ID: 1008956615

View in Genome Browser
Species Human (GRCh38)
Location 6:57222365-57222387
Sequence TTCTGGCGGGTGGCTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008956599_1008956615 0 Left 1008956599 6:57222342-57222364 CCCGCGGCCCTGCCCCGCCCCTG 0: 1
1: 0
2: 14
3: 171
4: 1081
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956602_1008956615 -7 Left 1008956602 6:57222349-57222371 CCCTGCCCCGCCCCTGTTCTGGC 0: 1
1: 0
2: 4
3: 77
4: 627
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956600_1008956615 -1 Left 1008956600 6:57222343-57222365 CCGCGGCCCTGCCCCGCCCCTGT 0: 1
1: 2
2: 17
3: 173
4: 1330
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232
1008956603_1008956615 -8 Left 1008956603 6:57222350-57222372 CCTGCCCCGCCCCTGTTCTGGCG 0: 1
1: 0
2: 3
3: 40
4: 348
Right 1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008956615 Original CRISPR TTCTGGCGGGTGGCTGGCGG CGG Intergenic