGGGGGAGG - Intronic
954452144 3:50577412-50577434 TTCTGGTGGGGGGTTGGAGGAGG + Intronic
962037605 3:131669155-131669177 TTCTGGAGGTTGGCTGGCTGTGG - Intronic
965302396 3:167019020-167019042 ATGGGGCGGCTGGCTGGCGGGGG - Intergenic
965590795 3:170358199-170358221 TTCTGGCCCGGGGCTGGCGCGGG + Intronic
967077024 3:186012712-186012734 TTGTGGCGTGTGCATGGCGGGGG + Intergenic
968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG + Exonic
968704664 4:2072341-2072363 GTCTGGGAGGTGGCTGGGGGTGG - Intronic
968726955 4:2252257-2252279 ATCTGGCGGGTGTGTGTCGGGGG - Intronic
968810604 4:2798090-2798112 TGCTGCCGGGTGGCAGGCAGCGG - Intronic
968900811 4:3430910-3430932 TCCTGGGGGGTGGAGGGCGGCGG - Exonic
969542132 4:7799023-7799045 AACTGGAGGGTGGATGGCGGTGG - Intronic
969911772 4:10454151-10454173 TTCTTGTGGGTGCCTGGAGGTGG + Intronic
971173453 4:24257988-24258010 TTATGGAGGGTGGCAGGCGGAGG + Intergenic
975848919 4:78551909-78551931 TGCTGACGGGTGGCTTGGGGAGG + Intronic
978987101 4:115026678-115026700 TTTTGGCGGGGGGGTTGCGGGGG + Intronic
981723554 4:147825087-147825109 TCCTGGGTGGTGGCTGGTGGGGG + Intronic
985101833 4:186466104-186466126 TTTTGGCGGGTGGGGGGAGGGGG - Intronic
985128109 4:186715120-186715142 TTCTGGTGGGGGGATGGAGGGGG - Intronic
985493771 5:193396-193418 TGCTGGGGGGTGCCTGGCGGTGG + Intronic
987175166 5:15300395-15300417 TTCTGGGAGTTGGCTGGCGGTGG - Intergenic
989634095 5:43516153-43516175 TTCTAGTGGGTGGGTGGCAGGGG - Intergenic
996746890 5:126853654-126853676 TTCACTCTGGTGGCTGGCGGGGG - Intergenic
998148681 5:139745007-139745029 TTCTGGGGGGTGGCAGGTGGTGG + Intergenic
998227560 5:140338742-140338764 GTCTGGTGGGTGGCTGGCTCTGG - Intronic
1002597254 5:180332221-180332243 TCCTGGCGGGGAGGTGGCGGGGG + Intronic
1006094098 6:31645011-31645033 GGGTGGCTGGTGGCTGGCGGGGG + Exonic
1006110243 6:31740137-31740159 TCCTGGCGCGTGGTTGGCAGAGG + Intronic
1007375453 6:41453157-41453179 TTGTGGCGGGTGGTGGGTGGTGG - Intergenic
1007403790 6:41620812-41620834 TTTTGGGGGGTGGCAGGGGGAGG + Intergenic
1007702272 6:43772065-43772087 TTCCCGCGGAGGGCTGGCGGGGG - Intronic
1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG + Intronic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1010250322 6:73700396-73700418 TTCTGTTGGGGGGCTGGGGGTGG - Intronic
1010794837 6:80106771-80106793 TCCTGGCGCGGGGCTGGCGCGGG + Exonic
1018014375 6:159698928-159698950 GTCTGGGGGGTGGGGGGCGGGGG + Intronic
1020083653 7:5299219-5299241 GGCTGGAGGGTGGCGGGCGGGGG - Exonic
1023372944 7:39530121-39530143 ATGTGGCGGGTGGGTGGAGGAGG + Intergenic
1024397768 7:48888810-48888832 TGCTGGCAGGTGGCTGGGGGGGG + Intergenic
1024529986 7:50383673-50383695 CCCTGGCTGGTGGCTGGCTGGGG - Intronic
1025763340 7:64415764-64415786 TTCTGTGTGGTGGCTGGTGGGGG + Intergenic
1027035281 7:74920652-74920674 TTCTGGCTGGAGGCAGGTGGAGG - Intergenic
1029394772 7:100300488-100300510 TTCTGGCTGGAGGCAGGTGGAGG + Intergenic
1030582244 7:111372449-111372471 ATCTGGTGGGTGGCAGGTGGAGG - Intronic
1030816758 7:114048703-114048725 TTGTGGTGGGTGGGTGGGGGAGG - Intronic
1031366533 7:120906696-120906718 TTGGGGTGGGTGGCTGGAGGAGG + Intergenic
1036298251 8:7553013-7553035 TTTTGGCGGGGGGGGGGCGGGGG - Intergenic
1036299556 8:7560663-7560685 TTTTGGCGGGGGGGGGGCGGGGG - Intergenic
1036300861 8:7568309-7568331 TTTTGGCGGGGGGGGGGCGGGGG - Intergenic
1036302167 8:7575957-7575979 TTTTGGCGGGGGGGGGGCGGGGG - Intergenic
1036920964 8:12854888-12854910 TGCTGGCTGGTGGCGGGGGGTGG + Intergenic
1037935966 8:22915284-22915306 GTTTGGCTGGTGGCTGGGGGAGG - Intronic
1040393867 8:46975985-46976007 TTCTGGTAGGTGGATGGCAGAGG - Intergenic
1040415443 8:47190748-47190770 TTCGGGTGGGGGGCTGGGGGAGG - Intergenic
1042612579 8:70614804-70614826 TTGTGGAGGGGGGCTGGCTGAGG + Intronic
1046672686 8:117074022-117074044 TTGGGGCGGGTGGGTGGGGGTGG + Intronic
1047316172 8:123735641-123735663 TGATGGCTGGTGGCTGGTGGAGG + Intronic
1047771174 8:128031210-128031232 GGGTGGCGGGTGGCTGGCAGGGG + Intergenic
1047926165 8:129684952-129684974 TTTTGGCTGGTGACTGGAGGAGG - Intergenic
1047987992 8:130256398-130256420 ATCTGGGGGGTGGGGGGCGGTGG + Intronic
1049389486 8:142360622-142360644 TTCAGGCTGGTGGGGGGCGGGGG - Intronic
1049983305 9:924543-924565 TTTTGGCAGGTGCCTGGCAGTGG + Intronic
1052362198 9:27573390-27573412 TCCTGGCGGGTGGCTGTTTGGGG - Intronic
1056587891 9:87940128-87940150 TTTTGGGGGGTGGATGGAGGGGG + Intergenic
1056608976 9:88112817-88112839 TTTTGGGGGGTGGATGGAGGGGG - Intergenic
1056710983 9:88991640-88991662 TCCTAGCGGGTGGCGCGCGGCGG - Exonic
1057550595 9:96048887-96048909 GTCTGGGTGGTGGCTGGCTGTGG + Intergenic
1058357008 9:104094522-104094544 TCCTGGCGGGAGGCGGGAGGCGG + Intronic
1060376504 9:123119381-123119403 TTTTGGCGGGGGGCGGGGGGTGG - Intronic
1060809434 9:126602768-126602790 TCCTGGTGGGTGGGGGGCGGAGG + Intergenic
1061224936 9:129275921-129275943 TTCTGCCAGGTGGATGGAGGAGG - Intergenic
1061273604 9:129557637-129557659 TTCAGGCTGGAGGCTGGTGGGGG - Intergenic
1062111791 9:134785891-134785913 TTCTGGCAGGGGCCTGGAGGAGG - Intronic
1062391272 9:136334868-136334890 TGCTGGCGGGTGAGTGGGGGTGG + Intronic
1062428128 9:136515453-136515475 GCCAGGCGGGTGGCCGGCGGGGG - Intronic
1185460935 X:332547-332569 TTCTGGCGGGACGCTGGCCACGG + Intergenic
1186439468 X:9573585-9573607 TTCTGGACGGTGGCTAGCAGGGG + Intronic
1187579506 X:20593124-20593146 TCCTGGCGGGTGGGTGGGGAGGG - Intergenic
1187797558 X:23020964-23020986 TTCTGGGGGGAGGATGGGGGTGG + Intergenic
1192220985 X:69197206-69197228 CTGAGGCAGGTGGCTGGCGGGGG - Intergenic
1192962514 X:76145369-76145391 TGCTGGGGGAGGGCTGGCGGGGG + Intergenic
1192963019 X:76149718-76149740 TGCTGGGGGAGGGCTGGCGGGGG - Intergenic
1195764690 X:108283585-108283607 TTTTGGGGGGGGGTTGGCGGCGG + Intronic
1196128936 X:112131658-112131680 TTCTGGCAGGTGGATAGCAGGGG + Intergenic
1196828524 X:119758919-119758941 TCCTGCGGGGTGGCTGTCGGAGG + Exonic
1199628375 X:149760242-149760264 TTCTGCCAGGTGGTTGGGGGTGG + Intergenic
1200176817 X:154122769-154122791 TTCTGCTGGGTGGCTGGGCGTGG + Intergenic